Molecular marker for identifying cotton low temperature tolerance, kasp primer set and application thereof

Abstract

The application discloses a cotton low-temperature-resistant molecular marker, a KASP primer group and application thereof, and relates to the fields of crop breeding and biotechnology. The nucleotide sequence of the cotton low-temperature-resistant molecular marker identified by the application is shown in SEQ ID NO. 1, a SNP site exists at the 51st bp of the nucleotide sequence, and a T / C mutation exists; and the genotypes of the SNP site include TT and CC genotypes. The molecular marker or the KASP primer group can be used to quickly identify and screen individuals carrying a low-temperature-resistant functional gene in an early generation or an initial selection population of cotton breeding, eliminate unnecessary lines, and reduce the scale of a breeding population, so that the breeding cost can be greatly reduced and the breeding efficiency can be improved.

Description

Technical Field

[0001] The present invention relates to the field of crop breeding and biotechnology, and more particularly to molecular markers for identifying cotton low-temperature resistance, a KASP primer set and applications thereof. Background Art

[0002] Cotton is an important economic crop. It is generally suitable for growing in warm areas and is sensitive to low temperatures. Low temperatures during the sowing period will affect the elongation rate of the hypocotyl during cotton germination, and in severe cases will cause cotton seeds and buds to rot. When exposed to low temperatures during the boll opening period, the quality and yield of cotton will be seriously reduced.

[0003] Functional markers are a new type of molecular marker developed based on polymorphic motifs within functional genes that cause phenotypic trait variation.

[0004] Currently, commonly used SNP detection methods include direct sequencing, gene chip technology, mass spectrometry, and KASP technology (competitive allele-specific PCR). KASP is an endpoint fluorescent genotyping technology based on known SNPs, which can accurately detect SNPs and InDels at specific sites in DNA samples. KASP genotyping technology can be used for the precise positioning of candidate genes and the rapid identification and screening of individuals carrying target functional genes in early breeding generations or primary selection populations, eliminating unnecessary strains and reducing the size of breeding populations, which can significantly reduce breeding costs and improve breeding efficiency.

[0005] Therefore, exploring SNP sites related to cotton cold tolerance and developing KASP molecular markers for identifying SNP site genotypes not only provide an effective detection method for breeding cold-tolerant cotton varieties and screening cold-tolerant germplasm resources, but also have important significance for improving cotton breeding efficiency, ensuring people's quality of life and sustainable agricultural development. Summary of the Invention

[0006] In view of this, the present invention provides a molecular marker for identifying cotton's low-temperature tolerance, a KASP primer set, and applications thereof.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] A molecular marker for identifying low-temperature tolerance of cotton, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO. 1, the 51st bp of the nucleotide sequence is a SNP site with a T / C mutation; and the genotype of the SNP site includes TT and CC genotypes.

[0009] Preferably, when the genotype of the SNP site is CC, the low-temperature resistance is strong, and when the genotype of the SNP site is TT, the low-temperature resistance is poor.

[0010] Another object of the present invention is to provide a KASP primer set for identifying cotton cold tolerance, the primer set comprising SNP-specific primers with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, and a universal primer with a nucleotide sequence as shown in SEQ ID NO.4.

[0011] Another object of the present invention is to provide a detection kit for identifying the low-temperature resistance of cotton, wherein the kit comprises the above-mentioned KASP primer set.

[0012] Another object of the present invention is to provide an application of the above-mentioned KASP primer set or the above-mentioned detection kit, wherein the application is any one of the following:

[0013] A. Identify the low temperature resistance of cotton;

[0014] B. Prepare testing products for identifying cotton's ability to withstand low temperatures;

[0015] C. Assisted cotton breeding.

[0016] Another object of the present invention is to provide a method for identifying low temperature resistance of cotton, comprising the following steps:

[0017] S1. Extract genomic DNA of the sample to be tested;

[0018] S2. Amplify genomic DNA using the KASP primer set or the detection kit described above;

[0019] S3. Analyze the results obtained in S2, identify the genotype, and determine the low-temperature resistance of the sample to be tested based on the genotype. If the genotype is CC, the sample to be tested is a germplasm with strong low-temperature resistance.

[0020] Preferably, the total amplification system in step S2 is 5 μL, comprising 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and 2.43 μL of template DNA at a concentration of 20 ng / μL; wherein, each 100 μL of KASP Assay Mix includes 12 μL of each SNP-specific primer (100 μM), 30 μL of universal primer (100 μM), and 46 μL of ultrapure water.

[0021] Preferably, the reaction procedure for the amplification in step S2 is: step 1: 95°C, 10 min; step 2: 95°C, 15 s, 61-55°C, 1 min, decreasing 0.6°C each cycle, for a total of 10 cycles; step 3: 95°C, 20 s, 55°C, 1 min, for a total of 28 cycles, fluorescence scanning, 25-37°C, 30 s.

[0022] Beneficial effects: The molecular markers and KASP primer sets for identifying the low-temperature tolerance of cotton provided by the present invention are closely related to the low-temperature tolerance of cotton. Using the molecular markers or KASP primer sets, individuals carrying low-temperature tolerance functional genes can be quickly identified and screened in the early breeding generations or primary selection populations, unnecessary strains can be eliminated, and the size of the breeding population can be reduced, which can significantly reduce breeding costs and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0024] Figure 1 These are the control loci of cotton cold tolerance-related genes obtained by GWAS analysis.

[0025] Figure 2 This is the genotyping map of 226 cotton germplasm resources detected by KASP_LT molecular marker. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Example 1

[0028] A total of 226 cotton accessions were collected for phenotypic identification of low-temperature tolerance. Cotton seeds were planted in seedling boxes, with 60 seeds per box. After approximately 7 days of incubation at 25°C, the cotyledons of the cotton plants expanded and the seedlings were aligned. Slow-growing seedlings were removed and placed in a 0°C incubator for 48 hours. After 7 days of recovery, the seedlings were assessed for low-temperature tolerance. Results were graded as 0, 1, or 2, based on whether the seedlings grew normally without frostbite, grew slowly with frostbite, or died. The experiment was repeated three times for each accession, and preliminary statistical analysis of the phenotypic data was performed using WPS Excel (Table 1).

[0029] In the 2023-2024 growing season, 226 cotton materials were planted at the experimental base of the Cotton Research Institute of Hebei Academy of Agricultural and Forestry Sciences. They were planted in single-row plots with 60 seeds per row, 7m long, and 0.30m row spacing, under conventional cultivation and management.

[0030] The genomic DNA of 226 cotton leaves was extracted by CTAB method and sent to Annoroad Gene Technology (Beijing) Co., Ltd. for DNA library construction. The sequencing platform used was DNBSEQ-T7 with Q30 ≥ 85%.

[0031] A genome-wide association study (GWAS) was performed on 226 accessions. SNP detection was mainly achieved using the GATK software toolkit. The reference genome was upland cotton TM-1 (https: / / phytozome-next.jgi.doe.gov / info / Ghirsutum_v3_1). SNPs were filtered with MAF (Minor allele frequency) > 0.05 and Missing ratio < 10%. Linkage disequilibrium analysis was performed on 226 cotton accessions using Tassel v5.2.22 software. The r-value of any two markers was used to identify the SNPs. 2 The genetic distance difference between the corresponding loci was calculated, and LD decay diagrams were drawn for the whole genome and each chromosome, and the best regression curve was fitted. The decay distance was defined as the time when the LD value dropped to half of the maximum value. Based on the SNP data obtained by resequencing, SNP loci with MAF>0.05 and Missing ratio<10% were selected for population structure analysis. 226 cotton germplasm materials were analyzed using Structure v2.3.3 software, and the kinship of the 226 cotton materials was evaluated using SPAGeDi software to calculate the matrix of kinship values ​​(K matrix). To reduce the influence of population structure and kinship between individuals on the association analysis results, this study used the mixed linear model (MLM, Q+K) of TASSEL software to conduct association analysis between the selected SNP markers and phenotypic traits related to low temperature tolerance in the cotton germplasm resource population.

[0032] A low-temperature tolerance control locus was detected on chromosome D13 of the reference genome of upland cotton TM-1 (https: / / phytozome-next.jgi.doe.gov / info / Ghirsutum_v3_1) by genome-wide association analysis, located in the physical interval 1343562-1343662 (see Appendix Figure 1), with the sequence: AATTCTACATAAAAATATGAAGAAACAAAAAAAAATTTCTCATAA TAATAYAATTTTGTGCAAATTGAATCTTAGCATAATTGGCATCGTT CATGTTGCAA (SEQ ID NO. 1), and was named KASP_LT. KASP_LT has a single-nucleotide polymorphism (SNP) at bp 53, with a T / C mutation (Y represents T or C). Genotypes at this SNP include TT and CC genotypes. The genotypes of the 226 cotton germplasm samples in this example at this SNP are shown in Table 1. The CC genotype indicates strong cold tolerance, while the TT genotype indicates poor cold tolerance.

[0033] Table 1 GWAS analysis of genotypes related to low temperature tolerance in 226 cotton germplasm resources

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040] Example 2

[0041] PCR amplification primers were designed based on the SNP sites and flanking sequences obtained in Example 1 to develop KASP detection primers for this molecular marker. Two SNP-specific primers (KASP_F1 / KASP_F2) and one universal primer (R) were designed for each marker. A specific sequence capable of binding to FAM fluorescence (underlined) was added to the tail of F1, and a specific sequence capable of binding to VIC fluorescence (underlined) was added to the tail of F2.

[0042] KASP_F1:5'- GAAGGTGACCAAGTTCATGCT AAAATTTCTCAT AATAATAT-3', SEQ ID NO.2;

[0043] KASP_F2:5'- GAAGGTCGGAGTCAACGGATT AAAATTTCTCAT AATAATAC-3', SEQ ID NO.3;

[0044] Universal primer R: 5'-TTGCAACATGAACGATGCCAA-3', SEQ ID NO.4.

[0045] The total KASP reaction volume is 5 μL, consisting of 2.5 μL of 2× KASP MasterMix, 0.07 μL of KASP Assay Mix (primer mix working solution), and 2.43 μL of template DNA at a concentration of 20 ng / μL. Each 100 μL of KASP Assay Mix (primer mix working solution) contains: 12 μL of each SNP-specific primer (100 μM), 30 μL of universal primer (100 μM), and 46 μL of ultrapure water.

[0046] KASP reaction procedure: Step 1: 95°C, 10 min; Step 2: 95°C, 15 s, 61-55°C, 1 min, with the temperature decreasing by 0.6°C each cycle, for a total of 10 cycles; Step 3: 95°C, 20 s, 55°C, 1 min, for a total of 28 cycles, with fluorescence scanning at 25-37°C for 30 s. PCR amplification reactions were performed in a water bath PCR instrument, Model Hydrocycler 16 (LGC). PCR results were analyzed using a KASP fluorescence analyzer (Model PHERAstarplus, LGC) (see Appendix). Figure 2 ).

[0047] Example 3

[0048] 46 samples were selected from the 226 materials for amplification verification, and the KASP typing results were compared with the GWAS analysis results. The results showed that the KASP typing results were completely consistent with the GWAS analysis results (see Table 2), proving that the KASP primers KASP_F1 and KASP_F2 had good amplification effects and Kasp_F1 and Kasp_F2 can be used in breeding selection of KASP_LT.

[0049] Table 2 KASP primer typing verification GWAS analysis results of 46 cotton germplasm resources

[0050]

[0051]

[0052] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0053] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. Application of the KASP primer set, characterized in that: The primer set includes SNP-specific primers with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, and a universal primer with a nucleotide sequence as shown in SEQ ID NO.4; The application is to identify the strength of cotton's resistance to low temperatures, or to prepare a detection product for identifying cotton's resistance to low temperatures.

2. Application of the detection kit, characterized in that, The detection kit includes SNP-specific primers with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3, and a universal primer with a nucleotide sequence as shown in SEQ ID NO.4; The application is to identify the strength of cotton's resistance to low temperatures, or to prepare a detection product for identifying cotton's resistance to low temperatures.

3. A method for identifying the low temperature resistance of cotton, characterized in that: The following steps are involved: S1. Extract genomic DNA of the sample to be tested; S2. Amplifying genomic DNA using the KASP primer set of claim 1 or the detection kit of claim 2; S3. Analyze the results obtained in S2, identify the genotype, and determine the low-temperature resistance of the sample to be tested based on the genotype. If the genotype at the 51st bp of the nucleotide sequence as shown in SEQ ID NO.1 is CC, the sample to be tested is a germplasm with strong low-temperature resistance.

4. The method for identifying low temperature resistance of cotton according to claim 3, wherein: The total amplification system in step S2 was 5 μL, containing 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix, and 2.43 μL of template DNA at a concentration of 20 ng / μL. Each 100 μL of KASP Assay Mix included 12 μL of each SNP-specific primer, 30 μL of universal primer, and 46 μL of ultrapure water. The concentrations of the specific and universal primers were both 100 μM.

5. The method for identifying low temperature resistance of cotton according to claim 3, wherein: The amplification reaction procedure in step S2 is as follows: Step 1: 95°C, 10 min; The second step was performed at 95°C for 15 seconds, then 61-55°C for 1 minute, with the temperature decreasing by 0.6°C each cycle for 10 cycles. The third step was performed at 95°C for 20 seconds, then 55°C for 1 minute for 28 cycles, followed by fluorescence scanning at 25-37°C for 30 seconds.

Images