Application of GmTGA1L-a / b gene in increasing soybean nodule number and soybean breeding

The soybean GmTGA1L-a/b gene was knocked out by CRISPR/Cas9 gene editing technology, and the pKSE401-GmTGA1L-a/b vector was constructed, which solved the problem of regulating the number of soybean nodules and improved the efficiency of symbiotic nitrogen fixation and soybean yield.

CN119685340BActive Publication Date: 2025-09-26HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411866041.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-18
Publication Date
2025-09-26
Estimated Expiration
2044-12-18

AI Technical Summary

Technical Problem

Existing technologies have failed to effectively utilize TGA family transcription factors to regulate the number of soybean nodules, resulting in low efficiency of symbiotic nitrogen fixation and affecting soybean yield.

Method used

The soybean GmTGA1L-a/b gene was knocked out by CRISPR/Cas9 gene editing technology, and the pKSE401-GmTGA1L-a/b vector was constructed to increase the number of nodules and promote symbiotic nitrogen fixation.

Benefits of technology

Significantly increase the number of soybean nodules, promote symbiotic nitrogen fixation, and increase soybean yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685340B_ABST
    Figure CN119685340B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of genetic engineering technology, and in particular to the use of the GmTGA1L-a / b gene in increasing the number of soybean nodules and in soybean breeding. The present invention relates to the use of the GmTGA1L-a / b gene in increasing the number of soybean nodules or in soybean breeding. Research by the present invention has found that using the knockout vector constructed by the present invention to transform recipient soybean plants to obtain transgenic plants significantly increases the number of soybean nodules and promotes symbiotic nitrogen fixation, which is of great significance for increasing soybean yield.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and in particular to application of GmTGA1L-a / b gene in increasing the number of soybean nodules and in soybean breeding. Background Art

[0002] As an important economic and oilseed crop, soybeans are a major source of edible vegetable oil and plant protein, with enormous production potential worldwide. As a nitrogen-intensive crop, soybeans derive their nitrogen from three primary sources: soil, fertilizer, and symbiotic nitrogen fixation. Symbiotic nitrogen fixation can provide 70% of the total nitrogen required for soybean growth, and even up to 85% of the nitrogen required for soybean seeds. Therefore, symbiotic nitrogen fixation is a key factor in determining high soybean yields.

[0003] Symbiotic nitrogen fixation in soybeans is achieved through the symbiosis between soybeans and rhizobia, forming nitrogen-fixing organs - nodules. As exogenous microorganisms, the rhizobia infection process will inevitably stimulate the plant's immune response, hindering the establishment of a symbiotic relationship. Therefore, weakening the plant's immune response helps rhizobia infect soybeans and form more nodules for nitrogen fixation. TGA family transcription factors are important signaling molecules downstream of the salicylic acid signaling pathway. In addition to participating in the regulation of plant development and stress resistance, they also play an important role in the plant's disease resistance immune response. There are no reports on whether TGA transcription factors are involved in regulating soybean symbiotic nitrogen fixation. Summary of the Invention

[0004] The present invention aims to provide applications of the GmTGA1L-a / b gene for increasing soybean nodule number or in soybean breeding. This invention demonstrates for the first time that the soybean GmTGA1L-a / b transcription factor is involved in regulating nodule number, and that knocking out GmTGA1L-a / b in soybean hairy roots significantly increases nodule number.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides application of the GmTGA1L-a / b gene in increasing the number of soybean nodules or in soybean breeding.

[0007] Preferably, the gene numbers of the GmTGA1L-a and GmTGA1L-b genes are Glyma.11G236300 and Glyma.18G020900, respectively.

[0008] The present invention also provides an expression vector comprising an initial vector and the GmTGA1L-a and GmTGA1L-b genes.

[0009] Preferably, the initial vector is pKSE401.

[0010] The present invention also provides a host transformed or transfected with the expression vector; the host is a microorganism.

[0011] The present invention also provides the use of the expression vector or the host in regulating the number of soybean nodules or in soybean breeding.

[0012] The present invention also provides a silencing vector, comprising an original vector and the GmTGA1L-a and GmTGA1L-b genes.

[0013] The present invention also provides a silent recombinant bacterium transformed or transfected with the silencing vector.

[0014] The present invention also provides the use of the silencing vector or the silencing recombinant bacteria in increasing the number of soybean nodules or in soybean breeding.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] Research conducted in this paper has found that knocking out GmTGA1L-a / b can increase soybean nodule number. Compared with a control soybean, the number of nodules in soybean hairy roots significantly increased after GmTGA1L-a / b knockout. This is the first demonstration that the soybean TGA family transcription factor GmTGA1L-a / b is involved in regulating soybean nodulation. Transgenic plants obtained by transforming recipient soybean plants with the knockout vector constructed in this invention are expected to significantly increase soybean nodule number and promote symbiotic nitrogen fixation, which is of great significance for increasing soybean yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0018] Figure 1 This is the map of the pKSE401-GmTGA1L-a / b vector;

[0019] Figure 2 The nodulation phenotype and statistical results of GmTGA1L-a / b knockout hairy roots and the control group;

[0020] Figure 3 Examples of editing forms in GmTGA1L-a / b knockout hairy roots. DETAILED DESCRIPTION

[0021] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0022] Example 1 Construction of pKSE401-GmTGA1L-a / b vector

[0023] The CRISPR / Cas9 gene editing vector constructed in the present invention can edit the two genes GmTGA1L-a and GmTGA1L-b of the soybean TGA family, whose gene numbers are Glyma.11G236300 and Glyma.18G020900, respectively.

[0024] (1) Target site adapter primer design

[0025] Target selection was performed using the CRISPR-P website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), and two targets were selected. GmTGA1L-a (Glyma.11G236300) and GmTGA1L-b (Glyma.18G020900) were simultaneously knocked out using CRISPR-Cas9 technology. Specifically, target prediction was performed on the CRISPR-P website by gene number or genomic sequence, and the scoring and off-target conditions of the candidate targets were comprehensively evaluated based on the website, and high-scoring targets located in the gene coding region and with a low off-target probability were selected. Target 1 (sequence shown in SEQ ID No. 1) selected in the present invention can simultaneously target GmTGA1L-a and GmTGA1L-b, and target 2 (sequence shown in SEQ ID No. 2) can target GmTGA1L-a, and the bold portion is the PAM recognition site.

[0026] SEQ ID No.1:GTGTCCATACTCCATCTCAAAGG

[0027] SEQ ID No.2:CCACCTTTAGAAGCTCCGAGGGG

[0028] According to the selected target site, the vector construction primers DT1-BsF, DT1-F0, DT2-R0 and DT2-BsR were designed, and their sequences are shown in SEQ ID No.3, SEQ ID No.4, SEQ ID No.5 and SEQ ID No.6 respectively:

[0029] SEQ ID No.3:

[0030] ATATATGGTCTCGATTGTGTCCATACTCCATCTCAAGTT;

[0031] SEQ ID No.4:

[0032] TGTGTCCATACTCCATCTCAAGTTTTAGAGCTAGAAATAGC;

[0033] SEQ ID No.5:

[0034] AACCTCGGAGCTCTAAAGGTGCAATCTCTTAGTCGACTCTAC;

[0035] SEQ ID No.6:

[0036] ATTATTGGTCTCGAAACCTCGGAGGCTTCTAAAGGTGCAA;

[0037] The non-bold sequence in the primer sequence is the primer backbone sequence. The bold sequence in primer DT1-F0 / BsF (SEQ ID No. 3 / 4) is the 19-nt sequence obtained by removing one base at the 5' end and the three bases of the PAM recognition site NGG of target 1. The bold sequence in primer DT2-R0 / BsR (SEQ ID No. 5 / 6) is the 19-nt reverse complementary sequence obtained by removing one base at the 5' end and the three bases of the PAM recognition site NGG of target 2.

[0038] (2) Construction of pKSE401-GmTGA1L-a / b recombinant plasmid

[0039] PCR amplification: Four-primer PCR amplification was performed using pCBC-DT1T2 diluted 100-fold as a template. The amplification reaction system is shown in Table 1, the amplification reaction procedure is shown in Table 2, and the amplified product sequence is shown in SEQ ID No. 7. The bold fonts are target 1 and target 2, respectively.

[0040] Table 1: Reaction system

[0041]

[0042] Table 2 Reaction procedure

[0043]

[0044]

[0045] SEQ ID No.7:

[0046] ATATATGGTCTCGATTGTGTCCATACTCCATCTCAAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTTCAAAATTTTCCAGATCGATTTCTTCTTCCTCTGTTCTCGGCGTTCAATTTCTGGGGTTTTCTCTTCGTTTTCTGTAACTGAAACCTAAAATTTGAC CTAAAAAAATCTCAAATAATATGATTCAGTGGTTTTGTACTTTTCAGTTAGTTGAGTTTGCAGTTCCGATGAGATAAACCAATATTAATCCAAACTACTGCAGCCTGACAGACAAATGAGGATGCAAACAATTTTAAAGTTTATCTAACGCTAGCTGTTTTGTTTCTTCTCTCTGGTGCACCAACGACGGCGTTTTCTCAATC5GACTAAGAGATT GCACCTTTAGAAGCTCCGAGGTTTAGAGACCAATAAT

[0047] Gel electrophoresis detection: Take 5 μL of PCR product for electrophoresis detection. The size of the amplified target band should be 473 bp.

[0048] PCR product purification: Purification was performed using a PCR product purification kit from Sangon Biotech Co., Ltd. The specific steps are as follows:

[0049] 1) Fill the PCR product to 100 μL, add 5 times the volume of Buffer B3, mix thoroughly, and transfer to the adsorption column;

[0050] 2) Centrifuge at 8000 rpm for 30 seconds and discard the liquid in the collection tube;

[0051] 3) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 8000 rpm for 30 seconds, and discard the liquid in the collection tube;

[0052] 4) Repeat step 3) once;

[0053] 5) Centrifuge the empty column at 9000 rpm for 1 min;

[0054] 6) Place the adsorption column in a new 1.5 mL centrifuge tube. Add 25 μL of Elution Buffer to the center of the column membrane. Let stand at room temperature for 2 minutes, then centrifuge at 9000 rpm for 1 minute. Collect the purified product for subsequent experiments or store at -20°C.

[0055] Enzyme digestion-ligation reaction: The vector is recombined by cutting and ligating at the same time. The reaction system is shown in Table 3, the reaction procedure is shown in Table 4, and the recombinant vector map is shown in Figure 1 shown.

[0056] Table 3: Reaction system

[0057]

[0058] Table 4 Reaction procedure

[0059]

[0060] Transform E.coli DH5α competent cells with the enzyme-digested ligation product:

[0061] 1) Take 50 μL of frozen DH5α competent cells, add 10 μL of ligation product, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0062] 2) Heat shock at 42°C for 1 min 30 sec, cool on ice for 2 min, add 800 μL of antibiotic-free LB liquid medium, and incubate at 37°C with shaking at 150 rpm for 50 min;

[0063] 3) Collect the cells by centrifugation at 4000 rpm for 5 min, resuspend the cells, and evenly spread them on LB solid medium plates containing 50 mg / L kanamycin. Incubate the plates upside down at 37°C overnight.

[0064] Colony PCR: Single colonies grown on the above plates were identified by colony PCR using vector primers U626-IDF (sequence shown in SEQ ID No. 8) and U629-IDR (sequence shown in SEQ ID No. 9). The reaction system is shown in Table 5. Plaques were picked with a pipette tip and mixed into the system before PCR reaction. The reaction procedure is shown in Table 6. After completion of the PCR reaction, the products were identified by electrophoresis. Positive clones should yield a 726 bp PCR product.

[0065] SEQ ID No.8: TGTCCCAGGATTAGAATGATTAGGC

[0066] SEQ ID No.9: AGCCCTCTTTCTTTCGATCCATCAAC

[0067] Table 5: Reaction system

[0068]

[0069] Table 6 Reaction procedure

[0070]

[0071] The positive clone plasmids were extracted and sequenced as follows:

[0072] 1) Pick a single positive colony and culture in LB liquid medium containing 50 mg / L kanamycin at 37°C, 200 rpm, and shake overnight.

[0073] 2) Take 4 mL of bacterial solution and centrifuge at 8000 rpm for 2 min to collect the bacteria;

[0074] 3) Discard the supernatant, add 250 μL of Buffer P1 to the bacterial pellet, and resuspend the cells by pipetting.

[0075] 4) Add 250 μL of Buffer P2, mix gently by inversion 8 times, and let stand at room temperature for 3 min;

[0076] 5) Add 350 μL of Buffer P3, gently invert to mix, and centrifuge at 12,000 rpm for 10 min;

[0077] 6) Use a pipette to transfer the supernatant to the adsorption column, centrifuge at 12,000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0078] 7) Add 500 μL of Buffer DW1 to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0079] 8) Add 500 μL of Wash Solution to the adsorption column, centrifuge at 9000 rpm for 30 seconds, discard the liquid in the collection tube, and replace the adsorption column;

[0080] 9) Repeat step 8) once;

[0081] 10) Place the empty adsorption column and collection tube into a centrifuge and centrifuge at 9000 rpm for 1 min.

[0082] 11) After the residual alcohol on the adsorption column membrane evaporates, add 35 μL of Elution Buffer to the center of the membrane, let it stand for 2 minutes, and centrifuge at 9000 rpm for 1 minute to collect the plasmid;

[0083] 12) Take 5 μL of the obtained plasmid for sequencing. The sequencing primer is U626-IDF. The plasmid with correct sequencing is used for subsequent experiments.

[0084] Example 2: Transformation of soybean hairy roots with pKSE401-GmTGA1L-a / b vector

[0085] (1) Plasmid transformation into Agrobacterium K599:

[0086] 1) Remove 50 μL of frozen K599 competent cells, thaw on ice, add 1 μL of the above sequenced plasmid, gently stir with a pipette tip to mix, and place on ice for 30 minutes;

[0087] 2) After quick freezing in liquid nitrogen for 5 minutes, heat shock at 37°C for 5 minutes, and then cool in ice for 2 minutes;

[0088] 3) Add 800 μL of LB liquid medium without antibiotics and incubate at 28°C, 150 rpm, and shake for 4 h;

[0089] 4) Spread 100 μL of the shake-cultured bacterial solution evenly on LB solid medium (containing 50 mg / mL kanamycin and streptomycin) and incubate at 28°C for about 2 days until a single colony grows.

[0090] 5) Colony PCR was used to detect whether the plasmid was successfully transformed into Agrobacterium K599. The reaction system and reaction procedure are shown in Tables 5 and 6, respectively. The PCR identification results were detected by electrophoresis.

[0091] 6) Select positive colonies and inoculate them into 5 mL of LB liquid medium containing the corresponding antibiotics. Cultivate the culture at 28°C, 200 rpm, and shake overnight. Add an equal volume of 30% glycerol to the culture medium for preservation and freeze at -80°C for hairy root transformation.

[0092] (2) Hairy root transformation:

[0093] 1) Preparation of infection solution: The correctly identified Agrobacterium rhizogenes K599 and K599 transformed with an empty plasmid were inoculated into 5 mL of LB liquid medium (containing 50 mg / mL kanamycin and streptomycin), cultured overnight at 28°C and 200 rpm, and then transferred to 50 mL of LB liquid medium (containing 50 mg / mL kanamycin and streptomycin) at a ratio of 1:50. The culture was shaken at 28°C and 200 rpm for 3-4 hours. The cells were collected by centrifugation at 4500 rpm for 10 minutes, the supernatant was discarded, and the cells were resuspended in liquid co-culture medium (1 / 10MS) to a bacterial solution OD of 0. 600 The value is about 0.8;

[0094] 2) Co-cultivation: Three-day-old Williams 82 soybean seedlings were excised from the hypocotyl approximately 0.2 cm from the cotyledonary node using a sterilized scalpel. A cross-shaped wound was made at the incision, and the explants were placed in the above-mentioned bacterial suspension resuspended in the liquid co-culture medium. After co-cultivation at room temperature on a shaker at 100 rpm for one hour, the explants were transferred to a culture dish containing filter paper soaked in 1 / 10 MS and co-cultivated in the dark for 3-4 days.

[0095] 3) Transplantation: After co-cultivation, the explants were transferred to vermiculite that had been previously soaked in nitrogen-free B&D (Broughton and Dilworth) nutrient solution and covered to retain moisture. The cover was completely removed about six days after transplantation.

[0096] 4) Inoculation of Rhizobia: The soybean Bradyrhizobium strain USDA110 was cultured in TY medium until the exponential growth phase, centrifuged at 4500 rpm for 10 min to collect the bacteria, and diluted with distilled water to an OD of 600 ≈0.08, and soybean plants were inoculated with 30 mL / plant;

[0097] 5) Nodule number statistics: 28 days after inoculation with rhizobia, the GFP fluorescent protein expressed by the pKSE401 vector was detected using a handheld fluorescence instrument. Successfully transformed hairy roots were selected and the number of nodules per hairy root was counted. The hairy root nodulation phenotype and statistical results are shown in Figure 2. Figure 2 The results showed that the number of nodules in transgenic plants was significantly increased compared with that in non-transgenic plants.

[0098] 6) Sampling: Take hairy root samples according to the number, freeze them in liquid nitrogen, and store them at -80°C for DNA extraction and detection;

[0099] Example 3 Identification of Gene Editing in GmTGA1L-a / b Knockout Soybean Hairy Roots

[0100] (1) CTAB method for extracting soybean hairy root DNA:

[0101] 1) Grinding the hairy root sample obtained in Example 2 into powder using a tissue grinder;

[0102] 2) Add 650 μL of CTAB DNA extraction buffer, shake to mix, and incubate at 65°C for 20 min;

[0103] 3) Add 0.5 times the volume of chloroform, shake vigorously to mix, and centrifuge at 12000 rpm for 10 min;

[0104] 4) Take the supernatant and place it in a new 1.5 mL centrifuge tube. Add 2 volumes of anhydrous ethanol and incubate at -20°C for 30 minutes.

[0105] 5) Centrifuge at 12000 rpm for 10 min, discard the supernatant, air dry at room temperature, dissolve in 50 μL ddH2O, and store at 4°C until use.

[0106] (2) Identification of gene editing:

[0107] Specific primers were designed upstream and downstream of the target gene (primer sequences are shown in SEQ ID No. 10, 11, 12 and 13) for PCR, and the PCR products were sent to a sequencing company for editing identification. The PCR reaction system is shown in Table 7, the reaction procedure is shown in Table 6, and the editing form example is shown in Table 7. Figure 3 shown.

[0108] GmTGAL-a gene editing identification primers:

[0109] SEQ ID No.10: TTGGCAATGCAACTATTTAATTGTTC

[0110] SEQ ID No.11: AGGCAGTGACTGAATTTAGATATAC

[0111] GmTGAL-b gene editing identification primers:

[0112] SEQ ID No.12: TAGTGTCTTATATTAGCCCCCAGAAAC

[0113] SEQ ID No.13: ATCTCTCTTCTCCAAGAAGACAGTAG

[0114] Table 7 Reaction system

[0115]

[0116] like Figure 3As shown, in Example #1, the gene editing results in a 4-base deletion in the GmTGAL-a exon sequence and an 8-base deletion in the GmTGAL-b exon sequence, which respectively lead to a frameshift mutation in the GmTGA1L-a protein sequence starting from amino acid position 153 and premature termination at position 159, and a frameshift mutation in the GmTGA1L-b protein sequence starting from amino acid position 151 and premature termination at position 157; in Example #3, the gene editing results in a 5-base deletion in the GmTGAL-a exon sequence and an 1-base insertion in the GmTGAL-b exon sequence, which respectively lead to a frameshift mutation in the GmTGA1L-a protein sequence starting from amino acid position 153 and premature termination at position 159. In example #6, the gene editing results in a 4-base deletion in the GmTGAL-a exon sequence and a 1-base insertion and 1-base substitution in the GmTGAL-b exon sequence, which respectively lead to a frameshift mutation in the GmTGA1L-a protein sequence starting from amino acid position 154 and premature termination at position 159, and a frameshift mutation in the GmTGA1L-b protein sequence starting from amino acid position 152 and premature termination at position 160.

[0117] From the above examples, it can be seen that the present invention provides a method for increasing the number of soybean nodules by knocking out GmTGA1L-a / b, which is of great significance for promoting symbiotic nitrogen fixation in soybeans and increasing soybean yield.

[0118] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Knockout GmTGA1L-a / b The application of the gene in increasing the number of soybean nodules is characterized by: described GmTGA1L-a and GmTGA1L-b The gene numbers of the genes are Glyma.11G236300 and Glyma.18G020900, respectively.

Citation Information

Patent Citations

  • Method for promoting nodulation, especially salt-tolerant nodulation of leguminous crops

    CN114574518A

  • Transgenic plant cultivation method for specifically controlling number of root nodules of crops

    CN116904505A