Core-shell microneedle patch and portable equipment for rapidly detecting food hazardous substances

Abstract

The invention relates to a core-shell microneedle patch and portable equipment for rapid detection of food hazardous substances, the core-shell microneedle patch comprises an inner-layer microneedle patch and an outer-layer composite hydrogel shell, the inner-layer microneedle patch is modified with a fluorescent probe, and the core-shell microneedle patch can be used for detecting hazardous substances in a sample to be detected; the outer-layer composite hydrogel shell can quickly adsorb grease, pigment and organic acid impurities in a sample and remove most types of impurities in food samples, so that the accuracy of hazardous substance detection is ensured; the microneedle patch treated in the to-be-detected sample can be used for detecting the fluorescence intensity through the food hazardous substance rapid detection portable equipment, so that whether the to-be-detected sample contains hazardous substances or not and the content of the hazardous substances are judged. According to the portable equipment for on-site rapid detection of food hazardous substances based on microneedle sensing, integration of sample pretreatment, hazardous substance detection and data collection and analysis is realized; and rapid, sensitive and accurate detection of hazardous substances is realized.

Description

Technical Field

[0001] The invention belongs to the field of food safety detection, and in particular relates to a core-shell microneedle patch and a portable device for rapid detection of food hazards. Background Art

[0002] Contamination of food causes more than 200 diseases, resulting in millions of illnesses and deaths worldwide. Most health problems stem from natural toxins and environmental pollutants. These chemical hazards include heavy metals, natural toxins, pesticide and veterinary drug residues, as well as food additives and food allergens, which may cause acute poisoning or long-term diseases. In order to ensure food safety, it is necessary to develop a rapid, convenient, accurate and sensitive analytical technology to detect chemical hazards in the food supply in a timely and comprehensive manner. Currently available rapid detection technologies include paper-based smart sensors, microfluidic immunosensors integrated with machine learning, and electrochemical-based wireless sensors, which can achieve rapid detection of food hazards. However, these methods have low fault tolerance, poor stability and insufficient scalability in different sample matrices, and cannot meet the diverse needs of on-site detection, including application scenarios, sample types and multi-target detection. These shortcomings hinder the effective application of rapid detection in food safety law enforcement and are the main weaknesses in food safety assurance. Therefore, in order to overcome these challenges, developing on-site detection technologies that integrate sample pretreatment and sensing is a key way to improve the current weaknesses of rapid detection of chemical hazards.

[0003] Microneedle-based biosensors have shown great potential in on-site food safety analysis. Microneedle arrays made of polymers have numerous nanoscale conical structures, and their three-dimensional curved surfaces reduce the barriers to molecular migration and enhance specific reactions, allowing for rapid enrichment of trace targets within seconds. The large surface area of ​​the microneedles also enables them to load a large number of recognition elements, achieving ultrasensitive biosensing. With their portability, high loading and rapid enrichment capabilities, microneedle-based biosensors can eliminate the cumbersome, time-consuming and inefficient process of sample pretreatment, and further extract and sensitively analyze trace targets. Various microneedle-based electrochemical techniques integrated with wireless transmission have been widely used in real-time monitoring of disease biomarkers in human interstitial fluid. Although microneedle-based biosensors have been proven to be effective in extracting targets (such as endotoxins, allergen DNA, bacteria, etc.) from food samples, they still face challenges in on-site detection of chemical hazards. Most chemical hazards, such as pesticides and veterinary drugs, react complexly with food tissues, resulting in low target extraction efficiency and poor accuracy of microneedle-based sensors. In addition, rapid screening of multiple targets in batch food samples in different application scenarios challenges the cost and portability of existing microneedle sensors. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a core-shell microneedle patch and a portable device for rapid detection of food hazards.

[0005] The technical solution adopted by the present invention is: a HAMA<P hydrogel composite film, HAMA is mixed with a photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium talc (LP), tannic acid (TA) and PSA to form a composite hydrogel HAMA<P; the HAMA<P hydrogel composite film is obtained after light cross-linking.

[0006] A core-shell microneedle patch comprises an inner microneedle patch and an outer HAMA<P hydrogel composite film, wherein the outer HAMA<P hydrogel composite film wraps the inner microneedle patch; the inner microneedle patch comprises a substrate and a fluorescent probe modified on the substrate.

[0007] Preferably, the fluorescent probe comprises a fluorescent cluster BSA-ICG, a target recognition element and a fluorescence quencher Cu 2+ ;

[0008] Preferably, the target recognition element is a nanobody or an aptamer.

[0009] The method for preparing a core-shell microneedle patch comprises preparing an inner microneedle patch substrate, modifying a fluorescent probe onto the substrate, and forming a HAMA<P hydrogel composite film outside the inner microneedle patch to obtain a core-shell microneedle patch.

[0010] Preferably, the specific steps are as follows:

[0011] Step 1: Mix the crosslinking agent and the photoinitiator, place them in a PDMS negative mold, and demould them after light curing to obtain a conical substrate; immerse it in a solution containing a fluorescent probe so that the fluorescent probe is modified onto the substrate to form an inner microneedle patch;

[0012] Step 2: Prepare the composite hydrogel HAMA<P, place it in the PDMS negative mold, press the inner microneedle patch into the composite hydrogel HAMA<P, and demold after light cross-linking and curing to obtain a core-shell microneedle patch.

[0013] Preferably, the substrate is obtained by mixing trimethylolpropane ethoxylate triacrylate (ETPTA) and 2-hydroxy-2-methylpropiophenone (HMPP) in a volume ratio of 100:1 and curing with light.

[0014] A portable device for rapid detection of food hazards, comprising:

[0015] a reading device for reading fluorescence intensity;

[0016] A darkroom shell forms a darkroom structure, and a reading device is arranged at an upper opening of the darkroom shell;

[0017] A microneedle loading platform, on which the core-shell microneedle patch of claim 2 or 3 can be loaded, and is arranged at the lower end opening of the darkroom housing;

[0018] The optical transmission system excites the fluorescence information of the microneedles on the microneedle loading platform and feeds it back to the camera module in the reading device.

[0019] Preferably, the optical transmission system includes a fluorescent excitation light source, a filter and a camera module; the fluorescent excitation light source is arranged in an obliquely upper direction of the microneedle loading platform, and the emitted light can irradiate the microneedle loading platform, the filter is arranged above the microneedle loading platform, and the camera of the camera module is arranged above the filter;

[0020] Preferably, the fluorescent excitation light source is a 780nm LED light emitting diode lamp bead;

[0021] Preferably, the filter is an 810nm narrow-band filter.

[0022] Application of portable equipment for rapid detection of food hazards in detecting food hazards;

[0023] Preferably, the food hazard is a combination of one or more of pesticides, veterinary drugs and allergens;

[0024] Preferably, the pesticide is acetamiprid, malathion, profenofos or thiamethoxam; the veterinary drug is kanamycin, tetracycline, ampicillin or chloramphenicol; and the allergen is β-lactoglobulin or macadamia nut.

[0025] Preferably, the specific steps are as follows:

[0026] Step 1: Collect food samples, treat and elute the food samples with water or organic solvents to obtain samples to be tested;

[0027] Step 2: Immerse the core-shell microneedle into the sample to be tested, and the outer composite film layer removes impurities in the sample to be tested;

[0028] Step 3: peel off the outer composite membrane layer of the core-shell structure, and immerse the inner microneedle into the sample to be tested;

[0029] Step 4: Place the inner microneedle patch on the microneedle loading platform of the portable device for rapid detection of food hazards, and detect the fluorescent information on the microneedle patch.

[0030] The advantages and positive effects of the present invention are: the HAMA<P composite film can quickly and efficiently remove impurities such as grease, pigments and organic acids; when used in the pretreatment process of food testing samples, it can absorb most of the interfering impurities; the inner layer of microneedles has high sensitivity and can efficiently identify food hazards;

[0031] The core-shell microneedle design integrates pretreatment and fluorescence sensing, making the detection medium more portable and the detection process faster. The portable device for rapid on-site detection of food hazards based on microneedle sensing realizes the integrated integration of sample pretreatment, hazard detection, data collection and analysis. It has been successfully applied to the rapid (20min), sensitive (pg / mL) and precise detection of 10 chemical hazards (allergens, pesticides and veterinary drugs). It helps users to accurately and quickly identify potential hazards in different food samples, providing a strong guarantee for food quality and safety. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 The morphology of the inner microneedle patch in one embodiment of the present invention;

[0033] Figure 2 The morphology of the core-shell microneedle patch in one embodiment of the present invention;

[0034] Figure 3 The morphology of the cross section of the core-shell microneedle patch in one embodiment of the present invention;

[0035] Figure 4 Diagram of grease removal efficiency of composite hydrogel membrane;

[0036] Figure 5 Pigment adsorption effect and efficiency diagram of composite hydrogel;

[0037] Figure 6 Citric acid adsorption kinetics of composite hydrogel;

[0038] Figure 7 Schematic diagram of off-on fluorescence sensing based on microneedles in one embodiment of the present invention;

[0039] Figure 8 A schematic diagram of the structure of a portable hazard detection device based on microneedle sensing according to an embodiment of the present invention;

[0040] Fig. 9 A schematic diagram of the internal structure and optical transmission of a portable hazard detection device based on microneedle sensing according to an embodiment of the present invention; wherein: 1. a reading device; 2. a darkroom housing; 3. an optical transmission system; 4. a microneedle loading platform; 5. a fluorescent excitation light source; 6. a filter; 7. a camera system; 8. a microneedle;

[0041] Fig.10Standard curve diagram for pesticide detection in Example 5;

[0042] Fig.11 Standard curve diagram for veterinary drug detection in Example 5;

[0043] Fig.12 Standard curve diagram for allergen detection in Example 5;

[0044] Fig.13 The test results using the portable device in Example 5; A is a graph showing the results of on-site rapid testing of 4 pesticides; B is a graph showing the results of on-site rapid testing of 4 veterinary drugs; C is a graph showing the results of on-site rapid testing of 2 allergens. DETAILED DESCRIPTION

[0045] The embodiments of the present invention are described below with reference to the accompanying drawings.

[0046] The present invention relates to a core-shell microneedle patch and a portable device for rapid detection of food hazards. On one hand, the present invention provides a core-shell microneedle patch, comprising an inner microneedle patch and an outer composite hydrogel shell, wherein the inner microneedle is modified with a fluorescent probe, which can be used to detect the presence and content of hazards in a sample to be tested. In order to avoid the influence of impurities in the sample to be tested, the outer composite hydrogel shell can quickly absorb oils, pigments and organic acid impurities in the sample, remove most types of impurities in food samples, and thus ensure the accuracy of hazard detection.

[0047] In certain embodiments of the present invention, a composite hydrogel HAMA<P is provided, wherein the hydrogel is formed by mixing HAMA with a photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithiasis earth (LP), tannic acid (TA) and PSA in a mass ratio of 8-10:1:2:1:8-10, and a HAMA<P composite film is obtained after a photoinitiated cross-linking reaction. The HAMA<P composite film can absorb oil impurities, such as soybean oil, sunflower oil, fish oil, lard and butter, etc., absorb pigment impurities, such as β-carotene, anthocyanin and chlorophyll, etc., and can also absorb organic acid impurities.

[0048] The inner layer microneedle includes a substrate and a fluorescent probe modified on the substrate. Ethoxy trimethylolpropane triacrylate (ETPTA) and 2-hydroxy-2-methylpropiophenone (HMPP) are mixed in a volume ratio of 100:1, and the prepared mixed solution is placed in a PDMS negative mold, irradiated and cured under ultraviolet light, and then demolded to form an inner layer microneedle substrate in a cone shape. The prepared substrate is immersed in an antibody / aptamer solution containing a fluorescent probe to modify the substrate.

[0049] The fluorescent probe consists of a fluorescent cluster BSA-ICG, a target recognition element (nanoantibody or aptamer) and a fluorescence quencher Cu 2+ Composition. First, the dopamine-modified microneedles were immersed in the fluorescent solution BSA-ICG (5μg / mL, 50μL) with the needle tip facing downward and coated overnight at 4°C. After washing three times with PBST, the microneedles were blocked with 3% BSA solution at room temperature for 30 minutes to prevent residual protein binding sites. Next, the microneedle patch was placed in CuCl2 and the target recognition element Nb / Aptamer-DTPAA solution in turn. The chelating agent DTPAA reacted with Cu through a chelating reaction. 2+ Chelation forms Cu-Nb / Aptamer modification on the surface of the microneedle, which quenches the fluorescence of BSA-ICG and puts the fluorescence on the surface of the inner microneedle in the Off state. Image J software was used to perform grayscale analysis and count the fluorescence value (F0) of the microneedle fluorescence signal when it is in the Off state. The microneedle is then immersed in the target solution, and the target binds to the corresponding Nb / Apt specific recognition element, causing Cu-Nb / Apt to be pulled away from the surface of the BSA-ICG fluorescent cluster, triggering the recovery of the fluorescence signal of the inner microneedle to the On state. The inner microneedle was washed 3 times with PBST, and a portable device was used to record the fluorescence value (F1) of the microneedle at this time. The quantitative detection of the target is achieved based on the difference (F1-F0) of the fluorescence signal recovery (Off-on), thereby constructing an Off-on fluorescence sensing detection method. The entire sensing process is as follows: Figure 7 shown.

[0050] When preparing a core-shell microneedle patch, first prepare a microneedle patch modified with a fluorescent probe; pour the uncrosslinked composite hydrogel HAMA<P into a PDMS negative mold, and then press the modified microneedle patch into a mold filled with a hydrogel material to make the two fully fit together. The mold is placed under 365nm ultraviolet irradiation for 5 minutes. After the hydrogel shell is cross-linked, it is demolded to obtain a core-shell microneedle patch. When in use, the core-shell microneedle patch is immersed in the sample to be tested. During the sample immersion process, the outer composite hydrogel membrane layer will loosen and fall off, realizing the core-shell separation of the core-shell microneedle patch. The fluorescent probe modified on the exposed microneedle patch contacts the harmful substance in the sample, turns on the fluorescence to make it in the On state, and can determine whether the sample contains harmful substances by detecting whether it contains fluorescence. Further, the content of harmful substances can be determined by detecting the fluorescence intensity.

[0051] The outer composite hydrogel HAMA<P is used to pre-treat the samples to be tested. It is responsible for shielding interference from impurities such as oils, pigments and organic acids, and realizing rapid pre-treatment of food samples. The inner microneedle patch is used to detect harmful substances. The microneedle patch is modified with specific fluorescent probes and realizes highly sensitive and specific detection of harmful molecules based on the fluorescence sensing mode. A set of core-shell microneedles can simultaneously realize the steps of pre-treatment and detection, simplifying the cumbersome pre-treatment steps in traditional methods, and can efficiently complete the sample pre-treatment procedures, improving portability and the speed of detection. The food sample pre-treatment steps and target fluorescence sensing are integrated into one.

[0052] In certain embodiments of the present invention, a portable device for rapid detection of food hazards is provided. The portable detection device includes a reading device 1, a darkroom housing 2, an optical transmission system 3 and a microneedle loading platform 4. The reading device 1 is arranged at the upper opening of the darkroom housing 2, and the microneedle loading platform 4 is arranged at the lower opening of the darkroom housing. The reading device 1, the darkroom housing 2 and the microneedle loading platform 4 form a darkroom structure, and the optical transmission system 3 is arranged in the darkroom structure. The optical transmission system 3 includes a fluorescent excitation light source 5, a filter 6 and a camera module 7 of the reading device. When reading the detection result, the fluorescent probe on the microneedle 8 is also included in the optical transmission system. The fluorescent excitation light source is arranged obliquely above the microneedle loading platform. The fluorescent excitation light source 5 irradiates the tip of the microneedle 8, so that the fluorescent probe emits fluorescence. The fluorescent signal enters the camera module 7 after passing through the filter 6 arranged just above it, and the fluorescent signal is collected and analyzed by the reading device 1. Among them, the reading device can be a smart phone, and the camera module is a smart phone camera system. The mobile phone is equipped with an App for coordinating calculation data to analyze the concentration of the hazard online. The main functions of the App software include device parameter setting and control, microneedle fluorescence image acquisition, automatic collection of fluorescence signals, machine learning and data transmission.

[0053] The core-shell microneedle patch was prepared by a three-step molding method. The mixture of trimethylolpropane ethoxy acid triacrylate (ETPTA) and 2-hydroxy-2-methylpropiophenone (HMPP) was placed in the inner microneedle PDMS negative mold, and the inner microneedle patch was made by demolding after vacuum and UV curing. HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium terephthalate (LP), tannic acid (TA) and PSA, and then ultrasonically reacted to make a composite hydrogel HAMA<P. The inner microneedle patch modified with a fluorescent probe was pressed into the outer microneedle PDMS negative mold containing the composite hydrogel solution (HAMA<P). After the hydrogel was cross-linked under UV, it was demolded to prepare a core-shell microneedle patch.

[0054] The specific steps of the on-site rapid detection method for food hazards are as follows:

[0055] Step 1: On-site collection of food samples; the collected vegetables and fruits are ground into pulp using a food processor and then simply extracted with an extracting solution;

[0056] Step 2: Pretreatment and sensing; immerse the core-shell microneedle patch into the sample to be tested, and the interfering impurities in the sample to be tested are adsorbed to the outer composite hydrogel layer. The outer hydrogel needle patch adsorbs impurities in the food sample, undergoes morphological changes such as swelling, and can be directly peeled off to achieve the pretreatment process of the sample to be tested. After the outer shell of the core-shell microneedle falls off, the inner microneedle modified with the corresponding fluorescent probe leaks out, and after contacting the harmful substances in the sample to be tested, it excites fluorescence to achieve the detection and processing process.

[0057] Step 3: Qualitative and quantitative analysis of hazards; place the treated inner microneedles into a portable device for rapid detection of food hazards, and use the App in the reading device to collect and read data. The data read is automatically analyzed by the software and the results are output and transmitted.

[0058] Core-shell microneedles and the above detection methods can be used for high-sensitivity and rapid detection of multiple hazards (allergens, pesticides and veterinary drugs) in complex matrix foods. The portable device for rapid on-site detection of food hazards based on microneedle sensing realizes the integrated integration of sample pretreatment, hazard detection, data collection and analysis; it has been successfully applied to the rapid (20min), sensitive (pg / mL) and precise detection of 10 chemical hazards (allergens, pesticides and veterinary drugs); it helps users to accurately and quickly identify potential hazards in different food samples, providing a strong guarantee for food quality and safety.

[0059] The scheme of the present invention is described below in conjunction with the accompanying drawings, wherein the experimental methods without specific operating steps are all carried out in accordance with the corresponding product instructions, and the instruments, reagents, and consumables used in the examples can all be purchased from commercial companies unless otherwise specified.

[0060] The acetamiprid, malathion, profenofos, thiamethoxam, kanamycin, tetracycline, ampicillin and chloramphenicol standards involved in the embodiments of the present invention are from Tianjin Alta Technology Co., Ltd.; acetamiprid, malathion, profenofos, thiamethoxam, kanamycin, tetracycline, ampicillin and chloramphenicol aptamers are all synthesized from Qingke Biotechnology Co., Ltd.; β-lactoglobulin and macadamia protein nanoantibodies are homemade in the laboratory; ETPTA, HAMA, Irgacure 2959, tannic acid, LAP, lithium algae, chlorophyll, β-carotene, anthocyanin and citric acid are purchased from Aladdin Reagent (Shanghai) Co., Ltd.; BSA, PBS, EDTA2Na, choline chloride, citric acid content kits are purchased from Beijing Solebold Biotechnology Co., Ltd.; fluorescent dye ICG is purchased from Xi'an Ruixi Biotechnology Co., Ltd.; microneedle PDMS negative mold is purchased from Taizhou Microchip Medical Technology Co., Ltd.

[0061] The 780nm LED lamp beads and 810nm narrow-band filters involved in the embodiments of the present invention were purchased from Shenzhen Nahong Optoelectronics Technology Co., Ltd.; the smartphone was realme 11; the gel imager was ChemiDoc MP, from Bio-Rad, USA; the TOC analyzer was Multi N / C 2100, from Analytik Jena, Germany; and the ELISA reader was Spark, from Tecan, Switzerland.

[0062] Example 1: Preparation of composite hydrogel HAMA<P

[0063] HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure2959), lithium terephthalate (LP), tannic acid (TA) and PSA in a mass ratio of 10:1:2:1:10 and then subjected to ultrasonic reaction to prepare a composite hydrogel HAMA<P.

[0064] Example 2: Adsorption of composite hydrogel HAMA<P

[0065] 1 mL of the HAMA<P solution prepared in Example 1 was evenly coated on the surface of glass fiber paper (5×5 cm) using a coating rod, and then exposed to ultraviolet light for crosslinking for 5 minutes. The crosslinked HAMA<P composite membrane was freeze-dried to obtain a HAMA<P composite membrane.

[0066] 2.1 Grease removal

[0067] After 20 mL of deionized water, 10 mL of oil (soybean oil, sunflower oil, fish oil, lard and butter) and 0.2 wt% Tween80 were mixed evenly, stirred at 5000 rpm / min for 2 h, and a series of stable emulsified oils were formed under the action of surfactants. 2 The HAMA<P composite membrane was used to separate water-oil emulsions on a laboratory filtration device. The filtrate was collected and the oil content in the filtrate was determined using a TOC analyzer. Figure 4 As shown in the figure, it can be seen that the HAMA<P composite membrane has a highly efficient adsorption and removal effect on various types of oils and fats.

[0068] 2.2 Pigment Removal

[0069] Dissolve β-carotene and chlorophyll in n-hexane, and dissolve anthocyanin in deionized water to prepare three pigment solutions. Add 50 mg of the freeze-dried HAMA<P composite membrane prepared in Example 1 to 1 mL of the pigment solution (pigment concentration is 1 mg / mL), stir for 10 min, and then centrifuge at 7000 rpm for 5 min at room temperature. Take 200 μL of the supernatant, and use an ELISA reader to measure the absorbance at 457 nm (β-carotene), 646 nm, and 663 nm (chlorophyll). β-carotene can be directly detected, and the β-carotene separation efficiency can be calculated;

[0070] The chlorophyll concentration can be calculated according to Arnon’s formula, and the chlorophyll separation efficiency can be further calculated;

[0071] Chlorophyll concentration (μg / mL) = (20.2A646 + 8.02A663);

[0072] For the determination of anthocyanin separation efficiency, the separation efficiency was calculated based on the anthocyanin concentration; 1.4 mL of potassium chloride buffer (0.025 M, pH = 1.0) and sodium acetate buffer (0.4 M, pH = 4.5) were added to 100 μL of the anthocyanin supernatant after centrifugation. The reaction was allowed to stand for 15 minutes, and the absorbance of the two solutions at 525 and 700 nm was measured respectively. The anthocyanin content was calculated according to the following formula:

[0073] Anthocyanin content / (g / 100g) = (ΔA×M×f×V×1000)×100 / (m×ξ×L)

[0074] Among them: ΔA=(A 520 -A 700 )pH 1.0 -(A 520 -A 700 )pH4.5

[0075] M: 449.2mg / moL, relative molecular mass of cyanidin-3-glucose;

[0076] f: dilution factor;

[0077] V: volume of buffer solution after constant volume;

[0078] m: the mass of anthocyanins in the original anthocyanin solution

[0079] ξ: 26900, molar extinction coefficient of cyanidin-3-glucose;

[0080] L: optical path, cm.

[0081] The removal effect and efficiency of three pigments, β-carotene, chlorophyll and anthocyanin, are as follows Figure 5 As shown, it can be seen that the composite hydrogel (HAMA<P) has better adsorption and removal ability for the three pigments.

[0082] 2.3 Removal of organic acids

[0083] Citric acid (CA) was used to evaluate the adsorption efficiency of the composite hydrogel HAMA<P for organic acids, and a citric acid content determination kit was used to determine the content of CA.

[0084] 20 mg of freeze-dried HAMA<P composite membrane was added to CA solution (2 μmol / mL) and stirred for 1, 3, 5, 10, 20, 30, 60, 90 and 120 min, respectively, and then centrifuged at 7000 rpm for 10 min at room temperature. 20 μL of the supernatant after different reaction times was collected and the subsequent reaction was carried out according to the instructions of the citric acid content determination kit. Finally, the optical density (OD) at 545 nm was measured. 545 nm) to quantify the concentration of citric acid. The adsorption efficiency of HAMA<P on organic acids at different adsorption times is shown in Figure 6 shown.

[0085] Example 3: Preparation of core-shell microneedle patch

[0086] Ethoxytrimethylpropane triacrylate (ETPTA) and 2-hydroxy-2-methylpropiophenone (HMPP) were mixed in a volume ratio of 100:1, and 500 μL of the mixture was placed in a PDMS negative mold. The bubbles and excess solution were removed by vacuum treatment. The mold was then irradiated under UV light for 1 min, and after curing, it was demolded to form an inner layer microneedle patch with a morphology as shown in FIG. Figure 1 The prepared inner layer microneedle patch was immersed in a fluorescent sensing probe solution containing 5 μg / mL BSA-ICG-antibody / aptamer for modification for 20 minutes, and then rinsed three times for use.

[0087] The fluorescent probe consists of a fluorescent cluster BSA-ICG, a target recognition element (nanoantibody or aptamer) and a fluorescence quencher Cu 2+ Composition. First, the dopamine-modified microneedles were immersed in the fluorescent solution BSA-ICG (5μg / mL, 50μL) with the needle tip facing downward and coated overnight at 4°C. After washing three times with PBST, the microneedles were blocked with 3% BSA solution at room temperature for 30 minutes to prevent residual protein binding sites. Next, the microneedle patch was placed in CuCl2 and the target recognition element Nb / Aptamer-DTPAA solution in turn. The chelating agent DTPAA reacted with Cu through a chelating reaction. 2+ Chelation forms Cu-Nb / Aptamer modification on the microneedle surface, which quenches the fluorescence of BSA-ICG and puts the fluorescence on the inner microneedle surface in the Off state.

[0088] HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithium terephthalate (LP), tannic acid (TA) and PSA in a mass ratio of 10:1:2:1:10 and then subjected to ultrasonic reaction to prepare a composite hydrogel HAMA<P.

[0089] Take 500 μL of the composite hydrogel solution and cast it into the PDMS negative mold, and vacuum it to fill the pinhole cavity with the material. Then, press the inner shell microneedle containing the fluorescent probe into the mold filled with the hydrogel material, and remove the excess solution after the two are fully fitted. The mold is irradiated under 365nm ultraviolet light for 5 minutes. After the hydrogel shell is cross-linked, demold it to obtain a core-shell microneedle patch. The morphology of the core-shell microneedle patch is shown in the figure. Figure 2-3 As shown. Figure 3 It can be seen that after cross-linking, the outer layer composite hydrogel HAMA<P can cover the inner layer microneedle patch.

[0090] Example 4 Portable detection device for hazardous substances based on microneedle sensing

[0091] like Figure 8 Fig. 9 As shown in FIG. 1 , the portable detection device consists of a reading device 1 (smartphone), a 3D printed darkroom housing 2, an optical transmission system 3, and a microneedle loading platform 4. The internal structure of the device is shown in FIG. Fig. 9As shown, the optical transmission system 3 includes a fluorescent excitation light source 5 (780nm LED light-emitting diode lamp beads), an 810nm narrow-band filter 6, and a microneedle 8 arranged on the microneedle loading platform. The fluorescent excitation light source 5 provides light of a specific excitation wavelength for each detection point; the specially made microneedle loading platform 4 is a black acrylic sample pool with three grooves that matches the size of the microneedle patch, which can hold a total of 6 microneedles. The black darkroom shell provides a sealed space for the entire device, and the camera of the smartphone is used to collect and receive microneedle fluorescence images. The type and content of the hazardous substance can be determined based on the type of microneedle and the fluorescence intensity.

[0092] In certain embodiments of the present invention, a detection App may be developed separately to control the operation of the device and to analyze and transmit the detection data.

[0093] Limited by the focal length of the smartphone camera, the ratio of the distance between the fluorescence excitation light source and the distance of the special microneedle patch sample pool is 1:3. The distance between the three LED light-emitting diode beads is 1cm, and the excitation wavelength is 780nm. The 810nm narrowband filter has a passband of 5nm and a filter cutoff rate of 0.1% outside the passband. The distance between the special microneedle patch card shell and the smartphone is 7cm. To avoid focal changes caused by automatic focus, the camera's automatic focus setting function is turned off when shooting, and the manual focus mode is used, with an ISO of 4000-6000 and an exposure time of 15s. The smartphone obtains clear fluorescence imaging photos of the microneedle patch through a portable fluorescence imaging device. By uploading the initial and final fluorescence images to a dedicated image calculation app, the image is analyzed to obtain the corresponding fluorescence recovery value, and the detection results are automatically generated.

[0094] The signal processing software includes four modules: pesticide, veterinary drug, allergen and multi-target detection, which can meet the needs of different detection projects in on-site supervision.

[0095] Example 5: Application of portable equipment for on-site rapid detection of pesticide and veterinary drug residues and allergen hazards in food 5.1 Determination of detection sensitivity of pesticide and veterinary drug residues and allergen hazards

[0096] Microneedles modified with harmful substance-specific recognition elements were prepared according to the method of Example 3. The aptamers corresponding to different harmful substances are shown below.

[0097] Acetamiprid aptamer sequence:

[0098] SEQ ID No.1: C6NH2-TGTAATTTGTCTGCAGCGGTTCTTGATCGCTGA CACCATATTATGAAGA

[0099] Thiamethoxam aptamer sequence:

[0100] SEQ ID No.2: C6NH2-GACGGATCCACCGACATGCAAAGATGCACAA AAACG

[0101] Malathion aptamer sequence:

[0102] SEQ ID No.3: C6NH2-ATCCGTCACAACCTGCTTCTTATACACAATTGTTTTTCTCTTAACTTCTTGA

[0103] Profenofos aptamer sequence:

[0104] SEQ ID No.4: C6NH2-TTAGCGAGCTGCACACACAATGGACTCGTCAT ACCGTGCTGTTT

[0105] Tetracycline aptamer sequence:

[0106] SEQ ID No.5: C6NH2-CGTACGGAATTCGCTAGCCCCCCGGCAGGCCA CGGCTTGGGTTGGTCCCACTGCGCGTGGATCCGAGCTCCACGTG

[0107] Kanamycin aptamer sequence:

[0108] SEQ ID No.6: C6NH2-AGATGGGGGTTGAGGCTAAGCCGA

[0109] Chloramphenicol aptamer sequence:

[0110] SEQ ID No.7: C6NH2-ACTTCAGTGAGTTGTCCCACGGTCGGCGAGTC GGTGGTAG

[0111] Ampicillin aptamer sequence:

[0112] SEQ ID No.8: C6NH2-CACGGCATGGTGGGCGTCGTG

[0113] The corresponding aptamers were added into the fluorescent probe solution to modify the microneedle patch. In addition, β-lactoglobulin (preparation method as disclosed in Hu Y, Wang Y, Nie L, et al. Exploration of Specific Nanobodies As Immunological Reagents to Detect Milk Allergen of β-Lactoglobulin without Interference of Hydrolytic Peptides [J]. Journal of Agricultural and Food Chemistry, 2022, 70 (48): 15271-15282) and macadamia protein nanobodies (preparation method as disclosed in HuY, Wu S, Wang Y, et al. Unbiased immunization strategy yielding specific nanobodies against macadamia allergen of vicilin-like protein for immunoassay development [J]. Journal of Agricultural and Food Chemistry, 2021, 69 (17): 5178-5188) were prepared and added to the fluorescent probe solution to modify the microneedle patch for detecting lactoglobulin and macadamia nuts. Assembled into a portable detection device according to the method of Example 4.

[0114] Prepare pesticide and veterinary drug test samples of different concentrations, as well as allergen test samples, and prepare a series of standard dilution solutions; specifically including:

[0115] Pesticides: acetamiprid (0, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000, 20000, 50000 ng / mL), thiamethoxam (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000 ng / mL), malathion (0, 0.00 0.005, 0.0001, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL), profenofos (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL);

[0116] Veterinary drugs: tetracycline (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000 ng / mL), kanamycin (0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000 ng / mL), chloramphenicol (0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000 ng / mL), mesylate (0, 0.0005, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL) and ampicillin (0, 0.001, 0.005, 0.01, 0.05, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 5000 ng / mL);

[0117] Allergens: β-lactoglobulin (0, 0.001, 0.005, 0.1, 0.5, 1, 5, 10, 50, 100, 500, 1000, 2000, 10000, 20000, 100000 ng / mL), macadamia nuts (0, 0.01, 0.05, 0.1, 0.5, 1, 2.5, 5, 7.5, 10, 50, 100, 500, 1000, 2000, 5000, 10000, 20000, 50000 ng / mL).

[0118] After each type of modified microneedle patch was immersed in the corresponding standard dilution solution for 10 minutes, the outer hydrogel of the core-shell microneedle was peeled off and placed in a portable detection device. The portable device records the fluorescence recovery signal, uses the concentration of the hazard as the X-axis and the fluorescence recovery signal value (F1-F0) as the Y-axis, draws a standard curve of allergen concentration and fluorescence recovery signal, and builds it into the App allergen detection module. Figure 10-12 They are the quantitative standard curves for pesticides, veterinary drugs and allergens respectively.

[0119] 5.2 Detection of pesticide residues in actual samples

[0120] 100 ng / mL of acetamiprid (ACE), malathion (mala), profenofos (PFF) and thiamethoxam (TMX) were mixed and added to 5 g spinach and 5 g apple samples respectively, then crushed and homogenized in 10 mL pesticide extract (1 mL methanol and 9 mL PBS buffer) and extracted for 5 min. After standing, the core-shell microneedles of the recognition probes modified by the four pesticide aptamers were reacted with the collected supernatant for 10 min. The outer shell of the microneedle was separated from the inner layer, and the inner microneedle was washed 3 times with PBST, and the test results were directly output using a portable device. The pesticide residue test results are as follows. Fig.13 As shown in A, it is proved that the portable detection equipment can effectively detect the residues of various pesticide hazards.

[0121] 5.3 Detection of veterinary drug hazardous residues in actual samples

[0122] 200 ng of kanamycin, tetracycline, ampicillin and chloramphenicol were added to 5.0 g of fresh pork and milk samples, respectively. The samples were then immersed in 20.0 mL of Mellvaine-Na2EDTA buffer (0.1 M) for extraction for 5 min. After standing, the core-shell microneedles modified with four veterinary drug aptamer recognition probes were reacted with the collected supernatant for 10 min. The outer shell of the microneedle was separated from the inner layer, and the inner microneedle was washed 3 times with PBST, and the test results were directly output using a portable device. The veterinary drug residue test results are shown in the figure. Fig.13 As shown in B, it is proved that the portable detection equipment can effectively detect the residues of various veterinary drug hazards.

[0123] 5.4 Detection of residual hazardous substances in actual samples of allergens

[0124] 5000ng of β-lactoglobulin (β-LG) and macadamia nut (Mac) allergen protein were added to 500mg of hypoallergenic milk powder and biscuits and mixed, followed by the addition of 1.6g of DES and 2mL of K2HPO4 solution (0.60g / mL) and stirring for 5min to ensure that the allergens in the sample were enriched in the top phase of DES. The upper phase DES solution was collected at rest and diluted 5 times with PBS (10mM, pH=7.4). The microneedle patch modified with β-lactoglobulin and macadamia nut allergen recognition probe (Nb-DTPAA) was reacted simultaneously with the diluted DES solution for 10min and detected using a portable device. The allergen test results are as follows Fig.13 As shown in Figure C, it is proved that the portable detection equipment can effectively detect the residues of various types of allergen hazards.

[0125] The embodiments of the present invention are described in detail above, but the contents described are only preferred embodiments of the present invention and cannot be considered to limit the scope of implementation of the present invention. All equivalent changes and improvements made within the scope of the present invention should still fall within the scope of the patent coverage of the present invention.

Claims

1. A HAMA<P hydrogel composite film, characterized in that: HAMA was mixed with photoinitiator 2-hydroxy-1-[4-(2-hydroxyethoxy)phenyl]-2-methyl-1-propanone (Irgacure 2959), lithophane (LP), tannic acid (TA) and PSA to form a composite hydrogel HAMA<P; after light cross-linking, a HAMA<P hydrogel composite film was obtained.

2. A core-shell microneedle patch, characterized in that: It includes an inner microneedle patch and an outer HAMA<P hydrogel composite film, wherein the outer HAMA<P hydrogel composite film wraps the inner microneedle patch; the inner microneedle patch includes a substrate and a fluorescent probe modified on the substrate.

3. The core-shell microneedle patch according to claim 2, characterized in that: The fluorescent probe includes a fluorescent cluster BSA-ICG, a target recognition element and a fluorescence quencher Cu 2+ ; Preferably, the target recognition element is a nanobody or an aptamer.

4. The method for preparing the core-shell microneedle patch according to claim 2, characterized in that: An inner microneedle patch substrate is prepared, a fluorescent probe is modified onto the substrate, and a HAMA<P hydrogel composite film is formed outside the inner microneedle patch to obtain a core-shell microneedle patch.

5. The method for preparing the core-shell microneedle patch according to claim 4, characterized in that: The specific steps are as follows: Step 1: Mix the crosslinking agent and the photoinitiator, place them in a PDMS negative mold, and demould them after light curing to obtain a conical substrate; immerse it in a solution containing a fluorescent probe so that the fluorescent probe is modified onto the substrate to form an inner microneedle patch; Step 2: Prepare the composite hydrogel HAMA<P, place it in the PDMS negative mold, press the inner microneedle patch into the composite hydrogel HAMA<P, and demold after light cross-linking and curing to obtain a core-shell microneedle patch.

6. The method for preparing the core-shell microneedle patch according to claim 5, characterized in that: The substrate is obtained by mixing trimethylolpropane ethoxylated acid triacrylate (ETPTA) and 2-hydroxy-2-methylpropiophenone (HMPP) in a volume ratio of 100:1 and curing with light.

7. A portable device for rapid detection of food hazards, characterized in that: include, a reading device for reading fluorescence intensity; A darkroom shell forms a darkroom structure, and the reading device is arranged at the upper opening of the darkroom shell; A microneedle loading platform, on which the core-shell microneedle patch according to claim 2 or 3 can be loaded, and is arranged at the lower end opening of the darkroom housing; The optical transmission system excites the fluorescence information of the microneedles on the microneedle loading platform and feeds it back to the camera module in the reading device.

8. The portable device for rapid detection of food hazards according to claim 7, characterized in that: The optical transmission system includes a fluorescent excitation light source, a filter and a camera module; the fluorescent excitation light source is arranged at an oblique upper direction of the microneedle loading platform, and the emitted light can irradiate the microneedle loading platform, the filter is arranged above the microneedle loading platform, and the camera of the camera module is arranged above the filter; preferably, the fluorescent excitation light source is a 780nm LED light emitting diode lamp bead; Preferably, the filter is an 810nm narrow-band filter.

9. Use of the portable device for rapid detection of food hazards according to claim 7 or 8 in detecting food hazards; Preferably, the food hazard is a combination of one or more of pesticides, veterinary drugs and allergens; Preferably, the pesticide is acetamiprid, malathion, profenofos or thiamethoxam; the veterinary drug is kanamycin, tetracycline, ampicillin or chloramphenicol; and the allergen is β-lactoglobulin or macadamia nut.

10. The use according to claim 9, characterized in that: The specific steps are as follows: Step 1: Collect food samples, treat and elute the food samples with water or organic solvents to obtain samples to be tested; Step 2: Immerse the core-shell microneedle into the sample to be tested, and the outer composite film layer removes impurities in the sample to be tested; Step 3: peel off the outer composite membrane layer of the core-shell structure, and immerse the inner microneedle into the sample to be tested; Step 4: Place the inner microneedle patch on the microneedle loading platform of the portable device for rapid detection of food hazards, and detect the fluorescent information on the microneedle patch.

Images