CFAP52 inhibitor and application thereof in preparation of traditional Chinese medicine for treating and / or preventing esophageal squamous cell carcinoma

Abstract

The invention provides a CFAP52 inhibitor and application thereof in preparing a medicine for treating and / or preventing esophageal squamous cell carcinoma. The CFAP52 inhibitor is a nucleic acid inhibitor, and is specifically ribozyme, an antisense molecule, an oligonucleotide inhibitor, an aptamer, microRNA or siRNA. The CFAP52 inhibitor provided by the invention can effectively kill esophageal squamous cell carcinoma tumor cells, significantly inhibit the in-vitro proliferation and migration process of esophageal squamous cell carcinoma cells, and finally block the diffusion and propagation of tumor cells in esophageal squamous cell carcinoma patients, thereby playing a good anti-tumor effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a CFAP52 inhibitor and its use in treating and / or preventing esophageal squamous cell carcinoma. Background Art

[0002] Cancer is the first or second leading cause of death in humans before the age of 70. According to the latest estimates from the International Agency for Research on Cancer (IARC), there will be nearly 20 million new cancer cases and 9.7 million cancer deaths in 2022. Among them, esophageal cancer is the seventh most deadly cancer in the world. See Bray, F. et al. (2024) "Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries" CA Cancer J Clin, 74(3): 229-263. There are two main histological subtypes of esophageal cancer, including esophageal adenocarcinoma and esophageal squamous cell carcinoma (ESCC). Esophageal adenocarcinoma is common in Western developed countries, while esophageal squamous cell carcinoma is common in developing countries. See Codipilly DC et al. (2022) "Squamous Cell Carcinoma of the Esophagus"

[0003] Gastroenterol Clin North Am, 51(3):457-484. Due to the lack of early diagnostic biomarkers and effective treatment strategies, the 5-year survival rate of patients with esophageal squamous cell carcinoma is close to 18%, see Paiboonrungruang, C. et al. (2021) "Development of targeted therapy of NRF2 highesophageal squamous cell carcinoma” Cell Signal, 86:110105. In recent years, due to the limited efficacy of traditional treatments for patients with advanced esophageal squamous cell carcinoma, molecular targeted therapy has become a research hotspot in the field and has made breakthrough progress in the treatment of some malignant tumors including esophageal squamous cell carcinoma. See Kashyap, MK et al. (2018) “Expression, regulation and targeting of receptor tyrosine kinases in esophageal squamous cell carcinoma” Mol Cancer, 17(1):54.

[0004] Therefore, developing more effective target molecules has become the key to conquering esophageal squamous cell carcinoma. Summary of the invention

[0005] In order to solve the above problems, the purpose of the present invention is to provide a CFAP52 inhibitor, which can specifically kill esophageal squamous cell carcinoma tumor cells, thereby inhibiting the malignant proliferation and spread and metastasis of esophageal squamous cell carcinoma.

[0006] Another object of the present invention is to provide use of a CFAP52 inhibitor in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma.

[0007] In order to achieve the above object, the present invention provides a CFAP52 inhibitor, which is a nucleic acid inhibitor.

[0008] Preferably, the nucleic acid inhibitor is a ribozyme, an antisense molecule, an oligonucleotide inhibitor, an aptamer, a microRNA, a siRNA or a shRNA.

[0009] More preferably, the CFAP52 inhibitor is siRNA.

[0010] Specifically, the CFAP52 inhibitor is siCFAP52-1, siCFAP52-2 or siCFAP52-3, wherein the forward sequence of siCFAP52-1 is shown in Seq ID No.1, the reverse sequence is shown in Seq ID No.2, the forward sequence of siCFAP52-2 is shown in Seq ID No.3, the reverse sequence of siCFAP52-2 is shown in Seq ID No.4, the forward sequence of siCFAP52-3 is shown in Seq ID No.5, and the reverse sequence of siCFAP52-3 is shown in Seq ID No.6.

[0011] The present invention also provides use of the above-mentioned CFAP52 inhibitor in preparing a drug for treating and / or preventing esophageal squamous cell carcinoma.

[0012] Preferably, the esophageal squamous cell carcinoma is from a mammal.

[0013] Specifically, the mammal is a human.

[0014] The present invention provides a method for treating and / or preventing esophageal squamous cell carcinoma in a mammal, comprising administering a therapeutically effective amount of a CFAP52 inhibitor to a patient suffering from symptoms of said cancer.

[0015] The beneficial effects of the present invention are:

[0016] The present invention provides the use of a CFAP52 inhibitor in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma. The CFAP52 inhibitor can target esophageal squamous cell carcinoma tumor cells for specific killing, thereby inhibiting the growth and metastasis of esophageal squamous cell carcinoma, while avoiding the side effects of traditional radiotherapy and chemotherapy for esophageal squamous cell carcinoma in patients. On the other hand, the CFAP52 inhibitor provided by the present invention is a double-stranded RNA nucleic acid molecule, which has a low economic cost, good therapeutic effect, and has a considerable clinical application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1A The following are typical tissue microarray photos of CFAP52 expression in tumor tissues of 112 patients with esophageal squamous cell carcinoma and 68 paired adjacent cancer tissues.

[0018] Figure 1B The above is the statistical graph of CFAP52 expression in tumor tissues of 112 patients with esophageal squamous cell carcinoma and 68 paired adjacent cancer tissues.

[0019] Figure 1C This is the Kaplan-Meier survival curve of CFAP52 expression level and survival rate of patients with esophageal squamous cell carcinoma.

[0020] Figure 2 Western blot photos of CFAP52 expression in 2 normal esophageal epithelial cells and 10 esophageal squamous cell carcinoma cells.

[0021] Figure 3 Western blot photos of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0022] Figure 4A Statistical graph of cell viability of KYSE410 cells overexpressing CFAP52.

[0023] Figure 4B Statistical graph of cell viability of KYSE450 cells overexpressing CFAP52.

[0024] Figure 5A Photographs showing the colony formation of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0025] Figure 5B Statistical graph showing the clone formation of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0026] Fig. 6A This is an analysis diagram of the cell cycle distribution of KYSE410 cells overexpressing CFAP52.

[0027] Figure 6B Statistical graph of cell cycle distribution of KYSE410 cells overexpressing CFAP52.

[0028] Fig. 7A This is an analysis diagram of the cell cycle distribution of KYSE450 cells overexpressing CFAP52.

[0029] Figure 7B Statistical graph of cell cycle distribution of KYSE450 cells overexpressing CFAP52.

[0030] Fig. 8A Photographs showing the migration of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0031] Figure 8B Statistical graph showing the migration of KYSE410 and KYSE450 cells overexpressing CFAP52.

[0032] Fig. 9A Photographs of scratch healing of KYSE410 cells overexpressing CFAP52.

[0033] Fig. 9B Statistical graph of the scratch healing of KYSE410 cells overexpressing CFAP52.

[0034] Fig. 10A Photographs of scratch healing of KYSE450 cells overexpressing CFAP52.

[0035] Fig. 10B Statistical graph of the scratch healing of KYSE450 cells overexpressing CFAP52.

[0036] Fig.11Western blot photos of CFAP52 expression in YES2 and KYSE410 cells transfected with siRNA.

[0037] Fig. 12A Statistical graph of cell viability of YES2 cells transfected with siRNA.

[0038] Fig. 12B The figure is a statistical graph of cell viability of KYSE410 cells transfected with siRNA.

[0039] Fig.13A The photographs are of the clone formation of KYSE410 cells transfected with siRNA.

[0040] Fig. 13B The figure is a statistical graph of the clone formation of KYSE410 cells transfected with siRNA.

[0041] Fig.14A This is an analysis diagram of the cell cycle distribution of YES2 cells transfected with siRNA.

[0042] Fig. 14B Statistical graph of cell cycle distribution of YES2 cells transfected with siRNA.

[0043] Fig.15A The figure shows the analysis of cell cycle distribution of KYSE410 cells transfected with siRNA.

[0044] Fig. 15B Statistical graph of cell cycle distribution of KYSE410 cells transfected with siRNA.

[0045] Fig.16A These are photographs of the migration of YES2 and KYSE410 cells transfected with siRNA.

[0046] Fig. 16B Statistical graph of migration of YES2 and KYSE410 cells transfected with siRNA.

[0047] Fig.17A These are photographs of the wound healing of YES2 cells transfected with siRNA.

[0048] Fig. 17B This is a statistical graph of the scratch healing of YES2 cells transfected with siRNA.

[0049] Fig.18A These are photographs of the wound healing of KYSE410 cells transfected with siRNA.

[0050] Fig.18B This is a statistical graph of the scratch healing of KYSE410 cells transfected with siRNA. DETAILED DESCRIPTION

[0051] The embodiments of the present invention will be described in detail and comprehensively below so that the advantages and features of the present invention can be more easily understood by those skilled in the art, thereby making a clearer and more definite definition of the protection scope of the present invention.

[0052] CFAP52, or cilia and flagella associated protein 52, also known as WDR16 (WD repeat domain 16), is a member of the large WD-40 repeat protein family (see Constanza Tapia Contreras et al. (2020) "The WD40-protein CFAP52 / WDR16 is a centrosome / basalbody protein and localizes to the manchette and the flagellum in male germ cells" Scientific Reports 10(1):14240). CFAP52 is located in the short arm of chromosome 17, region 1, band 3, subband 1 (17p13.1), and its accession number on NCBI is Gene ID: 146845. Its encoded protein contains 620 amino acids. CFAP52 is an intratubular protein, part of the dynein-modified double microtubules in the ciliary axon, and is involved in regulating the normal beating of cilia and flagella (see Gerard W Dougherty et al. (2020) "CFAP45 deficiency causes situsabnormalities and asthenospermia by disrupting an axonemal adenine nucleotidehomeostasis module" Nature Communications 11(1):5520), and may play an important role in cell growth and survival (see Fabio Pittella Silva et al. (2005) "WDRPUH, a novel WD-repeat-containing protein, is highly expressed in human hepatocellular carcinoma and involved in cell proliferation" Neoplasia 7(4):348-55). Studies have reported that CFAP52 mutations can cause motile ciliopathies and have been identified in human patients with complete situs inversus.In addition, homozygous deletion of CFAP52 exon 2 mutations leads to male infertility (see Bingbing Wu et al. (2023) "The cilia and flagellaassociated protein CFAP52 orchestrated with CFAP45 is required for sperm motility in mice" J Biol Chem 299(7):104858), and has been shown to be a novel diagnostic target for the identification of male infertility with defects of sperm head-tail connection and flagella development (see Huijuan Jin et al. (2023) "Identification of CFAP52 as a novel diagnostic target of male infertility with defects of sperm head-tail connection and flagella development" Elife 12:RP92769). There are very few studies on the role of CFAP52 in the occurrence and development of human tumors, and there is no clear literature report yet.

[0053] "Nucleic acid inhibitor" as used herein refers to a nucleic acid molecule such as an aptamer, which inhibits the activity of a CFAP52 polypeptide by binding to the polypeptide in a manner similar to that described for the above-mentioned antibody, or a nucleic acid molecule that is complementary to a polynucleotide encoding a CFAP52 polypeptide and binds to the polynucleotide, which inhibits the transcription or translation of the polynucleotide. For example, an inhibitory nucleic acid can act as a triple helix forming oligonucleotide by interfering with the correct transcription of the CFAP52 gene. Furthermore, the inhibitory nucleic acid can be a ribozyme, which specifically binds to and degrades the CFAP52 transcript.

[0054] Alternatively, it may be an antisense, siRNA, microRNA or shRNA that is capable of binding, degrading the transcript or at least inhibiting its efficient translation. The latter type of inhibitory nucleic acid is characterized by a nucleic acid sequence that is complementary to the sequence usually contained in the CFAP52 transcript. The complementary sequence should be long enough and should contain a sufficient number of matching nucleotides to allow specific hybridization with the transcript in the cell.

[0055] According to the present invention, a "ribozyme" is an RNA molecule comprising a sequence complementary to the CFAP52 transcript. Ribozyme technology is well known in the art, and those skilled in the art are able to design and apply suitable ribozymes without complications; see, for example, Khan 2006, Clin. Chim. Acta 367 (1-2): 20-27; Kalota 2004, Cancer Biology & Therapy 3 (1): 4-12.

[0056] "Antisense molecule" as used herein refers to a therapeutic antisense RNA complementary to a CFAP52 transcript or a morpholino oligonucleotide capable of binding to a CFAP52 transcript. Antisense technology including the use of morpholino oligonucleotides is well known in the art, see, for example, Kalota 2004, Cancer Biology & Therapy 3(1):4-12; Morcos 2007, Biochem Biophys Res Commun 358(2):521-7.

[0057] Inhibitory oligonucleotides are used herein to preferably refer to small double-stranded DNA molecules that can bind to specific regions of target genomic DNA to achieve gene silencing (so-called triple helix-forming oligonucleotides), or to oligonucleotides that act as decoys and block transcription factors specifically required for target gene transcription. These technologies have been successfully used in vivo and have achieved results in therapy to some extent (see also Kalota 2004, Cancer Biology & Therapy 3(1): 4-12).

[0058] The term "aptamer" is used herein to refer to a nucleic acid aptamer that specifically binds to a CFAP52 polypeptide. A pool of aptamers can be generated by using, for example, the systematic evolution of ligands by exponential enrichment (SELEX) technique. A selection step can be used for those aptamers that specifically bind to a CFAP52 polypeptide. Among the aptamers that specifically bind, those that block the binding of the ligand, or those that block the interaction domain, can thus be identified as suitable aptamers in the sense of the present invention. Techniques for generating aptamers are well known in the art, see, for example, Tuerk 1990, Science. Aug 3; 249(4968): 505-10; Ellington 1990, Nature. Aug 30; 346(6287): 818-822.

[0059] "MicroRNA" in the sense of the present invention refers to a single-stranded RNA molecule that is at least partially complementary to a nucleic acid sequence contained in the CFAP52 transcript. MicroRNAs typically have a length of about 19 to 26 nucleotides. MicroRNAs are synthesized as precursors, so-called pri-microRNAs, which have a hairpin structure and two complementary self-complementary regions that form a hairpin stem.

[0060] The term "small interfering RNA (siRNA)" refers to a nucleic acid molecule that is a double-stranded RNA agent, which is complementary to a portion of the CFAP52 transcript and can base pair. siRNA works by specifically directing the enzyme in the host cell to cut the target RNA. By virtue of the specificity of the siRNA sequence, and its homology with the RNA target, siRNA can cause the cutting of the target RNA chain, thereby inactivating the target RNA molecule. Preferably, the siRNA sufficient to regulate RNAi comprises the following nucleic acid sequence, which contains the target gene inverted repeat fragment and the target gene coding region (or portion). The complementary region of siRNA allows siRNA to be sufficient to hybridize with the target RNA, thereby regulating RNAi. In mammals, siRNA is a length of about 19-25 nucleotides.

[0061] In the following examples, unless otherwise indicated, the reagents used are analytically pure and all reagents used can be obtained from commercial channels. Unless otherwise specified, the western blot and other operations involved in the examples of the present invention are all performed in accordance with "Molecular Cloning Experiment Guide (3rd Edition)" (Science Press, 2002 [US] J. Sambrook DW Russell, translated by Huang Peitang, etc.) and the manufacturer's instructions, and the operations of cell culture, cell passage, cell recovery and freezing, cell transfection, etc. are all performed in accordance with "Basic Technical Guide for Animal Cell Culture (4th Edition)" (Science Press, 2000, [UK] Freshani (RI) author, translated by Zhang Jingbo, etc.) and the manufacturer's instructions.

[0062] Cells, tissue chips, plasmids, lentivirus, siRNA

[0063] 1. Human normal esophageal epithelial cells NEC and SHEE and human esophageal squamous cell carcinoma cell lines YES2, KYSE30, KYSE 70, KYSE 140, KYSE150, KYSE 180, KYSE410, KYSE450, KYSE510, and COLO680N are all commercial cell lines donated by Professor Yutaka Shimada of Kyoto University, Japan, and can also be purchased on commercial websites.

[0064] 2. Human esophageal squamous cell carcinoma tissue chip was purchased from Shanghai Xinchao Biotechnology Co., Ltd., product model HEsoS180Su10. The chip carries tumor tissues of 112 esophageal squamous cell carcinoma patients and paired adjacent cancer tissues of 68 patients (adjacent cancer tissue refers to tissue 2 cm away from esophageal squamous cell carcinoma tissue). Tissue sections were obtained by wax embedding and sectioning.

[0065] 3. pLenti-Vector (Product No.: VP106) and pLenti-CFAP52 plasmids and their corresponding lentiviruses were provided, constructed and packaged by Beijing Maijin Biotechnology Co., Ltd.

[0066] 4. siCFAP52-NC, siCFAP52-1, siCFAP52-2, and siCFAP52-3 were synthesized by Guangzhou Ruibo Biotechnology Co., Ltd., catalog number: SIGS0015837-1.

[0067] Culture media, reagents, antibodies

[0068] 1. Complete culture medium was purchased from Beijing Xigong Biotechnology Co., Ltd., which is 10% FBS RPMI-1640 culture medium, containing 10% fetal bovine serum (FBS), 100U / ml Penicillin, 100U / ml Streptomycin, 5958mg / ml HEPES, L-Glutamine, NaHCO3, and Phenol Red.

[0069] 2. Transfection reagent Lipofectamine 2000 Reagent (Lipofectamine 2000) was purchased from Thermo Fisher Scientific, catalog number: 11668030.

[0070] 3. MTS Kit CellTiter AQueous One Solution Cell Proliferation Assay was purchased from Promega, catalog number: G3581.

[0071] 4. Propidium iodide (PI) was purchased from BD Biosciences, catalog number: 550825.

[0072] 5. BCA protein concentration determination kit was purchased from Beijing Pulilai Gene Technology Co., Ltd., catalog number P1511.

[0073] 6. Super ECL ultrasensitive luminescent liquid (middle) was purchased from Beijing Pulilai Gene Technology Co., Ltd., product number: P1030.

[0074] 7. Antigen retrieval solution was purchased from Beijing Zhongshan Jinqiao Biological Co., Ltd., product number: ZLI 9071.

[0075] 8. The goat two-step detection kit (goat enhanced polymer detection system) was purchased from Beijing Zhongshan Jinqiao Biotechnology Co., Ltd., catalog number PV-9003.

[0076] 9.CFAP52 antibody (primary antibody) was purchased from Abcam, catalog number: ab127559.

[0077] 10.β-actin antibody (primary antibody) was purchased from Abcam, catalog number: ab8226.

[0078] 11. The secondary antibodies used in Western blot experiments were purchased from Promega Corporation, anti-Mouse IgG (H+L), HRP Conjugate, catalog number: W4021; anti Rabbit IgG (H+L), HRP Conjugate, catalog number: W401B.

[0079] Example 1: Detection of CFAP52 expression in tumor tissues of 112 patients with esophageal squamous cell carcinoma and 68 paired adjacent cancer tissues

[0080] 1. Immunohistochemistry to detect the expression of CFAP52 in human esophageal squamous cell carcinoma tissue microarray

[0081] The kit used for the immunohistochemistry experiment was a goat two-step detection kit (goat enhanced polymer detection system), in which the endogenous peroxidase blocker was replaced by goat serum to achieve a better blocking effect. The remaining reagents were all reagents provided with the kit, and the operation was carried out according to the kit instructions.

[0082] (1) Bake the tissue slides in an oven at 60°C for 2 h.

[0083] (2) Dewax the slides in xylene I for 30 min, then in xylene II for 30 min, then in anhydrous ethanol I for 5 min, then in anhydrous ethanol II for 5 min, then in 90% ethanol for 5 min, then in 75% ethanol for 5 min, and finally in 60% ethanol for 5 min.

[0084] (3) Antigen retrieval: Place the tissue sections in EDTA antigen retrieval solution (pH 9.0), heat in a pressure cooker for 3 min, and cool naturally to room temperature.

[0085] (4) Wash three times with 1× PBS, 5 min each time.

[0086] (5) Add an appropriate amount of 3% H2O2 solution onto the slices and incubate in a humidified chamber for 10 min at room temperature.

[0087] (6) Wash three times with 1× PBS, 5 min each time.

[0088] (7) Add an appropriate amount of goat serum to the slices and incubate them in a wet box for 30 min at room temperature. Discard the serum.

[0089] (8) Add an appropriate amount of diluted primary antibody onto the slice, place in a humidified chamber, and incubate at 4°C overnight.

[0090] (9) The next day, wash the cells three times with 1× PBS, each time for 5 min.

[0091] (10) Add biotin-labeled secondary antibody of appropriate concentration onto the slices, place the slices in a humidified chamber, and incubate at room temperature for 30 min.

[0092] (11) Wash three times with 1× PBS, 5 min each time.

[0093] (12) Add an appropriate amount of the prepared DAB staining solution to the section and observe under a microscope until a satisfactory degree of staining is achieved.

[0094] (13) Place the slide in double distilled water to terminate DAB color development and wash with double distilled water for 10 min.

[0095] (14) Add hematoxylin to the slide to stain the cell nucleus, incubate for 2 min, differentiate with 1% hydrochloric acid alcohol, and rinse under running tap water for 10 min;

[0096] (15) Alcohol dehydration: dehydrate the slides in 60% ethanol, 75% ethanol, 90% ethanol, and anhydrous ethanol for 2 min each time;

[0097] (16) Place the slide in xylene for 5 min to make it transparent and place it in a fume hood to dry.

[0098] (17) After adding neutral gum, seal the slide with a coverslip.

[0099] (18) Observe under a microscope, collect and save pictures. Typical pictures are as follows Figure 1A shown.

[0100] 2. Data collection and processing

[0101] The results of tissue microarray staining showed that the expression of CFAP52 in 112 human esophageal squamous cell carcinoma tissue samples was significantly higher than that in 68 paired adjacent cancer tissue samples, with a statistically significant difference (P<0.05). Figure 1BThe patients were further divided into CFAP52 low expression group and CFAP52 high expression group according to the staining intensity and positive rate. The survival curve was drawn by Kaplan-Meier method, and the difference in survival rate between the two groups was tested by Log-rank test. The results are shown in the figure. Figure 1C As shown in the figure, P﹤0.05 indicates that the difference is statistically significant. Figure 1C It can be seen that the survival time of esophageal squamous cell carcinoma patients in the low CFAP52 expression group was significantly longer than that in the high CFAP52 expression group, indicating that CFAP52 can be used as a target molecule for esophageal squamous cell carcinoma cells.

[0102] Example 2: Expression of CFAP52 in normal human esophageal epithelial cells and esophageal squamous cell carcinoma tumor cells

[0103] Western blot was used to detect the expression of CFAP52 in normal human esophageal epithelial cells (NEC, SHEE) and esophageal squamous cell carcinoma tumor cells (YES2, KYSE30, KYSE 70, KYSE 140, KYSE150, KYSE 180, KYSE410, KYSE450, KYSE510, COLO680N).

[0104] 1. Extraction of total cell protein

[0105] (1) Two normal human esophageal epithelial cell lines (NEC, SHEE) and 10 esophageal squamous cell carcinoma cell lines (YES2, KYSE30, KYSE 70, KYSE 140, KYSE150, KYSE 180, KYSE410, KYSE450, KYSE510, COLO680N) with good growth status were respectively obtained, the culture medium was discarded, and the cells were washed three times with ice-cold 1× PBS; then the cells were scraped and centrifuged at 3000 rpm, 4°C for 5 min to collect the cell pellet;

[0106] (2) Add an appropriate amount of protein lysis buffer (1 mL RIPA / 10 7 Cells were lysed on ice for 30 min and vortexed every 10 min.

[0107] (3) Centrifuge at 12,000 rpm, 4°C for 20 min.

[0108] (4) The supernatant is the total cell protein and should be stored in a -80°C refrigerator for future use.

[0109] 2. Determination of Protein Concentration

[0110] The operation was performed according to the instructions of the BCA protein concentration assay kit.

[0111] (1) Prepare BCA working solution: According to the number of standards and samples, prepare an appropriate amount of BCA working solution by 50 volumes of reagent A and 1 volume of reagent B and mix thoroughly.

[0112] (2) Add 0, 3.125, 6.25, 12.5, and 25 μL of the protein standard to the protein standard wells of a 96-well plate and add deionized water to make up to 25 μL. Take 2 μL of the sample to be tested and add it to the 96-well plate and add deionized water to make up to 25 μL.

[0113] (3) Add 200 μL of BCA working solution to the sample wells and protein standard wells (i.e., the volume ratio of sample to working solution is 1:20) and mix well.

[0114] (4) Warm bath at 37°C for 30 minutes.

[0115] (5) Measure the absorbance at a wavelength of 570 nm using an enzyme-labeled instrument.

[0116] (6) Create a standard curve and calculate the sample protein concentration from the standard curve.

[0117] 3. Western Blot

[0118] Sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) protein electrophoresis

[0119] (1) Gel preparation: Prepare SDS-PAGE separation gel and 5% stacking gel of corresponding concentration according to the protein molecular weight requirements. After the stacking gel layer solidifies, carefully pull out the comb, repeatedly rinse the loading wells, fix the gel glass plate on the electrophoresis device, add 1× Tris-glycine electrophoresis buffer, rinse the loading wells with electrophoresis buffer and then load the sample.

[0120] (2) Loading: Take an equal amount of protein, add an equal volume of loading buffer, heat at 100°C for 10 min to denature, and then load the sample.

[0121] (3) Electrophoresis conditions: 80 V, until the dye reaches the bottom edge.

[0122] Constant current wet transfer

[0123] (1) Prepare the transfer buffer in advance and pre-cool it.

[0124] (2) Cut the PVDF membrane into appropriate size and activate it in methanol for 40s-60s.

[0125] (3) Take out the PAGE gel, remove the accumulated gel, and place the separation gel into the transfer solution. Follow the steps of “white board-sponge-filter paper-membrane-gel-filter paper-sponge-black board”. Be careful not to have any bubbles. After the sponge board is installed, connect the device. Black against black, red against white.

[0126] (4) Electrophoresis conditions: constant current 0.35 A, 90 min.

[0127] Western blotting

[0128] (1) Place the PVDF membrane in blocking solution (1×PBS + 5% skim milk powder) and block at room temperature for 1 h.

[0129] (2) Dilute the primary antibody in a certain ratio with blocking solution, put it into the hybridization bag, and incubate at 37℃ for 2h or 4℃ overnight.

[0130] (3) Rinse three times with PBST at room temperature, 5-10 min each time.

[0131] (4) Dilute the secondary antibody in a certain ratio with blocking solution, put it into the hybridization bag, and incubate at room temperature for 1 hour.

[0132] (5) Mix equal amounts of Solution A and Solution B of the Western Blot Chemiluminescence Luminol Kit and drop them onto the membrane to completely cover the PVDF membrane. Allow to react at room temperature for 1 min. Expose the membrane and the results will be as follows: Figure 2 shown.

[0133] from Figure 2 It can be seen that, taking the expression level of β-actin (i.e., the depth of the band color) as the standard, the expression of CFAP52 in 10 esophageal squamous cell carcinoma tumor cells was significantly upregulated compared with 2 normal esophageal epithelial cells, indicating that CFAP52 is crucial for the occurrence and development of esophageal squamous cell carcinoma.

[0134] Example 3: Effect of overexpression of CFAP52 on the proliferation ability of esophageal squamous cell carcinoma cells

[0135] The CDS sequence of the CFAP52 gene (NM_145054) was inserted into the overexpression lentiviral vector pLenti to make the overexpression plasmid pLenti-CFAP52, and the empty vector pLenti-Vector was used as a blank control. pLenti-CFAP52 and pLenti-Vector were packaged with lentivirus, respectively. The above plasmid construction and lentiviral packaging were commissioned to Beijing Maijin Biotechnology Co., Ltd.

[0136] The CDS sequence of the CFAP52 gene is shown in Seq ID No.7:

[0137] ATGGATAACAAAATTTCGCCGGAGGCCCAAGTGGCGGAGCTGGAACTTGACGCC

[0138] GTGATCGGCTTCAATGGACATGTGCCCACTGGTCTCAAATGCCATCCTGACCAGG

[0139] AGCATATGATTTATCCTCTTGGTTGCACAGTCCTCATTCAGGCAATAAATACTAA

[0140] AGAGCAGAACTTCCTACAGGGTCATGGCAACAACGTCTCCTGCTTGGCCATCTCC

[0141] AGGTCTGGAGAGTACATCGCCTCCGGACAAGTCACATTCATGGGGTTCAAGGCA

[0142] GACATCATTTTGTGGGATTATAAGAACAGAGAGCTGCTTGCTCGGCTGTCCCTTC

[0143] ACAAAGGCAAAATTGAAGCTCTGGCCTTTTCTCCAAATGATTTGTACTTGGTATC

[0144] ACTAGGAGGCCCAGATGACGGAAGTGTGGTGGTGTGGAGCATAGCCAAGAGAG

[0145] ATGCCATCTGTGGCAGCCCTGCAGCCGGCCTCAATGTTGGCAATGCCACCAATGT

[0146] GATCTTCTCCAGGTGCCGGGATGAGATGTTTATGACTGCTGGAAATGGGACAATT

[0147] CGAGTATGGGAATTGGATCTTCCAAATAGAAAAATCTGGCCAACTGAGTGCCAA

[0148] ACAGGACAGTTGAAAAGAATAGTCATGAGTATTGGAGTGGATGATGATGATAGC

[0149] TTTTTCTACCTTGGCACCACGACTGGAGATATTCTAAAAATGAACCCCAGGACTA

[0150] AACTGCTGACAGATGTTGGGCCTGCGAAGGACAAATTCAGTTTGGGAGTGTCAG

[0151] CTATCAGGTGCCTGAAGATGGGGGGTTTGTTGGTGGGCTCTGGAGCCGGACTGCT

[0152] GGTCTTCTGTAAAGCCCTGGCTACAAACCCATCAAGAAGATTCAGTTACAAGG

[0153] CGGCATCACTTCTATCACACTTCGAGGAAGGACACCAGTTTCTCGTAGGAAACA

[0154] GAAGAATCGCCACATTTATCGTGTCAGCTTCACGGATTTCAAAGAGACGCTCATAG

[0155] CGACTTGTCACTTTGATGCTGTCGAGGATATTGTCTTTCCATTTGGCACTGCTGAG

[0156] CTATTTGCAACCTGTGCCAAGAAGGATATCAGGGTGTGGCCACACATCATCCAAC

[0157] AGGGAGCTGCTGCGGATCACCGTGCCCAACATGACCTGCCACGGCATCGACTTC

[0158] ATGAGGGACGGCAAAAGCATCATTTCAGCATGGAACGACGGTAAAATCCGAGCC

[0159] TTCGCCCCAGAGACAGGCCGACTGATGTATGTCATTAACAATGCTCACAGGATCG

[0160] GCGTCACCGCCATCGCCACCACCAGTGACTGTAAAAGGGTCATCAGTGCGGTG

[0161] GGGAAGGGGAGGTGAGGGTATGGCAGATAGGCTGTCAGACCCAGAAGCTGGAG

[0162] GAGGCCCTGAAGGAACACAAGTCATCAGTGTCCTGCATTAGGGTGAAGAGGAAC

[0163] AACGAGGAGTGTGTCACCGCCAGCACCGATGGGACTTGTATCATTTGGGACCTTG

[0164] TGCGTCTCAGGAGGAATCAGATGATACTAGCCAACACCTTATTCCAGTGTGTGTG

[0165] CTATCACCCTGAGGAGTTCCAGATCATCACCAGCGGAACAGACAGAAAGATTGC

[0166] TTACTGGGAAGTATTTGATGGGACAGTAATCAGAGAATTGGAAGGTTCCCTGTCT

[0167] GGGTCGATAAATGGCATGGATATCACACAGGAAGGGGTGCACTTTGTCACAGGT

[0168] GGAAATGACCATCTGGTCAAAGTTTGGGATTATAATGAGGGTGAAGTGACTCAC

[0169] GTTGGGGTGGGACACAGTGGCAACATCACACGCATCCGCATAAGTCCAGGAAAT

[0170] CAATATATTGTTAGTGTAAGTGCCGATGGAGCCATTTTGCGATGGAAGTACCCATATACCTCCTGA。

[0171] Separate 1 - 5×10 5KYSE410 cells and KYSE450 cells were plated into six-well plates. After the cells adhered, the original culture medium was discarded, the cells were washed with 1×PBS, and the PBS was discarded. 1 mL of complete culture medium and 5 μL of virus concentrate (pLenti-CFAP52 lentivirus or pLenti-Vector lentivirus) were added to each well, mixed well, and placed in an incubator for continued culture for 24 hours. 1 mL of complete culture medium was added for continued culture for 24 hours, and 2 μg / mL of puromycin was added to screen stable strains, and a control group (untreated group) was set up. After all the cells in the control group were killed, the stable cell lines were cultured with 1 μg / mL of puromycin, and the stable cell lines of KYSE410 cells and KYSE450 cells were frozen for seed preservation. A Western blot experiment was then performed to detect the overexpression efficiency of CFAP52. The specific operation was the same as in Example 2, and the results are as shown in FIG. Figure 3 shown.

[0172] from Figure 3 It can be seen that compared with the pLenti-Vector control group, the expression of CFAP52 in KYSE410 and KYSE450 cells stably transfected with the pLenti-CFAP52 overexpression plasmid was significantly upregulated, indicating that the KYSE410 and KYSE450 cell lines stably overexpressing CFAP52 were successfully constructed.

[0173] MTS assay was performed to detect the cell viability of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared as described above.

[0174] 1.MTS Experiment

[0175] (1) In a clean hood, digest the cells and prepare a single-cell suspension.

[0176] (2) Mix 9 μL of the single-cell suspension with 1 μL of trypan blue staining solution, and add 10 μL of the mixture to a cell counting plate.

[0177] (3) Measure the cell density using a cell counter.

[0178] (4) Use culture medium to adjust the density of the single-cell suspension to 50,000 cells / mL.

[0179] (5) The cell suspension was plated in a 96-well plate at a volume of 100 μL per well, and the 96-well plate was placed in a cell culture incubator for culture.

[0180] (6) After the cells adhered to the wall, the assay was performed at 0 h, 24 h, 48 h, and 72 h.

[0181] (7) Mix the MTS reagent and culture medium in a ratio of 1:9, use immediately after preparation, and store in a dark place.

[0182] (8) Discard the original culture medium, add 100 μL of MTS mixture to each well, shake gently, and incubate in a light-proof incubator for 1 h.

[0183] (9) Set the parameters of the microplate reader and select a wavelength of 490 nm to measure the absorbance. Be careful not to have bubbles in the wells.

[0184] 2. Data Analysis

[0185] The t-test was used for statistical analysis, and P < 0.05 was considered statistically significant. Figure 4A and Figure 4B shown.

[0186] from Figure 4A and Figure 4B It can be seen that compared with the control group, the cell viability of KYSE410 cells and KYSE450 cells was significantly enhanced after overexpression of CFAP52, indicating that CFAP52 can promote the malignant proliferation of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the growth of esophageal squamous cell carcinoma cells and further improve the treatment effect and quality of life of patients.

[0187] Example 4: Effect of overexpression of CFAP52 on the clone-forming ability of esophageal squamous cell carcinoma cells

[0188] The clone formation of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0189] 1. Plate colony formation experiment

[0190] (1) The transiently transfected KYSE410 and KYSE450 cells were digested and prepared into single cell suspensions in a clean bench.

[0191] (2) Use culture medium to adjust the density of the cell suspension to 1250 cells / mL. Take 4 mL of the cell suspension and add it to a 6 cm cell culture dish. Mix gently and place in a cell culture incubator for culture.

[0192] (3) When cell clones grow to be visible to the naked eye, stop cell culture.

[0193] (4) Discard the original culture medium, wash the cells with 1× PBS, and discard the 1× PBS.

[0194] (5) Add 1 mL of methanol solution to fix the cells, incubate at room temperature for 15 min, and discard the methanol.

[0195] (6) Add 1 mL of crystal violet stain and stain at room temperature for 30 min.

[0196] (7) Recover the crystal violet dye solution, carefully wash off the excess dye solution, and dry it at room temperature.

[0197] (8) Use Image J software to count the number of cell clones formed and take photos for storage. The results are as follows: Figure 5A shown.

[0198] 2. Data Analysis

[0199] The t-test was used for statistical analysis, and P < 0.05 was considered statistically significant. Figure 5B shown.

[0200] from Figure 5A and Figure 5B It can be seen that compared with the control group, after overexpression of CFAP52, the cloning efficiency of KYSE410 cells and KYSE450 cells increased significantly, indicating that CFAP52 can promote the proliferation of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may block the occurrence and development of esophageal squamous cell carcinoma cells.

[0201] Example 5: Effect of overexpression of CFAP52 on cell cycle progression in esophageal squamous cell carcinoma cells

[0202] The cell cycle distribution of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0203] 1. Cell Cycle Analysis

[0204] (1) Discard the original culture medium in the culture dish, gently wash the cells with 1× PBS, and discard the 1× PBS.

[0205] (2) Add an appropriate amount of 0.25% trypsin, and after the cells have detached from the cell culture dish, add an appropriate amount of culture medium to neutralize the cells.

[0206] (3) Centrifuge at 780 rpm for 5 min and discard the supernatant.

[0207] (4) Wash the cells with pre-cooled 1× PBS, centrifuge at 780 rpm for 5 min, and discard the supernatant.

[0208] (5) Add 250 μL of pre-cooled 1× PBS and gently flick the cells. Then slowly add 750 μL of pre-cooled anhydrous alcohol dropwise into the cell suspension, gently mixing while adding.

[0209] (6) Fix overnight at 4°C.

[0210] (7) The next day, centrifuge the fixed cells at 780 rpm for 5 min and discard the supernatant.

[0211] (8) Add 1× PBS for washing, centrifuge at 780 rpm for 5 min, and discard the supernatant.

[0212] (9) Add 300 μL PI / RNase buffer and incubate for 15 min at room temperature in the dark.

[0213] 2. Data Analysis

[0214] The t-test was used for statistical analysis, and P < 0.05 was considered statistically significant. Fig. 6A , Figure 6B , Fig. 7A and Figure 7B shown.

[0215] from Fig. 6A , Figure 6B , Fig. 7A and Figure 7B It can be seen that compared with the control group, after overexpression of CFAP52, the cell cycle progression of KYSE410 cells and KYSE450 cells was significantly changed, and the proportion of cells distributed in the S phase increased significantly, indicating that CFAP52 can promote the cell cycle progression of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may block the malignant proliferation of esophageal squamous cell carcinoma cells.

[0216] Example 6: Effect of overexpression of CFAP52 on the migration ability of esophageal squamous cell carcinoma cells

[0217] The cell migration of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0218] 1. Transwell cell migration assay

[0219] (1) The transiently transfected KYSE410 and KYSE450 cells were digested separately in a clean bench, and then the cells were resuspended in serum-free culture medium and the cell density was adjusted to 10,000 cells / mL.

[0220] (2) Take 200 μL of cell suspension and add it to the upper chamber, and add 1 mL of cell culture medium containing 20% ​​serum to the lower chamber, and place them in a cell culture incubator for 24 hours.

[0221] (3) Discard the culture medium in the upper and lower chambers and add 1 mL of methanol solution to the lower chamber to fix the cells for 15 min, then discard the methanol.

[0222] (4) Add 1 mL of crystal violet stain into the lower chamber and stain at room temperature for 30 min.

[0223] (5) Recover the crystal violet dye solution, carefully wash off the excess dye solution, and dry it at room temperature.

[0224] (6) Use Image J software to count the number of cells that pass through the chamber and take photos. Fig. 8A shown.

[0225] 2. Data Analysis

[0226] The t-test was used for statistical analysis, and P < 0.05 was considered statistically significant. Figure 8B shown.

[0227] from Fig. 8A and Figure 8B It can be seen that compared with the control group, the migration ability of KYSE410 cells and KYSE450 cells was significantly enhanced after overexpression of CFAP52, indicating that CFAP52 can promote the metastasis of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the recurrence and metastasis of esophageal squamous cell carcinoma cells and improve the treatment effect and quality of life of patients.

[0228] Example 7: Effect of overexpression of CFAP52 on the scratch healing ability of esophageal squamous cell carcinoma cells

[0229] The scratch healing of KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 was detected.

[0230] 1. Cell scratch assay

[0231] (1) Marking the culture plate: Use a marker pen to draw horizontal lines on the back of the 6-well plate. Make at least 5 lines across each well, and make each line even and parallel.

[0232] (2) Cell plating: KYSE410 cells and KYSE450 cells stably overexpressing CFAP52 prepared in Example 3 were inoculated with 5-10×10 cells per well according to the growth rate of the cells. 5 Make sure the cells are evenly spread and can grow confluently overnight.

[0233] (3) Cell streaking: On the second day, use a 20 μL sterilized pipette tip or toothpick to scratch the black line on the back of the well plate vertically so that the scratch intersects with the marked line.

[0234] (4) Washing cells and removing the scratched cells: After the streaking is completed, wash the cells 2-3 times with sterile PBS to remove the scratched cells so that the remaining gaps are clearly visible to the naked eye, and then replace with fresh serum-free or low-serum (<2%) culture medium.

[0235] (5) Cell culture and observation: The cells were cultured in a 37°C, 5% CO2 incubator. The cells were taken out after 24 hours and 48 hours, respectively, and observed and photographed under a microscope.

[0236] (6) Image acquisition: After opening the image using Image J software, 6 to 8 horizontal lines were randomly drawn and the mean of the distance between cells was calculated. The results are shown in Figure 2. Fig. 9A and Fig. 10A shown.

[0237] 2. Data Analysis

[0238] The t-test was used for statistical analysis, and P < 0.05 was considered statistically significant. Fig. 9B and Fig. 10B shown.

[0239] from Fig. 9A , Fig. 9B , Fig. 10A and Fig. 10B It can be seen that compared with the control group, the scratch healing ability of KYSE410 cells and KYSE450 cells was significantly enhanced after overexpression of CFAP52, indicating that CFAP52 can enhance the migration ability of esophageal squamous cell carcinoma cells. Therefore, inhibiting CFAP52 expression may effectively block the recurrence and metastasis of esophageal squamous cell carcinoma cells and further improve the treatment effect and quality of life of patients.

[0240] Example 8: Effect of interfering with CFAP52 expression on the proliferation ability of esophageal squamous cell carcinoma cells

[0241] The siRNA sequences siCFAP52-1, siCFAP52-2, and siCFAP52-3 targeting CFAP52 were designed, wherein the forward sequence of siCFAP52-1 is shown in Seq ID No.1: 5'-GGAGCAUAGCCAAGAGAGA-3', and the reverse sequence is shown in Seq ID No.2: 5'-UCUCUCUUGGCUAUGCUCC-3', the forward sequence of siCFAP52-2 is shown in Seq ID No.3: 5'-GGAGCCAUUUUGCGAUGGA-3', and the reverse sequence of siCFAP52-2 is shown in Seq ID No.4: 5'-UCCAUCGCAAAAUGGCUCC-3', the forward sequence of siCFAP52-3 is shown in Seq ID No.5: 5'-ACACCAGUUUCUCGUAGGA-3', and the reverse sequence of siCFAP52-3 is shown in Seq ID No.6 shows: 5'-UCCUACGAGAAACUGGUGU-3'.

[0242] Guangzhou Ruibo Biotechnology Co., Ltd. was commissioned to synthesize siCFAP52-1, siCFAP52-2, and siCFAP52-3. During the synthesis, dTdT was added to the 3' end to increase the stability of siRNA. The company also provided siCFAP52-NC as a control.

[0243] Lipofectamine 2000 Reagent instructions were used to operate siCFAP52-1, siCFAP52-2, siCFAP52-3, and siCFAP52-NC were transfected into YES20 and KYSE410 cells, respectively. Western blot experiments were then performed to detect the expression of CFAP52 after transfection to verify the interference efficiency of siRNA. The specific operations were the same as in Example 2, and the results are shown in FIG. Fig.11 shown.

[0244] from Fig.11 It can be seen that compared with the siCFAP52-NC control group, the expression of CFAP52 in YES2 and KYSE410 cells was significantly weakened after transfection with siCFAP52-1, siCFAP52-2 and siCFAP52-3, indicating that the interference efficiency of siCFAP52-1, siCFAP52-2 and siCFAP52-3 was higher.

[0245] MTS experiments were performed to detect changes in cell viability after transfection with siCFAP52-1, siCFAP52-2, and siCFAP52-3. The specific operations were the same as in Example 3, and the results were as follows: Fig. 12A and Fig. 12B shown.

[0246] from Fig. 12A and Fig. 12B It can be seen that compared with the control group, the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention significantly downregulated the cell viability of YES2 and KYSE410 after interfering with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2, and siCFAP52-3 provided by the present invention can inhibit the expression of CFAP52, thereby effectively blocking the malignant proliferation of esophageal squamous cell carcinoma cells.

[0247] Example 9: Effect of interfering with CFAP52 expression on the clone-forming ability of esophageal squamous cell carcinoma cells

[0248] The clone formation of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2 and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was detected. The specific operation was the same as that in Example 4, and the results were as follows. Fig.13A and Fig. 13B shown.

[0249] from Fig.13A and Fig. 13B It can be seen that compared with the control group, the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention significantly downregulated the plate clone formation ability of YES2 and KYSE410 after interfering with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can inhibit the expression of CFAP52, thereby effectively blocking the malignant proliferation of esophageal squamous cell carcinoma cells.

[0250] Example 10: Effect of interfering with CFAP52 expression on the cell cycle progression of esophageal squamous cell carcinoma cells

[0251] The cell cycle distribution of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2 and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was detected. The specific operation was the same as that in Example 5, and the results were as follows. Fig.14A , Fig. 14B , Fig.15A and Fig. 15B shown.

[0252] As can be seen from the figure, compared with the control group, the cell cycle distribution of YES2 and KYSE410 was significantly changed after the siCFAP52 expression was interfered with by the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention, and the proportion of cells distributed in the S phase was significantly reduced, indicating that the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can downregulate the expression of CFAP52, thereby effectively blocking the division process of esophageal squamous cell carcinoma cells.

[0253] Example 11: Effect of interfering with CFAP52 expression on the migration ability of esophageal squamous cell carcinoma cells

[0254] The migration ability of YES2 cells and KYSE410 cells transiently transfected with siCFAP52-1, siCFAP52-2 and siCFAP52-3 prepared in Example 8 and the control group siCFAP52-NC was detected. The specific operation was the same as that in Example 6. The results are shown in FIG. Fig.16A and Fig. 16B shown.

[0255] from Fig.16A and Fig. 16BIt can be seen that compared with the control group, the migration ability of YES2 and KYSE410 was significantly inhibited after the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention interfered with the expression of CFAP52, indicating that the siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can effectively inhibit the recurrence and metastasis of esophageal squamous cell carcinoma cells by downregulating the expression of CFAP52.

[0256] Example 12: Effect of interfering with CFAP52 expression on the scratch healing ability of esophageal squamous cell carcinoma cells

[0257] The above siRNA targeting CFAP52 and the control group siRNA were transiently transfected into YES2 and KYSE410 cells, and then a cell scratch assay was performed to detect changes in cell migration ability. The specific operation was the same as in Example 7, and the results were as follows: Fig.17A , Fig. 17B , Fig.18A and Fig.18B shown.

[0258] from Fig.17A , Fig. 17B , Fig.18A and Fig.18B It can be seen that siCFAP52-1, siCFAP52-2 and siCFAP52-3 provided by the present invention can interfere with the expression of CFAP52, thereby significantly inhibiting the scratch healing ability of YES2 and KYSE410 cells, and effectively blocking the recurrence and metastasis of esophageal squamous cell carcinoma cells.

[0259] It can be seen from the above examples that the CFAP52 inhibitor provided by the present invention, wherein the siRNA sequence can effectively inhibit the cell viability, clone formation, cell cycle progression, scratch healing and migration ability of esophageal squamous cell carcinoma.

[0260] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A CFAP52 inhibitor, characterized in that The CFAP52 inhibitor is a nucleic acid inhibitor.

2. The CFAP52 inhibitor according to claim 1, characterized in that The nucleic acid inhibitor is a ribozyme, an antisense molecule, an oligonucleotide inhibitor, an aptamer, a microRNA, a siRNA or a shRNA.

3. The CFAP52 inhibitor according to claim 2, characterized in that The CFAP52 inhibitor is siRNA.

4. The CFAP52 inhibitor according to claim 3, characterized in that The CFAP52 inhibitor is siCFAP52-1, siCFAP52-2 or siCFAP52-3, wherein the forward sequence of siCFAP52-1 is shown in Seq ID No.1, the reverse sequence is shown in Seq ID No.2, the forward sequence of siCFAP52-2 is shown in Seq ID No.3, the reverse sequence of siCFAP52-2 is shown in Seq ID No.4, the forward sequence of siCFAP52-3 is shown in Seq ID No.5, and the reverse sequence of siCFAP52-3 is shown in Seq ID No.

6.

5. Use of the CFAP52 inhibitor according to any one of claims 1 to 4 in the preparation of a drug for treating and / or preventing esophageal squamous cell carcinoma.

6. The use according to claim 5, characterized in that The esophageal squamous cell carcinoma is from a mammal.

7. The use according to claim 6, characterized in that The mammal is a human.

Images