Rice bacterial blight resistance-related protein XA50, its encoding gene and applications

Abstract

The present invention belongs to the field of plant genetic engineering, and particularly relates to an XA50 protein related to rice resistance to bacterial blight, its coding gene, and applications thereof. Experimental results have proved that the complementary transgenic plants of Xa50 have significantly enhanced resistance to bacterial blight, and the knockout transgenic plants of the Xa50 gene have significantly reduced resistance to bacterial blight. The rice Xa50 gene provided by the present invention has the function of positively regulating the disease resistance of rice, can be used to improve the resistance of rice to bacterial blight, and is of great significance for cultivating new rice varieties resistant to bacterial blight.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular relates to an XA50 protein related to rice resistance to bacterial blight and a coding gene and application thereof. Background Art

[0002] Rice ( Oryza. sativa L) is one of the most important food crops in the world and is vulnerable to a variety of pathogens during its growth. Xanthomonas oryzae pv. oryza , Xoo ) is the most serious and widespread bacterial disease in rice production. The main characteristics of bacterial blight are strong suddenness and rapid spread of infection. At present, its scope of occurrence has spread to rice-producing areas around the world, which can lead to a 20%-50% reduction in production throughout the year. In severe cases, there will be no harvest, posing a serious threat to agricultural production and food security. Chemical control of rice bacterial blight is not only costly and ineffective, but also environmentally unfriendly. Cultivating and promoting disease-resistant varieties is currently the most fundamental, economical and safest way to prevent and control bacterial blight. The cloning and functional research of disease-resistant genes is of great significance for the study of the molecular mechanism of rice disease resistance and molecular disease-resistant breeding.

[0003] At present, there are 48 rice bacterial blight resistance genes that have been internationally registered and reported in journals, of which 16 members have been isolated and cloned. According to the type of disease resistance gene encoding product and disease resistance mechanism, they are mainly divided into six types: NLR (nucleotide-binding leucine-rich repeat receptors), receptor-like kinases, cell wall-associated kinases (WAK), γ subunit of transcription factor ⅡA, E (executor) and SWEET. Plant WAK is a special type of receptor-like kinase, which consists of an extracellular domain, a transmembrane domain and an intracellular kinase domain. Among them, the extracellular domain is usually directly connected to the cell wall. As a protein kinase that connects the cell wall and the cytoplasm at the same time, it often has multiple biological functions, such as regulating plant growth and development, participating in signal transduction and activating disease resistance. The multiple roles of WAK not only have important scientific research value, but also have great application potential in the synergistic improvement of comprehensive rice traits. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a protein XA50 resistant to rice bacterial blight, its coding gene and application. The rice Xa50 gene has the function of positively regulating the disease resistance of rice, can be used to improve the resistance of rice to bacterial blight, and is of great significance for cultivating new rice varieties resistant to bacterial blight.

[0005] The object of the present invention can be achieved by the following technical solutions:

[0006] A protein XA50 resistant to rice bacterial blight has an amino acid sequence as shown in SEQ ID No. 3.

[0007] Meanwhile, the present invention also provides a gene encoding the protein XA50 resistant to rice bacterial blight, and the gene has a nucleotide sequence as shown in SEQ ID No. 2.

[0008] The present invention also provides an expression vector, recombinant bacterium or host cell of the above gene.

[0009] Meanwhile, the present invention also provides the application of the protein XA50 resistant to rice bacterial blight, or its coding gene in the improvement of rice resistance to bacterial blight.

[0010] The above application is further an application in cultivating rice resistant to bacterial blight.

[0011] The present invention also provides a method for cultivating rice resistant to bacterial blight, which includes the steps of overexpressing the above gene in a target plant by genetic engineering methods and screening plants with enhanced ability to resist bacterial blight.

[0012] The above method further includes the step of cultivating a rice variety resistant to bacterial blight.

[0013] The above method also includes the step of hybridizing the obtained plants or varieties with enhanced ability to resist bacterial blight with other varieties to obtain rice varieties with expected performance.

[0014] The present invention creates a new germplasm CX315 resistant to rice bacterial blight by distant hybridization with wild rice, identifies the resistance level using 10 races of Xanthomonas oryzae pv. oryzae at the tillering stage, then constructs a mapping and segregation population, maps the gene controlling rice resistance to bacterial blight by map-based cloning, and finally verifies the gene function through gene complementation and gene editing techniques, and successfully isolates a gene resistant to rice bacterial blight: Xa50. Experimental results show that: compared with the susceptible receptor parent JG30, CX315 has a highly significant improvement in resistance to rice bacterial disease bacterial blight, can be effectively applied to the molecular improvement of rice disease resistance, and has great development and application prospects.

[0015] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0016] The present invention discloses the amino acid sequence of the rice bacterial blight resistance protein XA50, as well as the sequences of its encoding gene and coding region sequence, and verifies the function of the gene through gene complementation and gene editing techniques. The experimental results prove that the complementary transgenic plants of Xa50 have significantly enhanced resistance to bacterial blight, and the transgenic plants with Xa50 gene knockout have significantly reduced resistance to bacterial blight. The rice Xa50 gene provided by the present invention has the function of positively regulating the disease resistance of rice, can be used to improve the resistance of rice to bacterial blight, and is of great significance for cultivating new rice varieties resistant to bacterial blight. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] The following further details the specific embodiments of the present invention with reference to the accompanying drawings.

[0018] Figure 1 It is the multi-strain inoculation identification of the new disease-resistant germplasm CX315 and the receptor parent JG30.

[0019] Figure 2 It is the fine mapping diagram of the Xa50 gene.

[0020] Figure 3 It is the comparison diagram of the expression levels of Xa50 in CX315 and JG30 after inoculation with T7174.

[0021] Figure 4 It is the comparison diagram of the phenotypes of bacterial blight inoculation of the Xa50 complementary transgenic material and the CRISPR / Cas9 gene-edited transgenic material in the T1 generation. Among them, A: the comparison diagram of the leaf lesion phenotypes after inoculation with the bacterial blight strain T7174; B: the comparison diagram of the leaf lesion lengths after inoculation with the bacterial blight strain T7174. SPECIFIC EMBODIMENTS

[0022] The following further describes the present invention with reference to specific embodiments, but the protection scope of the present invention is not limited thereto.

[0023] To more fully explain the implementation of the present invention, the following provides implementation examples of the rice bacterial blight resistance gene Xa50. These implementation examples are only for explanation and do not limit the scope of the present invention. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels without special instructions.

[0024] Example 1: Obtaining of Material CX315 and Bacterial Blight Inoculation Identification

[0025] The applicant's laboratory created a bacterial blight-resistant material CX315 through distant hybridization with wild rice. The traits of this material have been stably inherited after multiple generations of self-crossing. At the tillering stage, it was inoculated and identified with 10 bacterial blight pathogen races, and it was found that this material showed resistance to all tested strains, and the lesion length was significantly shorter compared with the susceptible receptor parent JG30 ( Figure 1 ).

[0026] Example 2. Genetic analysis and fine mapping of the Xa50 gene

[0027] CX315 was crossed with the bacterial blight-susceptible indica rice variety IR24 to obtain the F1 generation. At the tillering stage, it was inoculated with T7174, and all F1 plants showed disease resistance. The F1 plants were self-crossed to obtain an F2 segregation population of 2,342 individual plants. At the tillering stage, they were inoculated with T7174. 1,767 individual plants showed disease resistance, and 575 individual plants showed susceptibility. The disease resistance and susceptibility segregation ratio was statistically analyzed and chi-square tested, and it was proved that the disease resistance and susceptibility segregation ratio was 3:1, which conformed to the Mendelian single dominant gene inheritance law, indicating that the resistance of this material was controlled by a dominant single gene (Table 1).

[0028] Table 1. Genetic analysis of the bacterial blight-resistant material CX315

[0029]

[0030] According to the Shuhui 498 (R498) database (https: / / www.mbkbase.org / rice) sequence of the rice genome reference sequence and the IR24 sequence of the applicant's laboratory to search for Xa50 tightly linked molecular markers, the candidate gene was initially mapped to chromosome 11 of rice. By comparing the R498 and IR24 sequences in this interval, the different sequences were found. Primers were designed using the Primer designing tool of the NCBI database (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome). The product fragment range was about 100 - 500 bp, and a total of 80 pairs of primers were designed.

[0031] Twenty-one single plants with susceptible phenotypes were selected from the F2 segregation population of CX315 / IR24, and gene linkage analysis was performed using the above 80 pairs of primers. The target gene was mapped between marker ID11-7 and M11-540 on chromosome 11 of rice. Non-homologous regions within this interval were further selected to develop new molecular markers. The number of recombinant plants screened by markers M11-148, M11-204, M11-464, M11-588, M11-602, M11-577, and M11-594 was 10, 7, 3, 2, 1, 3, and 15, respectively. A co-segregating marker M11-489 was screened, so the target gene was finally mapped between the terminal linkage markers M11-464 and M11-602 on chromosome 11, and the physical interval was 147.7 kb ( Figure 2 ). Genomic DNA was extracted by the one-step method. The specific steps are as follows:

[0032] (1)Prepare 10x extraction buffer:

[0033] 100 mM Tris: Weigh 2.422 g of Tris powder and dissolve it in 100 mL of deionized water, and adjust the pH to 9.5; 5 mM EDTA: Weigh 0.3722 g of EDTA powder and dissolve it in the above Tris solution; 1 mol / L KCl: Weigh 14.91 g of KCl powder and dissolve it in the above mixture. Make up the volume to 200 mL and store it at room temperature. Dilute the stock solution 10-fold before use.

[0034] (2)Sampling: Cut 1-2 mm of rice leaves and place them in a 2 mL centrifuge tube, add 2 steel beads, and pipette 200 μL of 1x extraction buffer.

[0035] (3)Grind the sample: Place the centrifuge tube containing the sample and extraction buffer on the bead beater, balance it by the method of central symmetry, and beat it at 1000 rpm for 2 times, 30 seconds each time.

[0036] (4)Water bath: Place the ground sample in a 65 °C water bath for 30 minutes, and invert the centrifuge tube every 10 minutes to mix well.

[0037] (5)Pipette the supernatant: After the water bath, centrifuge the sample at 12000 rpm for 10 minutes, and pipette 100 μL of the supernatant into a 1.5 mL centrifuge tube or 96-well plate. The supernatant is the rice DNA.

[0038] The PCR reaction system used a 10 μL system: 2 μL of DNA template, 5 μL of 2×PCR reaction solution, 0.5 μL each of forward and reverse primers (10 μmol / L), and 2 μL of ddH2O. The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C - 60°C for 30 s (the annealing temperature varies for different primers), extension at 72°C for 10 s (the size of the PCR product should be less than 200 bp, and the extension time of the 2×PCR reaction solution is 30 s / 1 kb), for 35 cycles; extension at 72°C for 5 min, and hold at 16°C for 5 min. The PCR products were electrophoresed on a 5% agarose gel, and after electrophoresis, the gel was photographed and read using a gel imager. The primer sequences are shown in Table 2.

[0039] Table 2 Molecular markers used for fine mapping

[0040]

[0041] Example 3, Determination of candidate genes

[0042] Based on the 147.7 kb interval obtained from fine mapping, candidate gene prediction was performed in the rice Shuhui 498 genome database, and a total of 14 open reading frames (ORFs) were found. Expression analysis was performed on all candidate genes, as Figure 3 shown. The expression level of ORF5 was significantly up-regulated after CX315 was inoculated with T7174, and this gene was not induced to express in the recipient susceptible parent JG30. Therefore, this gene was preliminarily determined as a candidate gene and named Xa50. Its gDNA has the nucleotide sequence shown in SEQ ID No.1, its cDNA has the nucleotide sequence shown in SEQ ID No.2, and the encoded protein has the amino acid sequence shown in SEQ ID No.3.

[0043] Example 4, Construction of Xa50 gene complementary vector and gene CRISPR / Cas9 editing vector

[0044] 1. Construction of the complementary vector of Xa50

[0045] To verify whether the disease resistance of CX315 is caused by Xa50, using CX315 as a template, with Xa50-CF: gagctcggtacccggggatccTACACCTATATAACACTCCTAAATTAGAAAAAA (SEQ ID No.24) and Xa50-CR: caggtcgactctagaggatccTGTGCACAAAAATACATCTCCTTGA (SEQ ID No.25) as primers, a full-length sequence including the Xa50 promoter, expression cassette and terminator was successfully obtained by PCR amplification. Subsequently, using the ClonExpress II One Step Cloning Kit from Novoprotein (product number: C112-01), the PCR product fragment of Xa50 was ligated into the vector pCAMBIA1300 linearized by single digestion with BamHI through homologous recombination. This recombinant product was transformed into Escherichia coli TOP10 by heat shock method and then spread on an LB plate containing 50 mg / L kanamycin and grown for 16 hours. Positive clones were selected and the plasmid was extracted in small scale and sent to Beijing Sangon Biotech Co., Ltd. for first-generation sequencing. The plasmid with correct sequencing was named pCAMBIA1300-Xa50.

[0046] 2. Construction of the CRISPR / Cas9 editing vector for Xa50

[0047] The knockout vector for editing the Xa50 gene was constructed using the CRISPR / Cas9 technology, and the target sequences used were target sequence 1 and target sequence 2.

[0048] Target sequence 1: CCGCTGGATTCAATGGTGTTAGG (SEQ ID No.26); Target sequence 2: CACGCCGTTCCTGTTTGCGGAGG (SEQ ID No.27).

[0049] The vector construction referred to the method of Ma et al. (2015) (Ma X L, Zhang Q Y, Zhu Q L, et al. A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants[J]. Mol Plant, 2015, 8(8), 274-1284).

[0050] (1) Preparation of the target linker:

[0051] Target 1 adapter primer sequences: Xa50-gRT1: 5’-gccgCCGCTGGATTCAATGGTGTT-3’ (SEQ ID No.28), Xa50-OsU6aT1: 5’-aaacAACACCATTGAATCCAGCGG-3’ (SEQ ID No.29).

[0052] Target 2 adapter primer sequences: Xa50-gRT2: 5’-gttgCACGCCGTTCCTGTTTGCGG-3’ (SEQ ID No.30), Xa50-OsU6aT2: 5’-aaacCCGCAAACAGGAACGGCGTG-3’ (SEQ ID No.31).

[0053] Take 1 μL of each adapter primer (100 μM) and add it to 98 μL of ddH2O, then mix and dilute to 1 μM. Incubate at about 90 °C for 30 s, then transfer to room temperature to cool and complete annealing.

[0054] (2)sgRNA vector digestion: Take 1 μg of each LacZ-U6a / LacZ-U6b plasmid, digest with 10 U of BsaI in 25 μL reaction for 20 min, and store frozen.

[0055] (3)sgRNA expression cassette ligation reaction: Ligate the digested LacZ-U6a and LacZ-U6b plasmids with the adapters of Target 1 and Target 2 respectively. Ligation system: 1 μL of 10×T4 DNA ligase Buffer, 0.5 μL of vector plasmid, 0.5 μL of adapter, 0.05 μL of T4 DNA ligase (Takara), add water to make up to 10 μL. Incubate at room temperature for 15 minutes.

[0056] (4)First-round amplification: Each sgRNA expression cassette was divided into 2 PCR reactions, with a reaction system of 15 μL each: 0.5 μL of the ligation product was used as the template, and primers U-F (CTCCGTTTTACCTGTGGAATCG, SEQ ID No.32) / adapter reverse primer (reaction 1), and adapter forward primer / gR-R (CGGAGGAAAATTCCATCCAC, SEQ ID No.33) (reaction 2) were used. High-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase (Takara) was used for amplification: 0.5 μL of each forward and reverse primer, 2 μL of dNTP Mixture, 5 μL of 5×PrimeSTAR GXL Buffer, 0.5 μL of template, 0.5 μL of PrimeSTAR GXL DNA polymerase, and water was added to make up to 25 μL; 98℃ for 3 min; 98℃ for 15 s, 55℃ for 15 s, 68℃ for 15 s, for 35 cycles; 68℃ for 5 min, 12℃ for 5 min.

[0057] (5)Second-round amplification: 1 μL of the first-round PCR product was diluted 10-fold with H2O, and 1 μL of each was mixed as the template.

[0058] Primers for target 1, Pps-GGL: TTCAGAggtctcTctcgACTAGTATGGAATCGGCAGCAAAGG(SEQ IDNo.34), Pgs-GG2: AGCGTGggtctcGtcagggTCCATCCACTCCAAGCTC(SEQ ID No.35). The PCR product was U6a-sgRNA-Xa50.

[0059] Primers for target 2, Pps-GG2: TTCAGAggtctcTctgacacTGGAATCGGCAGCAAAGG(SEQ IDNo.36), Pgs-GGR: AGCGTGggtctcGaccgACGCGTATCCATCCACTCCAAGCTC(SEQ ID No.37). The PCR product was U6b-sgRNA-Xa50. High-fidelity PCR enzyme PrimeSTAR® GXL DNA Polymerase (Takara) was used for amplification, and the amplification system and procedure were the same as in (4).

[0060] (6) The above U6a-sgRNA-Xa50 and U6b-sgRNA-Xa50 were subjected to a digestion-ligation reaction with the pYLCRISPR / Cas9PubiH vector to obtain the Xa50 gene knockout vector pYLCRISPR / Cas9Pubi-Xa50. Digestion-ligation reaction system: U6a-sgRNA-Xa50 (10-15 ng), U6b-sgRNA-Xa50 (10-15 ng), pYLCRISPR / Cas9Pubi-H vector (60-80 ng), 10×CutSmart Buffer 1.5 μL, 10 mM ATP 1.5 μL, BsaI-HF 10 U, T4 DNA ligase 35 U, supplemented with ddH2O to 15 μL. Digestion-ligation reaction procedure: 37°C for 10 min, 10°C for 5 min, 20°C for 5 min, for 3 cycles; 37°C for 3 min, 10°C for 5 min, 20°C for 5 min, for 10 cycles.

[0061] The reaction product was transformed into Escherichia coli TOP10, and positive clones were screened. The recombinant vector with the correct sequence obtained was named pYLCRISPR / Cas9Pubi-Xa50.

[0062] Example 5, Rice Genetic Transformation

[0063] The plasmids of pCAMBIA1300-Xa50 and pYLCRISPR / Cas9Pubi-Xa50 in Example 2 were respectively transferred into the Agrobacterium strain EHA105 by the freeze-thaw method. The EHA105 strain containing the binary plasmid vector pCAMBIA1300-Xa50 was used to infect the callus of the susceptible receptor parent JG30 by the Agrobacterium infection method. After screening with hygromycin, the positive callus was successively differentiated and rooted to obtain complementary transgenic plants; the EHA105 strain containing the editing vector pYLCRISPR / Cas9Pubi-Xa50 was used to infect the callus of the disease-resistant material CX315 by the Agrobacterium infection method. After screening with hygromycin, the positive callus was successively differentiated and rooted to obtain knockout transgenic plants.

[0064] Example 6, Detection of Bacterial Blight Resistance of Transgenic Plants

[0065] The complementary transgenic positive line T1 generation and the Xa50-edited knockout transgenic plant line T1 generation KO were inoculated with the bacterial blight pathogen T7174, and the length of the leaf lesions was measured 14 days after inoculation. Figure 4It can be seen that the lesion length of the positive Xa50 gene complementary transgenic plants was significantly shorter than that of the wild type JG30; the lesion lengths of the Xa50 gene knockout plants were similar to those of JG30, showing susceptibility. This indicates that Xa50 positively regulates the resistance of rice to bacterial blight.

[0066] The above results fully demonstrate that Xa50 is a resistance-related protein, which mainly plays a positive regulatory role in the rice disease resistance response process and has utilization value for rice disease resistance breeding.

Claims

1. An application of a rice bacterial blight resistance protein XA50 or a gene encoding it in improving rice resistance to bacterial blight, wherein the amino acid sequence of the rice bacterial blight resistance protein XA50 is shown in SEQ ID No.

3.

2. The use according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID No.

2.

3. The use according to claim 1 or 2, characterized in that: The invention is used in cultivating rice resistant to bacterial blight.

4. A method for cultivating rice resistant to bacterial blight, characterized in that: The method comprises the steps of over-expressing a gene encoding rice bacterial blight resistance protein XA50 in a target plant by genetic engineering, and screening plants with enhanced resistance to bacterial blight; wherein the nucleotide sequence of the encoding gene is shown in SEQ ID No.

2.

5. The method according to claim 4, characterized in that The method further comprises the step of cultivating rice varieties resistant to bacterial blight.

6. The method according to claim 4, characterized in that The method also includes the step of hybridizing the obtained plants or varieties with enhanced resistance to bacterial blight with other varieties to obtain rice varieties with expected performance.

Images