Conserved B cell epitope peptide TG12 of RaGAPDH, nucleic acid molecule, recombinant vector and application of conserved B cell epitope peptide TG12

Abstract

The invention discloses a conserved B cell epitope peptide of a riemerella anatipestifer (RA) surface adhesion factor 3-phosphoglyceraldehyde dehydrogenase (GAPDH), a nucleic acid molecule, a recombinant vector and an application of the conserved B cell epitope peptide. Conservative B cell epitope TG12 is inserted into Salmonella pullorum Peg pili, inert carrier bacteria are introduced, and recombinant bacteria capable of functionally expressing and displaying RaGAPDH protein surface conservative B cell epitope peptide are obtained. The conserved B cell epitope expressed and exhibited can specifically recognize and bind duck-derived and goose-derived RA-infected serum, and macroscopic agglutination reaction particles are observed and have no cross agglutination reaction with other pathogen-infected positive serum. The agglutination detection method has the advantages of specificity, convenience and the like, and is expected to provide a new thought and method for detection, prevention and control of RA infection.

Description

Technical Field

[0001] The invention belongs to the technical field of biotechnology and immune diagnosis and detection, and specifically relates to a conservative B cell epitope peptide TG12 of the surface adhesion factor 3-glyceraldehyde phosphate dehydrogenase (RaGAPDH) of Riemerella anatipestifer, a nucleic acid molecule, a recombinant vector and applications thereof. Background Art

[0002] Riemerella anatipestifer infection (RAI) is an acute or chronic, contact, septicemic infectious disease of ducks, geese, turkeys and other poultry caused by Riemerella anatipestifer (RA). It is often associated with Escherichia coli in clinical practice and can cause duck infectious serositis characterized by fibrinous pericarditis, perihepatitis, air sacculitis, caseous salpingitis and meningitis. The pathogen can cause a mortality rate of up to 90% in waterfowl. Due to its high pathogenicity and persistent presence in the environment, it has become one of the main pathogens causing serious economic losses to the duck farming industry.

[0003] RA is a Gram-negative bacterium belonging to the family Flavobacteriaceae and the genus Riemerella. Under a microscope, it has a capsule, no spores, no flagella, and cannot move. Gram staining shows strong staining at both poles. The bacteria mostly exist alone, and occasionally in chain arrangement. The bacteria have high requirements for growth conditions and need sufficient nutrition. They grow well on suitable culture media such as chocolate plates, tryptic soy agar (TSA), and blood agar plates. They grow slowly or even not at all on ordinary agar plates and other commonly used culture media plates. 5% CO 2 Contributes to the growth of RA.

[0004] The preliminary diagnosis of RA infection is generally based on the clinical symptoms and autopsy changes of the sick animals, such as whether obvious clinical symptoms such as fibrinous perihepatitis, fibrinous pericarditis, and fibrinous air sac inflammation are found. However, clinical practice has found that not only Riemerella anatipestifer can cause the above-mentioned lesions, but also Escherichia coli and Salmonella infections can cause the above-mentioned lesions. Therefore, it is not accurate to diagnose the disease based solely on clinical symptoms and autopsy changes, and laboratory diagnosis is required for confirmation. At present, the detection methods for Riemerella anatipestifer mainly focus on pathogen observation, biochemical identification, agglutination test, agarose gel diffusion test, enzyme-linked immunosorbent assay, fluorescent antibody detection technology, molecular biology detection technology, etc. However, there are many problems with existing detection technologies, such as the common whole-bacteria agglutination test is prone to cross-reaction; the agarose gel diffusion test has low sensitivity, and when the antibody titer is too low and the same type of antigen and antibody reaction is weak, it is easy to produce false negative results; the classic methods such as isolation culture and biochemical characteristics observation have defects such as cumbersome operation and long time consumption, and the initial isolation rate from infected animals is not high. Therefore, there is an urgent need for a method for detecting and diagnosing Riemerella anatipestifer that is highly specific, sensitive, convenient and quick.

[0005] The serotypes of Riemerella anatipestifer are very complex, with regionally different isolates. Currently, 25 serotypes have been reported, and there is a lack of effective cross-protection between the serotypes. Therefore, there may be mixed infections of several serotypes of RA strains in the same farm, which poses a huge challenge to the diagnosis and prevention of Riemerella anatipestifer disease. At present, the dominant serotypes of Riemerella anatipestifer in my country are serotypes 1, 2, and 10. Studies have shown that all Riemerella anatipestifer can secrete and attach a GAPDH homolog protein on its cell surface, which is encoded by the gap gene and has a relative molecular weight of 36.7KDa. The researchers named it RaGAPDH. Studies have shown that the adhesion and invasion ability of duck embryo fibroblasts is significantly reduced after the loss of RaGAPDH, indicating that RaGAPDH is related to RA adhesion, colonization and infection pathogenicity; at the same time, the recombinant expression protein of RaGAPDH (with enzyme activity) can interact with plasminogen and histidine-rich glycoprotein in duck plasma proteins to promote bacterial invasion, which is a key step for bacteria to adhere to and colonize in the host or establish and initiate infection.

[0006] In summary, RaGAPDH can play a role in the adhesion, colonization and infection and pathogenicity of RA through two pathways: (1) existing on the surface of bacterial cells, binding to host cells, improving adhesion to host cells and promoting bacterial colonization; (2) secreting outside the cells, interacting with host plasma protein components, and affecting the blood coagulation system / fibrinolysis system. Therefore, RaGAPDH is the adhesion, colonization and infection pathogenicity factor of Riemerella anatipestifer, and is highly conserved in different serotypes of strains, and plays an important role in the infection and pathogenicity. Based on the limitations of existing detection methods and prevention and control measures, there is an urgent need for a rapid, convenient, specific, sensitive detection reagent and detection method suitable for infection of different serotypes of strains. Summary of the invention

[0007] Purpose of the invention: The technical problem to be solved by the present invention is to provide a conserved B cell epitope TG12 of RA adhesion and colonization pathogenic factor 3-glyceraldehyde phosphate dehydrogenase RaGAPDH that can directly recognize and bind to RA infection antibody-mediated plate agglutination test and its application in serological detection of RA infection.

[0008] The technical problem that the present invention needs to solve is to provide a nucleic acid molecule encoding the conserved B cell epitope TG12 of the RaGAPDH protein.

[0009] The technical problem that the present invention needs to solve is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain.

[0010] The technical problem that the present invention needs to solve is to provide a method for constructing a recombinant vector or a recombinant strain.

[0011] The technical problem that the present invention also aims to solve is to provide the use of the conserved B cell epitope TG12, the nucleic acid molecule, the recombinant gene peg-RA-TG12, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain in the preparation of a reagent or a kit for detecting RA infected serum.

[0012] The final technical problem to be solved by the present invention is to provide a detection system or detection kit for RA infection antibodies.

[0013] Technical solution: In order to solve the above technical problems, the first aspect of the present invention provides a conserved B cell epitope peptide TG12 of RA adhesion colonization and infection pathogenic factor 3-glyceraldehyde phosphate dehydrogenase, and the amino acid sequence of the conserved B cell epitope peptide TG12 is TVDGPSMKDWRG.

[0014] Wherein, the TG12 is the 187th to 198th amino acid residues from the N-terminus of the RaGAPDH protein.

[0015] The second aspect of the present invention provides a nucleic acid molecule encoding the conserved B cell epitope peptide TG12, wherein the nucleotide sequence of the nucleic acid molecule is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.

[0016] The third aspect of the present invention provides a recombinant gene peg-RA-TG12 in which a TG12 epitope sequence is inserted into a peg gene, and the nucleotide sequence thereof is shown in SEQ ID NO.1.

[0017] The fourth aspect of the present invention provides a recombinant Peg protein expressing a conserved B cell epitope TG12 in Peg pili, and the amino acid sequence of the recombinant Peg protein is shown in SEQ ID NO.3.

[0018] The fifth aspect of the present invention provides an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which comprises the nucleic acid molecule or the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12.

[0019] The sixth aspect of the present invention provides a method for constructing the recombinant vector, comprising the following steps:

[0020] (1) The gene sequence of the conserved B cell epitope peptide TG12 of RA adhesion colonization and infection pathogenic factor 3-glyceraldehyde phosphate dehydrogenase was obtained; its gene sequence is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.

[0021] (2) Inserting the gene sequence obtained in step (1) into a vector containing the Peg pili encoding gene sequence to construct a recombinant vector.

[0022] Specifically, the present invention also provides an expression vector pBR-peg-RA-TG12, in which the DNA sequence of a conserved B cell epitope peptide TG12 of the above-mentioned RA adhesion, colonization and infection pathogenic factor 3-glyceraldehyde phosphate dehydrogenase (RaGAPDH) is inserted into the coding gene sequence of Peg pili, and the Peg pili coding gene sequence carrying the conserved B cell epitope peptide TG12 is cloned into the pBR322 vector for expression to obtain the pBR-peg-RA-TG12 expression vector.

[0023] The seventh aspect of the present invention provides a method for constructing the recombinant strain, comprising introducing the recombinant vector into a carrier bacterium.

[0024] Wherein, the introduction method is electrotransformation, and the carrier bacteria are inert carrier bacteria.

[0025] Specifically, the present invention also provides an S9H-pBR-peg-RA-TG12 recombinant bacterium whose surface displays a conserved B cell epitope peptide TG12 of RA adhesion colonization and infection pathogenic factor 3-glyceraldehyde phosphate dehydrogenase (RaGAPDH). The above-mentioned expression vector pBR-peg-RA-TG12 is introduced into the inert carrier Salmonella S9H by electroporation, and the expression of Peg pili and the expression of the conserved B cell epitope peptide TG12 of the RA adhesion colonization and infection pathogenic factor 3-glyceraldehyde phosphate dehydrogenase (RaGAPDH) on the surface of the S9H-pBR-peg-RA-TG12 recombinant bacteria are verified by agglutination test.

[0026] The eighth aspect of the present invention provides the use of the conserved B cell epitope peptide TG12, the nucleic acid molecule, the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12, the recombinant protein, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain in the preparation of a reagent or kit for detecting infectious antibodies against Riemerella anatipestifer.

[0027] The ninth aspect of the present invention provides a detection system or detection kit for RA infection antibodies, which includes the conserved B cell epitope peptide TG12, the nucleic acid molecule, the recombinant gene peg-RA-TG12 or the recombinant gene pegA-TG12, the recombinant protein, the expression cassette, the recombinant expression vector, the recombinant cell or the recombinant strain.

[0028] The tenth aspect of the present invention provides an in vitro agglutination test detection method for specific recognition and binding of RA infection antibodies directly mediated by the conserved B cell epitope peptide TG12. The detection antigen in the plate agglutination test detection method is the S9H-pBR-peg-RA-TG12 recombinant bacteria expressing the conserved B cell epitope peptide TG12, and the detection control is S9H-pBR-peg. Compared with the detection antigen, the detection control only lacks the conserved B cell epitope peptide TG12 of the RaGAPDH protein, thereby ensuring the specificity of the detection.

[0029] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0030] (1) The conserved B cell epitope peptide TG12 provided by the present invention is a functional domain of the conserved epitope of RA adhesion colonization and infection pathogenic factor 3-phosphoglyceraldehyde dehydrogenase.

[0031] (2) The present invention also verifies through agglutination tests that the surface of the vector bacteria expresses Peg pili, and that the surface of the vector bacteria functionally displays the functional domain of the specific antigenic epitope of 3-glyceraldehyde phosphate dehydrogenase, a pathogenic factor of Riemerella anatipestifer adhesion, colonization and infection, through Peg pili, and can specifically recognize and bind to RA infectious antibodies against 3-glyceraldehyde phosphate dehydrogenase epitope antigens.

[0032] (3) The detection antigen S9H-pBR-peg-RA-TG12 of the present invention only adds the conservative B cell epitope peptide TG12 compared with the detection control S9H-pBR-peg, ensuring the specificity of the agglutination test detection method directly mediated by the conservative B cell epitope antigen TG12;

[0033] (4) The present invention utilizes the Peg pili display expression system to amplify and display the conserved B cell epitope peptide TG12 of RA adhesion and colonization pathogenic factor 3-phosphoglyceraldehyde on the surface of the inert carrier bacteria S9H, thereby ensuring the sensitivity of the detection;

[0034] (5) The present invention uses the conservative B cell epitope peptide TG12 to establish an in vitro agglutination test method for specific recognition and binding of RA infection antibodies directly mediated by the conservative B cell epitope peptide TG12. This method does not require bacterial isolation and culture, thus reducing the time required for identification.

[0035] In summary, the present invention provides a convenient, specific detection reagent, kit and detection method for agglutination test suitable for different serotypes of RA infection. The B cell epitope peptide TG12 selected by the present invention is highly conserved in different serotypes of RA strains, and is expected to become an important technology and platform for the diagnosis, monitoring and prevention of RA infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 , RA 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) protein conservation analysis. The red rectangular frame shows the conserved B cell epitope peptide sequence of the RaGAPDH protein provided by the present invention.

[0037] Figure 2 , RA 3-phosphoglyceraldehyde dehydrogenase (RaGAPDH) and its B cell epitope peptide conservation analysis results. The amino acid sequence of RaGAPDH in different Riemerella anatipestifer is highly conservative and consistent, and there are significant differences with the GAPDH protein sequence in RA infected host animals such as ducks and geese. The yellow rectangular box in the figure shows the amino acid sequence of the conserved B cell epitope peptide of RaGAPDH provided by the present invention, and the sequence and difference of the GAPDH protein in the infected duck and goose hosts.

[0038] Figure 3, Schematic diagram of the recombinant vector pBR-peg-RA-TG12 plasmid expressing TG12.

[0039] Figure 4 Electrophoretograms of PCR amplification and identification of the peg operon gene carried by peg-RA-TG12, peg-RA-TG12 and Salmonella pullorum standard strain CVCC 526, wherein lane M is Trans 2K plus II DNA Marker, lane 1 is the genomic amplification product of DH5α engineered bacteria as a negative control, lane 2 is the PCR amplification product of the Peg fimbriae operon containing the TG12 epitope peptide of pUC57-peg-RA-TG12, and lane 3 is the PCR amplification product of the Peg fimbriae operon of the Salmonella pullorum standard strain CVCC 526.

[0040] Figure 5 , nucleic acid electrophoresis diagram of expression vector pBR-peg-RA-TG12 and pBR-peg digestion identification. Lane M is Trans 2K plus II DNA Marker, lane 1 is pBR322 circular plasmid, lane 2 is recombinant circular plasmid pBR-peg-RA-TG12, lane 3 is the product of double digestion of pBR-peg-RA-TG12 by Nhe I and Eag I, lane 4 is the recombinant circular plasmid pBR-peg, and lane 5 is the product of double digestion of pBR-peg by Nhe I and Eag I.

[0041] Figure 6 , the specificity verification test result diagram of the in vitro agglutination test method for specific recognition and binding of Riemerella anatipestifer infection antibodies directly mediated by the conserved B cell epitope peptide TG12, where the detection antigen is the recombinant bacteria S9H-pBR-peg-RA-TG12 expressing TG12 (right) and the detection control is S9H-pBR-peg (left). If the agglutination reaction is negative, there are no agglutinated particles in the reaction solution and the background is turbid; if the agglutination reaction is positive, agglutinated particles visible to the naked eye are generated in the reaction solution, and white agglutinated particles are deposited on both sides of the reaction solution. "-" represents a negative agglutination reaction, and "+" represents a positive agglutination reaction. The agglutinated particles in the positive reaction are marked with red arrows in the figure. DETAILED DESCRIPTION

[0042] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific specific embodiments rather than to limit the scope of protection of the present invention. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those commonly understood by those skilled in the art. The embodiments of the present invention will be further described below in conjunction with the examples, which are intended to illustrate the present invention and should not be construed as limiting the scope of the present invention. In addition to the specific methods, equipment, and materials used in the examples, according to the technical personnel in the field of the present invention's mastery of the prior art and the records of the present invention, any methods, equipment, and materials of the prior art that are similar or equivalent to the methods, equipment, and materials in the examples of the present invention can also be used to implement the present invention.

[0043] Example 1. Comparison and analysis of the protein sequences of RA adhesion colonization and infection pathogen RaGAPDH and acquisition of the sequence of the conserved B cell epitope peptide TG12

[0044] The RA genome sequence was retrieved through the National Center for Biotechnology Information (NCBI) (https: / / www.ncbi.nlm.nih.gov / ), and only strains with complete genome information were collected. The RaGAPDH proteins of 40 strains were selected for sequence alignment and analysis. The results showed that the conservation of the amino acid sequence of Riemerella anatipestifer RaGAPDH was in the range of 97.9% to 100%, indicating that the protein was highly conserved in RA bacteria and could be used as a candidate antigen protein for diagnosing all serotypes of RA infection. The conserved sequence of RaGAPDH protein was selected for further analysis, and the conserved B cell epitopes of RaGAPDH protein were determined according to the prediction results of the B cell epitope online prediction website (https: / / www.iedb.org / ), and the conserved RaGAPDH epitope peptide amino acid sequence was optimized and selected, and named TG12: TVDGPSMKDWRG.

[0045] The nucleotide sequence of the conserved B cell epitope peptide TG12 of RA adhesion, colonization and pathogenicity factor RaGAPDH is: ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.

[0046] Example 2 Selection of alternative sites for the conserved B cell epitope peptide TG12 of RaGAPDH in Peg pili

[0047] According to the peg operon sequence of Salmonella Pullorum CVCC 526 (SEQ ID NO. 4), the PredictProtein online website (https: / / predictprotein.org / ) was used to predict the Peg pili of Salmonella pullorum CVCC526, and the amino acids exposed on the surface of Peg were found. At the same time, the protein tertiary structure online prediction website SWISS-MODEL was used to predict the spatial structure of Peg. The protein analysis software Pymol (https: / / pymol.org / 2 / ) was used to visualize the spatial structure of Peg, and the PegA exposed position was selected as the alternative site of the conserved B cell epitope TG12 of the RaGAPDH protein.

[0048] Example 3 Construction of recombinant vectors pBR-peg-RA-TG12 and pBR-peg expressing TG12 and Peg respectively

[0049] Based on the Salmonella Pullorum CVCC 526 peg operon sequence (SEQ ID NO.4), the above-determined RaGAPDH conserved B cell epitope TG12 sequence and the alternative exposure site of the RaGAPDH conserved B cell epitope TG12 in pegA, a plasmid containing the full-length peg operon nucleotide sequence of the RaGAPDH conserved B cell epitope TG12 was synthesized by Beijing Qingke Biotechnology Co., Ltd. and named pUC57-peg-RA-TG12. At the same time, a pair of molecular cloning primers were designed for peg-RA-TG12 (SEQ ID NO.1), and the upstream primer was peg-F: 5′-CGC GCTAGC ATGAAACGTTCACTTATTGCTGCT-3′; downstream primer is peg-R: 5′-CT CGGCCGTTAATTATAAGATACCACGATTAATGC-3′, the underlined sequences represent the restriction enzyme sites of Nhe I and Eag I, respectively. Using pUC57-peg-RA-TG12 as a template, the full length of peg-RA-TG12 was amplified using the upstream and downstream primers peg-F / R. The amplification system was 1 μL of pfu high-fidelity DNA Polymerase (2.5 U / μL) (Beijing Quanshijin Biotechnology Co., Ltd.), 10 μL of 5×pfu DNA polymerase buffer, 4 μL of dNTPs, 1 μL of each upstream and downstream primer (10 μM), 1 μL of pUC57-peg-RA-TG12 template, and 32 μL of ultrapure water. After the above system was mixed evenly, PCR amplification was performed using a thermal cycler (Bio-Red). The PCR program was: 95°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 3 min, 30 cycles; 72°C extension for another 10 min; after the amplification, the temperature was lowered to 4°C for storage. At the same time, the genome of Salmonella pullorum CVCC 526 was set as a positive control; the genome of Escherichia coli engineered bacteria DH5α was set as a negative control.

[0050] The PCR product was electrophoresed in a 1.0% agarose gel at 110 V. After the electrophoresis was completed, the gel was stained with ethidium bromide and the electrophoresis results were observed using a gel imager. Figure 4 As shown, both Salmonella pullorum CVCC 526 and pUC57-peg-RA-TG12 amplified a DNA product of 4850 bp, while the negative control Escherichia coli engineered bacteria DH5α genome did not amplify any band. The peg-RA-TG12 amplified by pUC57-peg-RA-TG12 and the full-length peg operon (SEQ ID NO. 4) amplified by PCR from the Salmonella pullorum CVCC 526 genome were purified using a universal DNA purification and recovery kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., Cat. No.: DP214), and the purified products were frozen at -20°C for future use.

[0051] The E. coli DH5α engineered bacteria were stored in this laboratory. The pBR322 plasmid purchased from the Miaoling plasmid platform was electroporated into the DH5α competent cells at 1.8KV using an electroporator to obtain the DH5α recombinant bacteria containing the pBR322 plasmid. The recombinant bacteria were stored at -80°C. The DH5α containing the pBR322 plasmid stored in a -80°C cryotube was streaked on a plate containing ampicillin (Amp + ) on an LB plate, invert and culture at 37°C overnight, pick a single colony and place it in 4 mL of fresh Amp +Liquid LB medium was cultured at 37°C with shaking at 220 rpm overnight, and the next day, the mixture was transferred to 4 mL of fresh Amp at a ratio of 1:100. + After overnight shaking culture in liquid LB medium at 37°C and 220 rpm, the pBR322 plasmid was extracted using a rapid plasmid extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd., catalog number: DP105). The extracted pBR322 plasmid, the purified peg-RA-TG12 fragment, and the full-length peg operon were double-digested with Nhe I and Eag I restriction endonucleases (NEB, Beijing, catalog number R3131, R3505), and electrophoresed at 110 V and 1.0% agarose gel. The target band was cut and purified using a universal DNA purification and recovery kit. Then, the purified pBR322 plasmid digested fragment was connected with the peg-RA-TG12 digested fragment and the peg operon digested fragment in a 16°C metal bath overnight using T4 DNA ligase (NEB, Beijing, catalog number M0202). The next day, the ligated product was transformed into DH5α competent cells and coated with 100 μg / mL Amp + After inverted culture at 37℃ for 16h, single colonies were picked and inoculated into a plate containing 100μg / mL Amp + LB liquid medium, overnight culture, extract plasmid, double digest with Nhe I and Eag I endonucleases. After electrophoresis at 110V voltage and 1.0% agarose gel for 45 minutes, the electrophoresis results were observed in a gel imager after ethidium bromide staining. The results are as follows Figure 5 As shown, the double enzyme digestion products of the recombinant plasmid pBR-peg-RA-TG12 were 3651 bp linear pBR322 vector and 4850 bp peg-RA-TG12 linear DNA fragment; the double enzyme digestion products of the recombinant plasmid pBR-peg were 3651 bp linear pBR322 vector and 4850 bp peg linear DNA fragment (SEQ ID NO.4), which were consistent with expectations. The recombinant plasmids were named pBR-peg-RA-TG12 and pBR-peg, respectively. A pair of identification primers was designed for pegA to identify whether RA-TG12 was inserted into the surface exposed position in pegA. The upstream primer was pegA-F: 5′-ATGAAACGTTCACTTATTGCTGCT-3′; the downstream primer was pegA-R: 5′-TTAATCAGTTAATACCGTCATCGTCA-3′. The pBR-peg-RA-TG12 plasmid and the identification primers were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing, and it was verified and found that RA-TG12 was inserted into the surface exposed position in pegA.

[0052] Example 4 Construction and functional verification of in vitro agglutination test method for specific recognition and binding of RA infection antibodies directly mediated by conserved B cell epitope peptide TG12

[0053] The S9H (Chinese patent ZL202010427735.8, a pan-inert carrier Salmonella and its potential application) stored in a -80℃ cryotube was streaked onto a solid LB plate, incubated at 37℃ for 24h, and then a single colony was picked up and transferred to 4mL LB liquid culture medium. The culture was shaken at 37℃ and 220rpm for 12h. After the first generation, the bacterial solution was transferred to a 50mL centrifuge tube containing 40mL LB culture medium at a ratio of bacterial solution volume: LB liquid culture medium volume = 1:100, and shaken at 37℃ until the OD 600 =0.4-0.6, place the 50mL centrifuge tube in an ice bath for 30min, centrifuge at 4°C, 4000rpm for 10min, then resuspend with pre-cooled 10% glycerol, centrifuge at 4°C, 4000rpm for 10min, wash the bacteria three times with 10% glycerol, finally resuspend with 40μL of 10% glycerol for every 4mL of bacterial solution, aliquot at 100μL / tube to make S9H competent state, and freeze at -80°C for later use.

[0054] 200 ng of pBR-peg-RA-TG12 plasmid and pBR-peg plasmid (see Example 3) were mixed with 100 μL S9H competent cells, electroporated at 2.2 KV using an electroporator, and then 1 mL of SOC medium was added and cultured at 37°C with shaking for 1 h. 200 μL of the bacterial solution was spread on a plate containing 100 μg / mL Amp + LB plates were inverted and cultured at 37°C. Positive clones were picked and identified using pegA-F / R. The positive clone containing pBR-peg-RA-TG12 was named S9H-pBR-peg-RA-TG12, and the positive clone containing pBR-peg was named S9H-pBR-peg.

[0055] S9H-pBR-peg-RA-TG12 and S9H-pBR-peg were mixed in the presence of 100 μg / mL Amp + The cells were grown in LB liquid medium until the stationary phase, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. The cells were resuspended with an equal volume of sterile saline and washed twice to prepare S9H-pBR-peg-RA-TG12 and S9H-pBR-peg bacterial suspensions (final concentration 1×10 10 CFU / mL).

[0056] Agglutination test was performed with S9H-pBR-peg-RA-TG12 bacterial suspension and S9H-pBR-peg bacterial suspension and negative chicken serum (90-day-old SPF chicken serum) and Salmonella pullorum positive serum (90-day-old SPF chickens were immunized twice with Salmonella pullorum standard strain CVCC 526, and blood was collected 45 days after immunization) and S9H (S9H-pBR322) bacterial suspension containing pBR322 empty vector was used as negative control. The results are shown in Table 1, and the bacterial suspensions of S9H-pBR-peg-RA-TG12, S9H-pBR-peg and S9H-pBR322 did not react with negative serum. Both S9H-pBR-peg-RA-TG12 bacterial suspension and S9H-pBR-peg bacterial suspension showed significant agglutination with positive serum of Salmonella pullorum, and white agglutinated particles gathered and deposited on both sides of the reaction solution; while S9H-pBR322 bacterial suspension containing pBR322 empty vector did not agglutinate with positive serum, no agglutinated particles, and the background was turbid. The results showed that positive serum of Salmonella pullorum was specifically recognized by Salmonella pullorum Peg pili, and Salmonella pullorum Peg pili could be successfully functionally displayed and expressed on the surface of the inert carrier Salmonella S9H.

[0057] Table 1 Verification of the functional display of Salmonella pullorum Peg pili on the surface of the inert carrier Salmonella S9H

[0058]

[0059]

[0060] Note: "Negative" means negative agglutination reaction, no agglutinated particles, and a turbid background; "Positive" means positive agglutination reaction, white agglutinated particles are deposited on both sides of the reaction solution.

[0061] The above-mentioned S9H-pBR-peg-RA-TG12 bacterial suspension was subjected to agglutination tests with 10 sera from 7-day-old healthy ducks (kindly donated by Tianjin Heliant Biotechnology Co., Ltd.), 10 sera from 1-day-old healthy geese (kindly donated by the Animal Husbandry Research Institute of Ningbo Academy of Agricultural Sciences, Zhejiang Province), and 15 RA-positive sera (5 sera each from ducks orally infected with type 1, 2 and 10 RA, kindly donated by Tianjin Heliant Biotechnology Co., Ltd. and the Animal Husbandry Research Institute of Ningbo Academy of Agricultural Sciences, Zhejiang Province), and the S9H-pBR-peg bacterial suspension containing pBR-peg was used as a negative control. The results are shown in Table 2. Neither the S9H-pBR-peg-RA-TG12 bacterial suspension nor the S9H-pBR-peg bacterial suspension reacted with the sera of healthy ducks or geese. The S9H-pBR-peg-RA-TG12 bacterial suspension reacted with 15 positive sera infected with RA, and white agglutinated particles were deposited on both sides of the reaction solution. However, the S9H-pBR-peg control and the positive sera did not react with agglutination, and there were no agglutinated particles, and the background was turbid. This result shows that the conserved B cell epitope peptide TG12 can be expressed on the surface of the inert carrier Salmonella through Peg pili, and antibodies against RA can be detected. In this detection method, S9H-pBR-peg is used as the detection control. Compared with the detection antigen S9H-pBR-peg-RA-TG12, the detection control only lacks the conserved B cell epitope peptide TG12, and the absence of agglutination reaction ensures the specificity of the detection result.

[0062] Table 2 Functional verification of RaGAPDH conserved B cell epitope peptide TG12 expressed on the surface of S9H

[0063]

[0064] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0065] Example 5 Specificity and sensitivity test of in vitro agglutination test method for specific recognition and binding of Riemerella anatipestifer infection antibodies directly mediated by conserved B cell epitope peptide TG12

[0066] According to the method in Example 4, the detection control S9H-pBR-peg bacterial suspension and the detection antigen S9H-pBR-peg-RA-TG12 bacterial suspension (the bacterial suspension concentration was 1×10 10CFU / mL), and the above two bacterial suspensions were subjected to agglutination tests with positive sera / antibodies with different background information to verify the specificity of the plate agglutination detection method. The sera / antibodies used included: 15 sera of ducks orally infected with RA types 1, 2, and 10 (kindly donated by Tianjin Heliant Biotechnology Co., Ltd. and the Institute of Animal Science and Poultry, Ningbo Academy of Agricultural Sciences, Zhejiang Province), 4 sera of goose orally infected with RA type 1 (kindly donated by Tianjin Heliant Biotechnology Co., Ltd.), 3 clinical RA-positive goose sera (kindly donated by the Institute of Animal Science and Poultry, Ningbo Academy of Agricultural Sciences, Zhejiang Province after bacterial isolation and identification), 2 RA-positive sera (kindly donated by Hebei Normal University of Science and Technology), 10 SPF chicken sera (prepared and stored in this laboratory), 10 CIAV artificially infected positive sera (prepared and collected by this laboratory), 7 Escherichia coli APEC-infected duck sera (obtained by this laboratory using Escherichia coli APEC TW-XM strain to infect ducks), 6 Escherichia coli-positive mouse sera (obtained by this laboratory using Escherichia coli APEC TW-XM strain to infect SPF mice), 5 Salmonella typhimurium-positive sera (preserved in this laboratory), and 1 Escherichia coli F4 monoclonal antibody (prepared and stored in this laboratory). The experimental results are shown in Table 3, and some agglutination test results are shown in Figure 6 The S9H-pBR-peg detection control did not agglutinate with any sera / antibodies; S9H-pBR-peg-RA-TG12 only reacted with RA-positive sera, but not with negative sera and other sera / antibodies.

[0067] Table 3 Specificity verification of the in vitro agglutination test method for specific recognition and binding of Riemerella anatipestifer infection antibodies mediated directly by the conserved B cell epitope peptide TG12

[0068]

[0069] Note: “-” represents negative agglutination reaction; “+” represents positive agglutination reaction

[0070] The sensitivity test of the present invention is to determine the earliest detection time of Riemerella anatipestifer antibodies by detecting duck serum (kindly donated by Tianjin Heliante Biotechnology Co., Ltd.) at different days after oral infection of Riemerella anatipestifer with RA strains. Before artificial infection, whole blood of ducks was collected for serum separation and preparation; then the ducklings were orally inoculated with RA weak strains, and duck serum was collected and prepared on days 7 and 14, and the RA infection antibodies in the serum were detected using the in vitro agglutination test directly mediated by the conservative B cell epitope antigen TG12 of the present invention. The antibody detection results of duck serum after infection are shown in Table 4. The in vitro agglutination test detection method directly mediated by the conservative B cell epitope peptide TG12 of the present invention can detect RA agglutination antibodies in the serum of infected ducks on the 7th day, and has high sensitivity.

[0071] Table 4 In vitro aggregation of RA infection antibodies specifically recognized and bound by the conserved B cell epitope antigen TG12

[0072]

[0073] Sensitivity validation of the cluster test method

[0074] In summary, the in vitro agglutination test detection method for specific recognition and binding of RA infection antibodies directly mediated by a conserved B cell epitope peptide TVDGPSMKDWRG (TG12) on the surface of the RA adhesion colonization and infection pathogen RaGAPDH protein and the conserved B cell epitope peptide TG12 provided by the present invention has potential application prospects in the differential diagnosis and prevention and control of RA clinical infection. The in vitro agglutination test for specific recognition and binding of RA infection antibodies directly mediated by the conserved B cell epitope peptide TG12 of the present invention is used to detect the level of RA post-infection antibodies in the sample (serum), which has good specificity, sensitivity and repeatability, and has the advantages of convenience and speed. Its low detection cost and convenience can be used for large-scale rapid detection in farms.

[0075] SEQ ID NO.1: peg-RA-TG12 gene fragment

[0076]

[0077] SEQ ID NO.2: Recombinant pegA-TG12 gene sequence

[0078] ATGAAACGTTCACTTATTGCTGCTTCTGTATTGTCTGCTGTATTTATGAGCGCTGGGGTTTTTGCTGCTGATGAAGATATGGGGGAATTAAAAATAAACGGAGAAGTGGTGGGAACATCCTGTACTTTCGAAGGTGCAAATAGCGCGACTATTGAATTATCCCAGGTAGGTGTTGATAGATTGACTACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGTAGCCCAGAAGCGATTTTAAAAGTAAGATGTACGAATACAGCTAATCCACGAATTAGTTTTAACCGTTCTCAATTTGTGGATAACATGCAAATCACCAAAAATAATGCTACTAATAATGGTGCGGGCTTCGCTGTTTATCTTGATGGTATTCAGGTGAAACCGGATGAGGCGGGGAATTACACTCTGAATTCAAGTAAGTTTGAAAATGGTGTATATACCCTGAACTTTTCTGCCCGCTATGCCGCCGTTGAAAATACTGTAACACCAGGTTCTGTTGAATCTGTACTGACGATGACGGTATTAACTGATTAA

[0079] SEQ ID NO.3: Amino acid sequence of recombinant PegA-TG12 protein

[0080] MKRSLIAASVLSAVFMSAGVFAADEDMGELKINGEVVGTSCTFEGANSATIELSQVGVDRLTTVDGPSMKDWRGSPEAILKVRCTNTANPRISFNRSQFVDNMQITKNNATNNGAGFAVYLDGIQVKPDEAGNYTLNSSKFENGVYTLNFSARYAAVENTVTPGSVESVLTMTVLTD

[0081] SEQ ID NO.4: Full-length peg operon

[0082]

Claims

1. A conserved B cell epitope peptide TG12 of 3-phosphoglyceraldehyde dehydrogenase, a surface adhesion factor of Riemerella anatipestifer, characterized in that: The amino acid sequence of the conserved B cell epitope peptide TG12 is TVDGPSMKDWRG.

2. A nucleic acid molecule encoding the conserved B cell epitope peptide TG12 according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid molecule is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT.

3. A recombinant gene peg-RA-TG12 or recombinant gene pegA-TG12 , characterized in that, The nucleotide sequence is shown as SEQ ID NO.1 or SEQ ID NO.

2.

4. A recombinant Peg protein expressing a conserved B cell epitope peptide TG12 in Peg pili, characterized in that: The amino acid sequence of the recombinant Peg protein is shown in SEQ ID NO.

3.

5. An expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, characterized in that: It comprises the nucleic acid molecule of claim 2 or the TG12 epitope sequence of claim 3 inserted peg Recombinant gene peg-RA-TG12 or recombinant gene pegA-TG12 .

6. The method for constructing the recombinant vector according to claim 5, characterized in that: The following steps are involved: (1) obtaining the nucleotide sequence of the nucleic acid molecule of the conserved B cell epitope peptide TG12 of the surface adhesion factor 3-glyceraldehyde phosphate dehydrogenase of Riemerella anatipestifer; the nucleotide sequence of the nucleic acid molecule is ACGGTAGACGGTCCTTCTATGAAAGATTGGAGAGGT; (2) Inserting the nucleic acid molecule sequence obtained in step (1) into a vector containing the Peg pili encoding gene sequence to construct a recombinant vector.

7. The method for constructing the recombinant strain according to claim 5, characterized in that: The recombinant vector according to claim 5 is introduced into the carrier bacteria to obtain the product.

8. The method for constructing the recombinant strain according to claim 7, characterized in that: The introduction method is an electrotransformation method, and the carrier bacteria are inert carrier bacteria.

9. The conserved B cell epitope peptide TG12 according to claim 1, the nucleic acid molecule according to claim 2, and the recombinant gene according to claim 3 peg-RA-TG12 or recombinant gene pegA-TG12 , the use of the recombinant Peg protein according to claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5 in the preparation of a reagent or kit for detecting infectious antibodies against Riemerella anatipestifer.

10. A detection system or a detection kit for antibodies to infection by the pathogen Riemerella anatipestifer, characterized in that: The detection system or detection kit for antibodies to Riemerella anatipestifer infection comprises the conserved B cell epitope peptide TG12 according to claim 1, the nucleic acid molecule according to claim 2, and the recombinant gene according to claim 3. peg-RA-TG12 or recombinant gene pegA-TG12 , the recombinant Peg protein according to claim 4, the expression cassette, recombinant vector, recombinant cell or recombinant strain according to claim 5.

Images