A molecular marker related to yellow leaf of chinese cabbage and application thereof

Abstract

The present application belongs to the technical field of crop molecular marker assisted breeding, and particularly relates to a molecular marker related to yellow leaf of Chinese cabbage and application thereof. The molecular marker is a molecular marker in a yellow leaf gene BrYL1, and a site of the molecular marker is located at the 70th position from the 5' end on SEQ ID NO. 1, and is located at the 6557852th position from the 5' end on the Brapa_Chiifu_V3.0 reference gene A066 chromosome, and the original base C is deleted. The results of the examples show that the molecular marker is closely linked to the leaf color gene, the molecular marker (BrYL1-funK1) can be used to accurately and efficiently distinguish green and yellow leaf Chinese cabbage materials, is used for breeding of new varieties of Chinese cabbage with leaf color, and can greatly improve the breeding efficiency of leaf color.

Description

Technical Field

[0001] The invention belongs to the technical field of crop molecular marker-assisted breeding, and particularly relates to a molecular marker related to yellow leaves of Chinese cabbage and an application thereof. Background Art

[0002] Leaves are the primary tissues for photosynthesis and respiration in plants, directly impacting crop yield and quality. Chloroplasts are the primary organs for photosynthesis, and chlorophyll is the primary pigment involved in photosynthesis. Mutations in genes related to chlorophyll synthesis and metabolism, as well as genes involved in chloroplast development, can lead to varying degrees of leaf color variation. Cabbage crops (Brassica rapa L.) belong to the genus Brassica in the family Cruciferae and include various leafy vegetables, such as Chinese cabbage (B. rapa. pekinensis), Chinese cabbage (B. rapa. chinensis), turnip (B. rapa. rapifera), and Chinese cabbage (B. rapa. chinensis var. utilis Tsen et Lee). Because consumers in different regions prefer different colors of cabbage, leaf color is an important commercial trait and a key breeding target. By identifying molecular markers closely linked to leaf color genes, marker-assisted selection breeding can significantly improve the efficiency of leaf color breeding.

[0003] KASP (Kompetitive Allele-Specific PCR) accurately identifies SNPs or Indels widely present in genomic DNA and can simultaneously test large numbers of samples, making it a high-throughput, cost-effective, and efficient SNP typing technology. Therefore, screening for SNPs associated with leaf color traits and further developing them into KASP markers suitable for high-throughput, high-efficiency detection, which can be applied to the selection of yellow-leaf material in Chinese cabbage, has important implications for improving cabbage yield and quality.

[0004] Therefore, there is an urgent need to provide a new molecular marker for the detection of Chinese cabbage leaf color traits or molecular marker-assisted breeding. Summary of the Invention

[0005] The purpose of the present invention is to provide a molecular marker related to yellow leaves of Chinese cabbage. The molecular marker provided by the present invention can not only accurately and efficiently distinguish between green and yellow leaf Chinese cabbage materials, but also can be used for the breeding of new varieties of Chinese cabbage leaf color, which can greatly improve the leaf color breeding efficiency.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a molecular marker related to the leaf color trait of Chinese cabbage. The molecular marker is located at the 70th position from the 5' end on SEQ ID NO.1 as shown in the nucleotide sequence table, corresponding to the 6557852nd position from the 5' end on the chromosome A066 of the Brapa_Chiifu_V3.0 reference genome, in which the original base C is deleted.

[0008] Preferably, the growth trait is the leaf color of Chinese cabbage, including yellow and green.

[0009] The present invention also provides a primer pair for detecting the above-mentioned molecular marker, wherein the primer pair comprises three primers: BrYL1-funK1Fa, BrYL1-funK1Fb, and BrYL1-funK1R; the nucleotide sequence of the BrYL1-funK1Fa is shown in the sequence listing as SEQ ID NO.3; the nucleotide sequence of the BrYL1-funK1Fb is shown in the sequence listing as SEQ ID NO.4; and the nucleotide sequence of the BrYL1-funK1R is shown in the sequence listing as SEQ ID NO.5.

[0010] Preferably, the BrYL1-funK1Fa is a specific primer for the green leaf genotype; the BrYL1-funK1Fb is a specific primer for the yellow leaf genotype; and BrYL1-funK1R is a common reverse primer.

[0011] More preferably, the 5' ends of the primers BrYL1-funK1Fa and BrYL1-funK1Fb are respectively added with FAM and HEX fluorescent sequences.

[0012] The present invention also provides a method for detecting Chinese cabbage leaf color traits, which comprises detecting the above-mentioned molecular markers.

[0013] Preferably, the detection method can be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescent labeling capillary electrophoresis or sequencing, preferably competitive allele-specific PCR.

[0014] Preferably, the detection method comprises the following steps: using the above primer pairs to amplify the nucleotide sequence of the above molecular marker site to obtain an amplified product, performing fluorescence quantification on the amplified product, reading the fluorescence signal and analyzing the typing result.

[0015] The present invention also provides the use of a molecular marker in the Chinese cabbage BrYL1 gene in detecting the leaf color trait of Chinese cabbage, wherein the molecular marker is the above-mentioned molecular marker.

[0016] The application also provides application of the specific primer pair of the molecular marker related to the leaf color trait of Brassica rapa in Brassica rapa breeding, wherein the molecular marker related to the leaf color trait of Brassica rapa is the above-mentioned molecular marker, and the specific primer pair is the above-mentioned primer pair.

[0017] The application has the following beneficial effects:

[0018] The application relates to a SNP marker A06-6557852 related to a Brassica rapa yellow leaf gene BrYL1, and a detection primer BrYL1-funK1 for detecting the marker is designed. The SNP marker and the detection primer BrYL1-funK1 can accurately and efficiently detect green leaf and yellow leaf material types. The screening method is not affected by environmental factors, can greatly reduce the workload of field selection, and is helpful for assisting in accelerating the leaf color breeding of Brassica rapa. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the application, and other drawings can be obtained by those skilled in the art without creative labor.

[0020] Figure 1 The BSA-Seq positioning result of the leaf color gene BrYL1 is shown, the drawing window is 1 Mb, the step length is 50 kb, the yellow line is a 95% confidence interval, the blue line is a 99% confidence interval, and the positioning interval is a candidate region (6.20-7.25 Mb) on the A06 chromosome;

[0021] Figure 2 The KASP gene typing result of the F2 population is shown;

[0022] Figure 3 The KASP gene typing result of the natural population is shown. DETAILED DESCRIPTION

[0023] The application provides a molecular marker related to a yellow leaf of Brassica rapa, the molecular marker is an InDel molecular marker in a yellow leaf gene BrYL1, and the site of the molecular marker is located at the 70th position from the 5' end on SEQ ID NO. 1 shown in the nucleotide sequence table, and is located at the 655785th position from the 5' end on the Brapa_Chiifu_V3.0 reference gene A066 chromosome, and the original base C is deleted.

[0024] The application also provides a method for detecting the leaf color trait of Brassica rapa, comprising detecting the above-mentioned molecular marker. The detection method of the application can be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescently labeled capillary electrophoresis or sequencing, preferably competitive allele-specific PCR.

[0025] The nucleotide sequence of the SNP molecular marker of the application is: TACCTGTTATAGCAGATGGAGGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCCTTGGAGCATCAACTGTGATGATGGGAAGCTTCTTAGCTGGAAGCACTGAGGCTCCTGGTGCTTACGAATATCGAGTAAT (SEQ ID NO. 1).

[0026] The nucleotide sequence A06-6557852 of the yellow leaf material of the application is: TACCTGTTATAGCAGATGGAGGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCCTTGGAGCATAACTGTGATGATGGGAAGCTTCTTAGCTGGAAGCACTGAGGCTCCTGGTGCTTACGAATATCGAGTAAT (SEQ ID NO. 2).

[0027] In order to detect the above-mentioned molecular marker, the application designs a primer pair of KASP marker BrYL1-funK1, which comprises three primers.

[0028] BrYL1-funK1Fa: 5'-CTCTAGTCCTTGGAGCATC-3' (SEQ ID NO. 3); GAAGGTGACCAAGTTCATGCT BrYL1-funK1Fa: 5'-CTCTAGTCCTTGGAGCATC-3' (SEQ ID NO. 3);

[0029] BrYL1-funK1Fb: 5'-GGCTCTAGTCCTTGGAGCATAA-3' (SEQ ID NO. 4); GAAGGTCGGAGTCAACGGATT BrYL1-funK1Fb: 5'-GGCTCTAGTCCTTGGAGCATAA-3' (SEQ ID NO. 4);

[0030] BrYL1-funK1R: 5'-CAGTGCTTCCAGCTAAGAAGCTTCC-3' (SEQ ID NO. 5).

[0031] BrYL1-funK1Fa and BrYL1-funK1Fb are two allele-specific forward primers. BrYL1-funK1Fa is specific for the green leaf genotype, while BrYL1-funK1Fb is specific for the yellow leaf genotype. FAM and HEX tag sequences complementary to the fluorescent signal sequence are added to the 5' ends of the BrYL1-funK1Fa and BrYL1-funK1Fb primers, respectively. BrYL1-funK1R is a common reverse primer.

[0032] The examples of the present invention show that the SNP molecular marker BrYL1-funK1 primer pair has good versatility and accuracy, and can be used for molecular marker-assisted selection of the yellow leaf trait of Chinese cabbage.

[0033] The Chiifu_V3.0 reference genome of the present invention is a genome version of the Chinese cabbage (Brassica rapa) variety Chiifu.

[0034] DH material generally refers to plant material obtained through doubled haploid (DH) technology. This is homozygous diploid plant material obtained through haploid breeding. Doubled haploid technology is a method that accelerates the breeding process, producing homozygous plants within one generation, thereby significantly shortening the breeding cycle.

[0035] The CTAB method is a commonly used DNA extraction method that uses cetyltrimethylammonium bromide (CTAB) as a cationic detergent to extract nucleic acids.

[0036] BSA-Seq (Bulked Segregant Analysis Sequencing) is a gene mapping method that combines traditional BSA (Bulked Segregant Analysis) methods with high-throughput sequencing technology. It is mainly used to quickly locate genes or quantitative trait loci (QTLs) associated with specific phenotypes.

[0037] Clean reads refer to high-quality sequence reads obtained after quality control and filtering in high-throughput sequencing data. During sequencing data analysis, raw sequencing data (rawreads) often contain some low-quality sequence reads. These reads may affect the accuracy and reliability of subsequent analysis due to sequencing errors, adapter contamination, and duplicate sequences. Therefore, preprocessing the raw data to remove low-quality reads and obtain clean reads is a very important step.

[0038] The Delta SNP-index (ΔSNP-index) is a metric used in Bulk Segregant Analysis (BSA) to quantify the difference in SNP (single nucleotide polymorphism) frequencies between two bulks. In BSA analysis, two or more bulks are typically constructed, each containing a mixture of DNA from individuals with similar phenotypes. By comparing the SNP frequency differences between these bulks, genes or quantitative trait loci (QTLs) associated with specific phenotypes can be located.

[0039] Candidate genes are genes known to have specific biological functions and sequences and to be involved in the development of specific traits. These genes may directly affect the expression of traits or indirectly affect traits by regulating the expression of other genes.

[0040] In order to further illustrate the present invention, the technical solution provided by the present invention is described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0041] Unless otherwise specified, the production processes, experimental methods or detection methods involved in the embodiments of the present invention are all conventional methods in the prior art, and their names and / or abbreviations are conventional names in the field and are very clear and unambiguous in the relevant fields of use. Those skilled in the art can understand the conventional process steps based on the names and apply the corresponding equipment to implement them according to conventional conditions or the conditions recommended by the manufacturer.

[0042] The various instruments, equipment, raw materials or reagents used in the embodiments of the present invention are not particularly limited in their sources and are all conventional products that can be purchased through regular commercial channels or prepared according to conventional methods well known to those skilled in the art.

[0043] Example 1 Development of KASP Molecular Markers for Gene BrYL1

[0044] 1.1 Extraction of leaf color gene BrYL1

[0045] A green DH line of Chinese cabbage, R16-11 (P1), and a yellow line, Y706-1 (P2), were selected as parents. F1 seeds were obtained by hybridization, and F2 seeds were obtained by self-pollination. All plants were planted at the Henan Modern Agriculture Research and Development Base under unified field management. Leaf color was measured for each plant during the seedling stage.

[0046] The results of the investigation of the sub-representative type showed that in the F1 population, all the plant leaves were green. In the F2 population, the phenotype was separated. In the F2 small population, the number of green and yellow leaf plants was 168 and 52 respectively, which was consistent with the 3:1 separation ratio by chi-square test. In the F2 large population, the number of green and yellow leaf plants was 2716 and 944 respectively, which was consistent with the 3:1 separation ratio by chi-square test.

[0047] The results shown in Table 1 showed that the yellow leaf phenotype of Y706-1 was controlled by a recessive single gene, and the leaf color gene was named BrYL1.

[0048] Table 1: Separation of green and yellow plants of Brassica rapa parents and their offspring

[0049]

[0050] 1.2. Extraction of genomic DNA

[0051] The genomic DNA of each single plant of the two parents, F1 and F2 was extracted by the improved CTAB method. The specific steps are as follows.

[0052] An appropriate amount of fresh leaves was taken and placed in a 2.0 mL centrifuge tube, 1 steel ball with a diameter of 5 mm was added, and then 1000 μL of 2% CTAB extraction buffer was added. The centrifuge tube was placed in a tissue crusher (model: Germany Retsch MM400) and crushed at a frequency of 30 times per second for 1 min.

[0053] The crushed sample was placed in a 65℃ water bath for 1 hour, during which it was taken out and shaken up and down 2-3 times. After cooling, 500 μL of chloroform was added, shaken up and down thoroughly, and then centrifuged at 12000 r / min for 10 min. 500 μL of supernatant was aspirated and transferred to a new 1.5 mL centrifuge tube, 500 μL of pre-ice bath isopropanol was added, mixed thoroughly, then ice bathed for 30 min, and then centrifuged at 12000 r / min for 5 min. The supernatant was discarded, 1000 μL of 75% ethanol was added to wash the DNA precipitate, and then centrifuged at 12000 r / min for 2 min, and the supernatant was discarded. The DNA precipitate was air-dried at room temperature, 100 μL of ddH2O was added to dissolve the DNA, and the dissolved DNA was stored in a -20℃ refrigerator for use.

[0054] 1.3. Localization of Brassica rapa yellow leaf gene BrYL1

[0055] 30 green leaf materials and 30 yellow leaf materials were selected from the F2 population to construct green leaf pool (G-pool) and yellow leaf pool (Y-pool), respectively, and BSA-Seq technology was used to resequence the two mixed pools.

[0056] Clean reads were aligned with the Chinese cabbage Chiifu genome sequence (V3.0) using BWA software, and variant site information was obtained using Samtools software. The ΔSNP-index between the green and yellow leaf pools was then calculated, and a sliding window analysis was performed with a 1 Mb plotting window and a 50 kb step length to determine the distribution of the candidate gene BrYL1 on the genome. Significance analysis was performed, such as Figure 1 As shown, the yellow leaf gene BrYL1 was located in the 6.20-7.25Mb interval of chromosome A06, with a length of 1.05Mb.

[0057] 1.4 Development of KASP molecular markers for the yellow leaf gene BrYL1

[0058] The candidate gene of the cabbage yellow leaf gene BrYL1 was identified by gene mapping method. The candidate gene was sequenced and sequence aligned, and a SNP deletion C / - was found at the 6557852bp position of chromosome A066 (Brapa_Chiifu_V3.0 reference gene). As shown below, at the 70bp position, the base in the green leaf material is C, while the base is missing in the yellow leaf material. This variation is called SNP marker A06-6557852.

[0059] TACCTGTTATAGCAGATGGAGGGATATCAAACTCAGGTCACATTGTGAAGGCTCTAGTCCTTGGAGCAT[C / -]AACTGTGATGATGGGAAGCTTC TTAGCTGGAAGCACTGAGGCTCCTGGTGCTTACGAATATCGAGTAAT

[0060] The KASP marker BrYL1-funK1 was designed for this SNP marker A06-6557852, including three primers:

[0061] BrYL1-funK1Fa: 5'-GAAGGTGACCAAGTTCATGCTCTCTAGTCCTTG GAGCATC-3' (SEQ IDNO.3);

[0062] BrYL1-funK1Fb: 5'-GAAGGTCGGAGTCAACGGATTGGCTCTAGTCC TTGGAGCATAA-3' (SEQ ID NO. 4);

[0063] BrYL1-funK1R: 5'-CAGTGCTTTCCAGCTAAGAAGCTTCC-3' (SEQ ID NO. 5).

[0064] BrYL1-funK1Fa and BrYL1-funK1Fb are two allele-specific forward primers. BrYL1-funK1Fa is specific for the green leaf genotype, and BrYL1-funK1Fb is specific for the yellow leaf genotype. FAM and HEX tag sequences are added to the 5' ends of BrYL1-funK1Fa and BrYL1-funK1Fb, respectively. BrYL1-funK1R is a common reverse primer.

[0065] The KASP-PCR reaction was performed in a 96-well PCR instrument. The reaction system (8 μL) consisted of 1.5 μL DNA (80 ng / μL), 4 μL KASP Master mix (2×), and 0.14 μL primer mixture (prepared by mixing BrYL1-funK1Fa, BrYL1-funK1b, and BrYL1-funK1R at a concentration of 100 μmol / L with ddH2O at a volume ratio of 12:12:30:46). The remainder was filled with ddH2O.

[0066] The KASP-PCR amplification program was as follows: first stage denaturation at 94°C for 15 min; second stage denaturation at 94°C for 20 s, annealing at 61°C for 60 s, for a total of 10 cycles (starting from the second cycle, the temperature was reduced by 0.6°C each cycle); third stage denaturation at 94°C for 20 s, annealing at 55°C for 60 s, for a total of 26 cycles; fourth stage 37°C for 1 min.

[0067] The KASP-PCR amplification products were read using the Roche LightCycler 480 Instrument II (LC480II) for endpoint fluorescence signal analysis. The SNP typing results were analyzed using LC480 software v1.5.1. Figure 2 As shown, the signal points of the homozygous green material are blue, and are competitively amplified by primers with a FAM fluorescent tag sequence at the 5' end, clustering near the X-axis. The signal points of the homozygous yellow material are green, and are competitively amplified by primers with a HEX fluorescent tag sequence at the 5' end, clustering near the Y-axis. The signal points of the heterozygous green material are red, clustering near the diagonal line. The BrYL1-funK1 marker can significantly distinguish between the two homozygous genotypes and can also identify the heterozygous genotype, demonstrating its codominant nature, indicating successful marker development.

[0068] Example 2 Validation of KASP Molecular Marker BrYL1-funK1

[0069] The BrYL1-funK1 marker was used to genotype 86 individuals in the F2 population, and the homozygous green genotype was marked as a, the homozygous yellow genotype was marked as b, and the heterozygous type was marked as h.

[0070] The results are as follows Figure 3 As shown, there were 18 plants with genotype a, 21 plants with genotype h, and 47 plants with genotype b. The genotype and phenotype concordance rate of the marker BrYL1-funK1 in 86 F2 plants reached 100%. This further demonstrates that the BrYL1-funK1 marker can be used for molecular-assisted breeding of Chinese cabbage leaf color traits.

[0071] Example 3 Application of KASP molecular marker BrYL1-funK1

[0072] All natural populations were green materials. The DNA of individual strains of natural populations was extracted according to the above-mentioned genomic DNA extraction method and stored in the refrigerator for future use. KASP marker BrYL1-funK1 was used to verify the parent R16-11, Y706-1 and natural populations described in Example 1. The results are as follows Figure 3 As shown, all natural populations clustered on the X-axis, and the typing results were consistent with R16-11, with a 100% concordance rate between genotype and phenotypic results. This further demonstrates that the marker BrYL1-funK1 has good versatility and accuracy and can be used for molecular marker-assisted selection of yellow leaf traits in Chinese cabbage.

[0073] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. An InDel molecular marker related to leaf color traits of Chinese cabbage, characterized in that: The nucleotide sequence of the InDel molecular marker is shown in SEQ ID NO.2; its corresponding wild-type nucleotide sequence is shown in SEQ ID NO.1; the InDel molecular marker is characterized by the deletion of the original base C at position 70 of the nucleotide sequence shown in SEQ ID NO.

1.

2. A primer pair for detecting the InDel molecular marker according to claim 1, characterized in that: The primer pair includes three primers: BrYL1-funK1Fa, BrYL1-funK1Fb and BrYL1-funK1R; the nucleotide sequence of the BrYL1-funK1Fa is shown in the sequence listing SEQ ID NO.3; the nucleotide sequence of the BrYL1-funK1Fb is shown in the sequence listing SEQ ID NO.4; and the nucleotide sequence of the BrYL1-funK1R is shown in the sequence listing SEQ ID NO.

5.

3. The primer pair according to claim 2, characterized in that The 5' ends of the primers BrYL1-funK1Fa and BrYL1-funK1Fb are respectively added with FAM and HEX fluorescent sequences.

4. A method for detecting leaf color traits of Chinese cabbage, characterized in that: The method comprises detecting the InDel molecular marker according to claim 1; Among them, when the 70th base of the nucleotide sequence shown in SEQ ID NO.1 is C, the leaf color of the Chinese cabbage is green; when the original base C is deleted at the 70th base of the nucleotide sequence shown in SEQ ID NO.1, the leaf color of the Chinese cabbage is yellow.

5. The method according to claim 4, characterized in that: The detection method can be polyacrylamide gel electrophoresis, competitive allele-specific PCR, fluorescent labeling capillary electrophoresis or sequencing.

6. The method according to claim 4, characterized in that The detection method comprises the following steps: using the primer pair of claim 2 to amplify the nucleotide sequence of the InDel molecular marker site of claim 1 to obtain an amplified product, performing fluorescence quantification on the amplified product, reading the fluorescence signal and analyzing the typing result.

7. Application of InDel molecular markers in the BrYL1 gene of Chinese cabbage in detecting leaf color traits of Chinese cabbage, characterized in that: The InDel molecular marker is the InDel molecular marker according to claim 1; Among them, when the 70th base of the nucleotide sequence shown in SEQ ID NO.1 is C, the leaf color of the Chinese cabbage is green; when the original base C is deleted at the 70th base of the nucleotide sequence shown in SEQ ID NO.1, the leaf color of the Chinese cabbage is yellow.

8. Application of a specific primer pair of InDel molecular markers related to Chinese cabbage leaf color traits in Chinese cabbage breeding, characterized in that: The InDel molecular marker related to the leaf color trait of Chinese cabbage is the InDel molecular marker according to claim 1; the specific primer pair is the primer pair according to claim 2, comprising three primers: BrYL1-funK1Fa, BrYL1-funK1Fb, and BrYL1-funK1R; The BrYL1-funK1Fa is a specific primer for the green leaf genotype; the BrYL1-funK1Fb is a specific primer for the yellow leaf genotype; and the BrYL1-funK1R is a common reverse primer.

Images