Multiplex qPCR (quantitative polymerase chain reaction) detection primer and probe composition for detecting four psychrophiles and enzymes thereof and application of multiplex qPCR detection primer and probe composition

Abstract

The invention provides a multiplex qPCR (quantitative polymerase chain reaction) detection primer and probe composition for detecting four psychrophilic bacteria and enzymes thereof and application, and belongs to the technical field of biological detection. The invention develops two quadruple qPCR methods for housekeeping genes and enzyme coding genes of pseudomonas, acinetobacter, bacillus cereus and stenotrophomonas maltophilia, the method has good specificity and versatility, the primer and the probe both show a good linear relationship between a Ct value and a colony count in single and multiple qPCR, and the primer and the probe can be used for detecting the colony count of the pseudomonas, the acinetobacter, the bacillus cereus and the stenotrophomonas maltophilia and the enzyme coding genes of the pseudomonas, the acinetobacter, the bacillus cereus and the stenotrophomonas maltophilia. The detection limit of the housekeeping gene is 101 CFU / mL, and the detection limit of the enzyme coding gene is 102 CFU / mL. The detection method can be used for evaluating the content of psychrophilic bacteria in milk and dairy products, the detection time is shortened to 2.5 h from 25 h, and the method has the advantages of being efficient, rapid and easy to operate.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a multiplex qPCR detection primer and probe composition and application thereof for detecting four psychrophilic bacteria and their enzymes. Background Art

[0002] Milk and dairy products are rich in nutrients, which makes them an excellent culture medium for the growth of microorganisms. With the application of low-temperature storage technology in the storage of raw milk, the growth of microorganisms is inhibited, and psychrophilic bacteria have gradually become the dominant genus in milk and dairy products. The optimal growth temperature range of psychrophilic bacteria is 15℃~20℃, but they can grow at 7℃ and below. At refrigerated temperatures, these bacteria can produce heat-resistant extracellular proteases and lipases. After heat treatment such as pasteurization or ultra-high temperature instantaneous sterilization, these enzymes can still maintain some activity and decompose proteins and fats during the storage of milk and dairy products, resulting in precipitation, odor, aged gel, oil separation and other corruption phenomena, affecting the shelf life of the product.

[0003] Pseudomonas is considered to be one of the main causes of milk spoilage because it produces an alkaline zinc metalloproteinase AprX (EC 3.4.24), which belongs to the serine protease family and is encoded by the aprX-lipA2 operon. The main thermostable protease produced by Pseudomonas hydrolyzes casein, resulting in protein precipitation during storage of milk and dairy products. Acinetobacter is also commonly found in raw milk and exhibits strong lipolytic enzyme activity, which is considered to be related to milk fat hydrolysis and rancidity. The lipase (EC 3.1.1.3) secreted by Acinetobacter is encoded by the lipA gene and requires specific molecular chaperones to participate in the secretion and folding of the zymogen. Stenotrophomonas maltophilia secretes a temperature-responsive protease that is secreted at low temperatures and has been identified as a serine protease (EC 3.4.21.-) encoded by the StmPr2 gene. Bacillus cereus among Gram-positive bacteria produces a thermostable protease HhoA (EC 3.4.21.-). After treatment at 121°C and 135°C, the protease secreted at 7°C has higher heat resistance than that secreted at 25°C and 37°C.

[0004] Currently, the method of counting psychrophiles by culture is time-consuming, taking about 10 days or 25 hours, and cannot evaluate the activity of thermostable enzymes and the potential for spoilage, which limits its application in ranches and enterprises. The multiplex qPCR method based on TaqMan probes can quantify multiple targeted genes at the same time, but previous studies usually only focus on Pseudomonas and its AprX protease, ignoring other psychrophiles and their enzymes. Therefore, a molecular biology method is needed to simultaneously quantify multiple psychrophiles and their enzymes in raw milk. Summary of the invention

[0005] The object of the present invention is to provide a multiplex qPCR detection primer, probe composition and application for detecting four psychrophilic bacteria and their enzymes. The present invention can simultaneously perform quantitative detection on Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia and their enzymes, and can be directly used for the detection of psychrophilic bacteria in raw milk, and the detection results have strong specificity and high sensitivity.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The invention provides a multiplex qPCR detection primer and probe combination for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia. The multiplex qPCR detection primer and probe combination consists of a system 1 for detecting a housekeeping gene rpoB of Pseudomonas, a housekeeping gene gyrB of Bacillus cereus, a housekeeping gene rpoD of Stenotrophomonas maltophilia and a lipase gene lipA of Acinetobacter and / or a system 2 for detecting a protease gene aprX of Pseudomonas, a housekeeping gene recA of Acinetobacter, a protease gene HhoA of Bacillus cereus and a protease gene StmPr2 of Stenotrophomonas maltophilia.

[0008] Preferably, the system 1 is composed of:

[0009] Pseudomonas housekeeping gene rpoB:

[0010]

[0011] Acinetobacter lipase gene lipA:

[0012]

[0013] Stenotrophomonas maltophilia housekeeping gene rpoD:

[0014]

[0015] Bacillus cereus housekeeping gene gyrB:

[0016]

[0017] Preferably, the composition of the system 2 is:

[0018] Pseudomonas protease gene aprX:

[0019]

[0020] Acinetobacter housekeeping gene recA:

[0021]

[0022] Stenotrophomonas maltophilia protease gene StmPr2:

[0023]

[0024] Bacillus cereus HhoA protease gene:

[0025]

[0026] The present invention also provides a multiplex qPCR detection kit, which comprises the system 1 for detecting the Pseudomonas housekeeping gene rpoB, the Bacillus cereus housekeeping gene gyrB, the Stenotrophomonas maltophilia housekeeping gene rpoD, and the Acinetobacter lipase gene lipA, or the system 2 for detecting the Pseudomonas protease gene aprX, the Acinetobacter housekeeping gene recA, the Bacillus cereus protease gene HhoA, and the Stenotrophomonas maltophilia protease gene StmPr2.

[0027] The present invention also provides an application of a multiplex qPCR detection kit in the preparation of products for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia.

[0028] Preferably, the product includes any one of a detection reagent, a detection kit and a detection chip.

[0029] The beneficial effects of the present invention compared with the prior art are:

[0030] (1) The present invention has developed two quadruple qPCR methods for housekeeping genes and enzyme encoding genes of Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia, which have good specificity and versatility. The primers and probes show a good linear relationship between Ct value and colony count in both single and multiplex qPCR, R 2 The detection limit of multiplex qPCR was 10 1 -10 2 CFU / mL, the detection limit of housekeeping genes is 10 1 CFU / mL, enzyme encoding gene is 10 2 CFU / mL.

[0031] (2) The detection method of the present invention can be used to estimate the content of psychrophilic bacteria in milk and dairy products, shortening the detection time from 25 h to 2.5 h, and has the advantages of high efficiency, rapidity and simple operation. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0033] Figure 1 The multiplex qPCR detection amplification curve and the standard curve of system 1 in Example 1 of the present invention, wherein A is the lipA gene, B is the gyrB gene, C is the rpoB gene, and D is the rpoD gene;

[0034] Figure 2 The multiplex qPCR detection amplification curve and standard curve of system 2 in Example 1 of the present invention, wherein A is the recA gene, B is the HhoA protease gene, C is the aprX gene, and D is the StmPr2 gene;

[0035] Figure 3 This is the result of multiplex qPCR detection of artificially spiked UHT milk samples in Example 1 of the present invention, wherein A is Acinetobacter, B is Bacillus cereus, C is Pseudomonas, and D is Stenotrophomonas maltophilia;

[0036] Figure 4 This is the result of multiplex qPCR detection of 4 psychrophilic bacteria and their enzymes in raw milk in Example 1 of the present invention. DETAILED DESCRIPTION

[0037] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0038] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0039] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0040] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0041] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0042] The primers and probes used in the present invention are shown in Table 1

[0043] Table 1 Primer and probe sequences

[0044]

[0045]

[0046]

[0047] Note: F represents the upstream primer, R represents the downstream primer, and P represents the probe. S and Y are degenerate bases that can be paired with G / C and C / T.

[0048] Example 1

[0049] In Example 1 of the present invention, the primers and probe sequences shown in SEQ ID NO.1 to SEQ ID NO.27 were used to detect Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia. The specific detection steps are as follows:

[0050] (1) Extraction of total DNA from the sample to be tested

[0051] Pure bacterial samples: After activation and resuscitation, DNA was extracted according to the instructions of the bacterial genomic DNA extraction kit [Tiangen Biochemical Technology (Beijing) Co., Ltd.]. At the same time, untreated nutrient broth was used as a negative control for subsequent experiments.

[0052] Milk samples: For milk samples, high-speed centrifugation and 1×TE buffer (pH 8.0) were used to remove protein and fat. 10 mL of sample was placed in a sterile centrifuge tube and centrifuged at 1 000 g for 10 min. After wiping off the upper fat layer with a sterile cotton swab, the middle layer was placed in another sterile centrifuge tube and centrifuged at 10 000 g for 10 min. The upper fat layer and the middle layer were discarded, and TE buffer was added to repeatedly rinse the precipitate. Centrifuge at 10000 g for 10 min and the precipitate was retained. Then follow the instructions of the kit. The extracted DNA was dissolved in 200 μL TE buffer and stored at -20 °C for subsequent use.

[0053] (2) Multiplex qPCR amplification

[0054] The primer and probe pairs in system 1 and system 2 were used to detect the extracted sample DNA as a template. The volume used for qPCR amplification was 20 μL, including 10 μL 2× TaqMan Fast qPCR Master Mix [Shanghai Biotechnology Co., Ltd.], the concentration of each primer was 200 nM, the concentration of the probe was 150 nM, and the DNA template was 4 μL, which was supplemented to 20 μL with RNasefree ddH2O. The multiplex qPCR reaction program was: 95°C pre-denaturation for 3 min, followed by 95°C denaturation for 5 s, 56°C annealing for 15 s, and 72°C extension for 30 s, for a total of 40 cycles. In the multiplex qPCR reaction, RNase free ddH2O was used as a blank control.

[0055] (3) Data analysis

[0056] Monitor the qPCR reaction in real time using a fluorescent PCR instrument, and record the Ct value based on the amplification curve. Calculate the quantitative results of each detection target in the sample based on the Ct value and the standard curve.

[0057] In the PCR instrument, the FAM channel of system 1 represents the number of Pseudomonas, the Cy5 channel represents the number of LipA lipase genes of Acinetobacter, the HEX channel represents the number of Stenotrophomonas maltophilia, and the Texas Red channel represents the number of Bacillus cereus. The FAM channel of system 2 represents the number of AprX protease genes of Pseudomonas, the Cy5 channel represents the number of Acinetobacter, the HEX channel represents the number of StmPr2 protease genes of Stenotrophomonas maltophilia, and the Texas Red channel represents the number of HhoA protease genes of Bacillus cereus.

[0058] (4) Validation of multiplex qPCR system:

[0059] 1) Verify the specificity and versatility of the multiplex qPCR system

[0060] To ensure the specificity and universality of each primer and probe, all strains listed in Table 2 (including target strains and other microorganisms commonly found in raw milk) were tested using steps (1) to (3). All tests were repeated three times, including blank controls, negative controls, and internal amplification controls (IAC).

[0061] Verification of universality: Different strains have different genomic information. In this experiment, Pseudomonas fluorescens 116, Acinetobacter johnsonii 264-1-2-1, Stenotrophomonas maltophilia 262-3-2-1 and Bacillus cereus 33 were used for the early establishment of the method and determination of the detection limit. In order to further determine the application effect of this method in strains of different species of the same genus or different strains of the same species, universality tests were carried out. The results are shown in Table 2.

[0062] Table 2 Detection results of different strains

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] General description: Detect strains of the same species or different strains of the same species. In the methodological requirements, the targeted housekeeping gene should be able to detect all corresponding strains, such as recA should be able to detect strains 1, 2, 3, and 4, and gyrB should be able to detect strains 5-10. For enzyme encoding genes, since each strain does not necessarily carry the corresponding gene, it is normal that it is not detected, such as lipA was not detected in strain 1.

[0069] Specificity description: This method evaluates specificity from two aspects. On the one hand, in the design of this method, except for the internal amplification control that should be able to detect all strains, the bacteria not involved in this method, that is, 11-23 and 33-43 are not involved in this method and cannot be detected. On the other hand, it is the specificity of the designed primer probe, that is, the designed probe should only detect the targeted strains and cannot detect other bacteria. For example, rpoB should not detect other strains except strains 23-32.

[0070] 2) Determine the detection limit and evaluate the PCR method - evaluate the sensitivity and amplification efficiency of single and multiplex qPCR

[0071] Pseudomonas fluorescens 116, Acinetobacter johnsonii 264-1-2-1, Bacillus cereus 33 and Stenotrophomonas maltophilia 262-3-2-1 isolated from raw milk were used to evaluate the amplification efficiency and detection limit of qPCR detection. The genomic DNA was extracted from the pure culture solution after 10-fold gradient dilution as a template, and single- and multiplex qPCR detection was performed. The Ct value obtained by qPCR detection was correlated with the concentration of the target strain (lg CFU / mL) to generate a standard curve, and the amplification efficiency and sensitivity were evaluated. The calculation formula for the amplification efficiency (Eff%) is: Eff% = (10^-1 / slope-1) × 100%. The results are shown in Table 3, Figure 1 , 2 shown.

[0072] Table 3 Single-plex qPCR detection results

[0073]

[0074]

[0075]

[0076] As shown in Table 3, in single-plex qPCR, the detection limits of Pseudomonas rpoB, Stenotrophomonas maltophilia rpoD and Bacillus cereus gyrB housekeeping genes were 0.04, 0.45 and 0.76 lg CFU / mL, respectively, and that of Acinetobacter recA was 1 lg CFU / mL; the detection limits of the four enzyme encoding genes aprX, StmPr2, HhoA and lipA were all 1 lg CFU / mL.

[0077] Depend on Figure 1 , 2It can be seen that the detection range of lipA in multiplex qPCR system 1 is 2.68lgCFU / mL~7.68lg CFU / mL, and the detection limit is 2lg CFU / mL; the detection range of gyrB is 1.76lgCFU / mL~7.76lg CFU / mL, and the detection limit is 1lgCFU / mL; the detection range of rpoB is 1.04lgCFU / mL~7.04lg CFU / mL, and the detection limit is 1lg CFU / mL; the detection range of rpoD is 1.45lg CFU / mL~7.45lg CFU / mL, and the detection limit is 1lg CFU / mL. The detection range of recA in system 2 is 1.68lg CFU / mL~7.68lg CFU / mL, and the detection limit is 1lg CFU / mL; the detection range of HhoA is 2.76lg CFU / mL~7.76lg CFU / mL, and the detection limit is 2lg CFU / mL; the detection range of aprX is 2.04lg CFU / mL~7.04lg CFU / mL, and the detection limit is 2lg CFU / mL; the detection range of StmPr2 is 2.45lg CFU / mL~7.45lg CFU / mL, and the detection limit is 2lg CFU / mL.

[0078] 3) Application of multiplex qPCR in milk samples - qPCR detection in spiked and raw milk samples

[0079] Protein, calcium and other substances in milk can inhibit PCR detection, so the amplification effect of this method in milk samples was verified.

[0080] Commercial UHT milk was used as the basis for the preparation of spiked samples. 50 mL of milk was inoculated with 1 mL of Pseudomonas fluorescens 116, Acinetobacter johnsonii 264-1-2-1, Bacillus cereus 33 and Stenotrophomonas maltophilia 262-3-2-1 bacterial suspensions that had been revived twice and cultured at an appropriate temperature for 6 hours. The genomic DNA was extracted and tested. The results were as follows: Figure 3 shown.

[0081] Figure 3In the test using the system 1 and system 2 of the present invention, A: the detection range of recA is 2.15lg CFU / mL to 7.15lg CFU / mL, and the detection limit is 2lg CFU / mL; the detection range of lipA is 2.15lg CFU / mL to 7.15lg CFU / mL, and the detection limit is 2lg CFU / mL. B: the detection range of gyrB is 1.00lg CFU / mL to 6lg CFU / mL, and the detection limit is 1lgCFU / mL; the detection range of HhoA is 2.00lg CFU / mL to 6lg CFU / mL, and the detection limit is 2lg CFU / mL. C: the detection range of rpoB is 1.89lg CFU / mL to 6.89lg CFU / mL, and the detection limit is 1lg CFU / mL; the detection range of aprX is 2.89lg CFU / mL to 6.89lg CFU / mL, and the detection limit is 2lg CFU / mL. D: The detection range of rpoD is 1.30lg CFU / mL to 7.30lg CFU / mL, and the detection limit is 1lg CFU / mL; the detection range of StmPr2 is 2.30lg CFU / mL to 7.30lgCFU / mL, and the detection limit is 2lg CFU / mL.

[0082] In order to evaluate the practical application potential of the qPCR detection method, a total of 30 raw milk samples from Beijing, Ningxia, Zhejiang and Fujian were collected, genomic DNA was extracted and multiplex qPCR detection was performed. Figure 4 As shown, “NX”, “BJ”, “FJ” and “ZJ” indicate that the samples are from Ningxia, Beijing, Fujian and Zhejiang respectively.

[0083] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A multiplex qPCR detection primer and probe combination for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia, characterized in that: The multiplex qPCR detection primer and probe combination is composed of primers and probes for detecting the housekeeping gene of Pseudomonas rpoB , Bacillus cereus housekeeping gene gyrB , Stenotrophomonas maltophilia housekeeping gene rpoD , Acinetobacter LipA lipase gene lipA System 1 and / or for detecting the AprX protease gene of Pseudomonas aprX , Acinetobacter housekeeping genes recA , Bacillus cereus HhoA protease gene, Stenotrophomonas maltophilia StmPr2 protease gene StmPr2 The system consists of 2 components.

2. The multiplex qPCR detection primer and probe composition for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia according to claim 1, characterized in that: Connection 1 action: Pseudomonas housekeeping gene rpoB : SEQ ID NO.1-F: GTTCGGTGGTCAGCGTTTC; SEQ ID NO.2-R: CAACACGTTGAAGGACTCGG; SEQ ID NO.3-P: MGB-TGCAAGAAATGCTCACA-FAM; Acinetobacter lipase gene lipA : SEQ ID NO.4-F: ATGTCTGAAAACCGTAAACCTGA; SEQ ID NO.5-R: GCAGTACCGCCACCAAAAC; SEQ ID NO.6-P: MGB-CCTACGGTTGAAACG-Cy5; Stenotrophomonas maltophilia housekeeping gene rpoD : SEQ ID NO.7-F: AGACAAGATCCCGCAAGGTGA. SEQ ID NO.8-R: AGACAGATTGATGTTGGTGGTG. SEQ ID NO.9-P: MGB-TCGATGGAAACCCCGAT-HEX; Bacillus cereus housekeeping gene gyrB : SEQ ID NO.10-F: TTTACATGGTGTTGGGGCA. SEQ ID NO.11-R: TTGTTCCTGTTTGATCGGTGT. SEQ ID NO.12-P: MGB-ACATCGTGAAGGTAAA-Texas Red.

3. The multiplex qPCR detection primer and probe composition for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia according to claim 1, characterized in that: Connection 2 actions: Pseudomonas protease gene aprX : SEQ ID NO.13-F: CACATGASCTTCGGCAACTA; SEQ ID NO.14-R: YGGTGTTGCTCTCRCTCCA. SEQ ID NO.15-P: MGB-AGACCCTGACCCACGA-FAM; Acinetobacter housekeeping gene recA : SEQ ID NO.16-F: ATCGTYGAGATYTATGGTCCTGA; SEQ ID NO.17-R: CAGCATGTCTGCAATTTCAAGT; SEQ ID NO.18-P: MGB-AATGCACATGTACCACC-Cy5; Stenotrophomonas maltophilia protease gene StmPr2 : SEQ ID NO.19-F: TCAATGCCAAGGTCGTGC; SEQ ID NO.20-R: CCAGCGAGAGGTTGATGACT; SEQ ID NO.21-P: MGB-CTCCGACATCGCCGA-HEX; Entertainment license plate HhoA entrance hall: SEQ ID NO.22-F: ATAACTTGTGCTTGCCAATCTG; SEQ ID NO.23-R: CGTGCGGGTGAAAAAGC; SEQ ID NO. 24-P: MGB-ACTACTGATTATACCTTCC-Texas Red.

4. A multiplex qPCR detection kit, characterized in that: The multiplex qPCR detection kit comprises the method for detecting the housekeeping gene of Pseudomonas according to claim 1 or 2 rpoB , Bacillus cereus housekeeping gene ikB , Stenotrophomonas maltophilia housekeeping gene rPb , Acinetobacter lipase gene lipA System 1 or claim 1 or 3 for detecting Pseudomonas protease gene apr , Acinetobacter housekeeping genes recA , Bacillus cereus protease gene HkDJ , Stenotrophomonas maltophilia protease gene StmPr2 System 2.

5. Use of the multiplex qPCR detection kit as claimed in claim 4 in preparing a product for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia.

6. The use of the multiplex qPCR detection kit according to claim 1 in preparing a product for detecting Pseudomonas, Acinetobacter, Bacillus cereus and Stenotrophomonas maltophilia, characterized in that: The product includes any one of a detection reagent, a detection kit and a detection chip.

Images