MRNA vaccine for preventing or treating malignant tumors as well as preparation method and application of mRNA vaccine

Abstract

The invention belongs to the technical field of biological medicines, and particularly relates to an mRNA vaccine for preventing or treating malignant tumors as well as a preparation method and application of the mRNA vaccine. The mRNA vaccine is composed of a nucleic acid molecule encoding an NID1 antigen and cationic lipid nanoparticles wrapping the nucleic acid molecule, and the nucleic acid molecule or the cationic lipid nanoparticles have good immunogenicity and can induce an organism to generate strong cellular and humoral immune response in a short time. The nucleic acid molecule or the lipid nanoparticle thereof can express NID1 protein in a body after being delivered into the body, trigger immune response of the body and enable the body to generate anti-tumor immune response, meanwhile, the nucleic acid molecule or the lipid nanoparticle thereof can effectively inhibit tumor growth only by low dosage, and the nucleic acid molecule or the lipid nanoparticle thereof is quick, simple and convenient to prepare and low in cost. The large-scale production can be realized in a short time, the industrialization of the medicine is facilitated, and the cost of the anti-tumor medicine is reduced.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an mRNA vaccine for preventing or treating malignant tumors and a preparation method and application thereof. Background Art

[0002] The global pandemic of COVID-19 has attracted worldwide attention to the development and application of vaccines based on mRNA (messenger RNA) technology. The maturity and progress of this technology also endow mRNA vaccines with great potential in other fields, especially in cancer treatment. Both the medical and scientific communities hope that mRNA vaccines can become the next treatment to fight cancer and save patients' lives. Tumor vaccines use tumor-associated antigens to induce the body's specific cellular and humoral immune responses, and inhibit tumor growth by enhancing its own resistance to tumors, thereby achieving the purpose of controlling tumors. At present, tumor vaccines can be divided into four categories: whole-cell vaccines based on tumor cells or antigen-presenting cells, tumor peptide vaccines, viral vector-based vaccines, and nucleic acid-based vaccines. Among them, nucleic acid vaccines include DNA vaccines and RNA vaccines. Compared with other types of cancer vaccines, mRNA-based vaccines have significant advantages, including rapid research and development and production, safer, and can induce more efficient immune responses. This is mainly manifested in that mRNA vaccines only transiently express tumor antigens and do not interact with genomic DNA, thereby reducing the risk of genomic integration brought by traditional vaccines such as viral vector vaccines and DNA vaccines. More importantly, mRNA vaccines can be combined more flexibly, encoding one or more antigens, including the full length or partial polypeptide segments of antigen proteins, making it easier to achieve the efficacy of multivalent vaccines and conveniently and flexibly selecting to use multiple antigens at the same time to enhance the effect of vaccines. Compared with traditional inactivated vaccines or recombinant protein vaccines, mRNA vaccines can more efficiently activate cell responses to achieve better preventive efficacy. The above advantages make mRNA tumor vaccines have strong clinical application prospects and become a current research hotspot.

[0003] At present, most mRNA tumor vaccines are still in the clinical trial stage, and their efficacy has not yet been determined. How to design a stable and safe tumor mRNA vaccine that can induce specific tumor immune response, has few side effects and can be mass-produced will be the key to determining whether mRNA vaccines can enter the clinic. At present, there are two main types of antigens targeted by mRNA vaccines, including tumor associated antigens (TAAs) and tumor specific antigens (TSAs). TAAs mainly refer to antigens that are highly expressed in tumors and lowly expressed in normal tissues, while TSAs refer to neoantigens produced by tumor cell mutations, which are only expressed in tumors and have high immunogenicity. TSAs are more suitable for personalized precision treatment due to their high individual differences, but the difficulty in scalable survival leads to increased treatment costs, which limits the prospect of their popular use. In contrast, the production cost of mRNA vaccines designed based on TAAs is relatively low. However, since TAAs are also expressed in normal tissues, the risk of potential inducing autoimmune toxicity is also increased accordingly. Although mRNA encoding full-length antigen sequences can break through the restrictions of HLA types and induce a wider range of T cell responses, no relevant mRNA vaccines have been approved for clinical use. Taking advantage of the multi-antigen binding of mRNA, mRNA vaccines containing multiple TAA sequences are undergoing clinical trials. For example, the LipoMERIT vaccine from BioNTech combines NY-ESO-1, MAGE-C3, tyroxinase and gp100 antigen sequences for the treatment of advanced melanoma. The CV9201 vaccine from CureVac contains multiple antigens such as MAGE-C1, MAGE-C2, NY-SEO-1 and survivin for the treatment of advanced lung cancer. For the prevention and treatment of different cancers, domestic and foreign teams are intensively conducting research using mRNA vaccine technology, and the application prospects of mRNA tumor vaccines are promising.

[0004] However, the existing anti-tumor mRNA vaccines have the following disadvantages: 1) The mainstream LNP system (DLin-MC3-DMA (MC3), ALC-0315 and SM-102) used in the mRNA vaccines currently approved or in clinical trials has poor stability and harsh storage conditions. 2) mRNA vaccines targeting tumor-specific antigens are only suitable for the development of personalized tumor vaccines, and have the disadvantages of high cost and difficulty in large-scale production. 3) mRNA vaccines targeting tumor-associated antigens have lower production costs, but because normal tissues and cells may also contain low levels of expression of the associated antigen, there is a risk of inducing autoimmune toxicity. 4) mRNA vaccines encoding full-length antigen sequences can more effectively induce T cell responses, but no related anti-tumor mRNA vaccines have been approved for marketing, and their safety needs further verification. 5) NID1 is highly expressed in many cancers and has an important regulatory role in the tumor microenvironment. Previous studies have shown that it is a safe and effective pan-cancer target, but there is still no anti-tumor vaccine targeting NID1 on the market. Summary of the invention

[0005] In view of the problems existing in current anti-tumor vaccines and the prospects of NID1 as a vaccine antigen, the present invention uses NID1 as an antigen to provide an mRNA vaccine for the prevention and treatment of malignant tumors. The vaccine encodes the full-length protein of NID1 and can effectively inhibit tumor growth or prevent tumor formation with only a low dose, has good safety and a simple preparation process.

[0006] To achieve the above objectives, the technical solutions adopted by the present invention include:

[0007] In a first aspect, the present invention provides a nucleic acid molecule encoding NID1 antigen, wherein the nucleotide sequence of the nucleic acid molecule is as shown in (a) or (b):

[0008] (a) the nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0009] (b) A nucleotide sequence derived from (a) having a function of encoding NID1 antigen, wherein the nucleotide sequence in (a) is substituted, deleted or added with at least one nucleotide.

[0010] The nucleic acid molecule comprises at least one of a 5'-cap structure, a 5'-UTR, a 3'-polynucleotide sequence and a 3'-UTR, wherein the 5'-UTR is 10-200 nucleotides, preferably 50-100 nucleotides; the 3'-UTR is 50-250 nucleotides, preferably 100-200 nucleotides; and the 3'-polynucleotide sequence is 70-150 A, more preferably 100-120 A.

[0011] The nucleic acid molecule of the present invention can encode the full-length NID1 antigen, has good immunogenicity, and can induce the body to produce strong cellular and humoral immune responses in a short period of time, thereby achieving the purpose of preventing or treating malignant tumors.

[0012] Preferably, the nucleic acid molecule comprises at least one of DNA, ASO, siRNA, miRNA, mRNA and aptamer, and more preferably, the nucleic acid molecule is mRNA.

[0013] In a second aspect, the present invention provides a nucleic acid-liposome complex, wherein the nucleic acid-liposome complex comprises the nucleic acid molecule and cationic lipid nanoparticles encapsulating the nucleic acid molecule.

[0014] Preferably, the molar ratio of the cationic lipid nanoparticles to the nucleic acid molecules is (2-10):1.

[0015] Preferably, the cationic lipid nanoparticles comprise the following components in molar percentages: 15-49% cationic lipid, 40-50% structural lipid, 5-20% auxiliary lipid and 1-5% PEGylated lipid.

[0016] Preferably, the structural lipid comprises cholesterol or a derivative thereof, the auxiliary lipid comprises any one of DSPC, DOPE, DOPG and DOPS, and the PEGylated lipid comprises PEG-DMG or PEG-DSPE.

[0017] More preferably, the structural lipid is cholesterol, the auxiliary lipid is DSPC, and the PEGylated lipid is PEG-DMG.

[0018] The cationic lipid nanoparticles coated with nucleic acid molecules described in the present invention can ensure that mRNA encoding tumor-associated antigens is effectively delivered to target cells, prevent it from being degraded in the body, and achieve transient expression of tumor-associated antigens, activate the body's immune response, and to a certain extent promote the activation and regulation of the immune system, thereby enhancing the effect of tumor immunotherapy.

[0019] In a third aspect, the present invention provides a method for preparing the nucleic acid-liposome complex, comprising the following steps:

[0020] S1, dissolving the cationic lipid, the structural lipid, the auxiliary lipid and the PEGylated lipid in an organic solvent to obtain an organic phase;

[0021] S2, dissolving the nucleic acid molecule in a solvent buffer to obtain an aqueous phase;

[0022] S3, the organic phase and the aqueous phase are fully mixed to obtain a liposome mixed solution encapsulating the nucleic acid molecules, and then the storage buffer is used to replace the solvent buffer in the mixed solution and the solvent in the organic phase to obtain the nucleic acid-liposome complex.

[0023] Preferably, the total concentration of cationic lipids, structural lipids, auxiliary lipids and PEGylated lipids in the organic phase is 1-30 mg / mL, the concentration of nucleic acid molecules in the aqueous phase is 0.2-1.5 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:(2-6).

[0024] More preferably, the total concentration of the cationic lipids, structural lipids, auxiliary lipids and PEGylated lipids in the organic phase is 15-20 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:3.

[0025] Preferably, the organic solvent includes but is not limited to ethanol, the solvent buffer includes but is not limited to citrate buffer and sodium acetate solution, and the storage buffer includes but is not limited to PBS solution.

[0026] Preferably, the method for replacing the solvent buffer in the mixed solution and the solvent in the organic phase is: using a stable storage buffer to dilute the liposome mixed solution encapsulating the nucleic acid 10-200 times (preferably 50-100 times) and then concentrate it, or placing the liposome mixed solution encapsulating the nucleic acid in a 1000-fold volume of a stable storage buffer and then concentrating it after dialyzing, or using a buffer exchange technique such as tangential flow to replace the solvent in the solvent buffer and the organic phase with a stable storage buffer.

[0027] In a fourth aspect, the present invention provides the use of the nucleic acid molecule and / or the nucleic acid-liposome complex in the preparation of a drug for preventing or treating malignant tumors.

[0028] Preferably, the drug comprises a vaccine, and the malignant tumor comprises liver cancer.

[0029] The present invention uses the disclosed mRNA nucleic acid molecule encoding the NID1 antigen to develop a vaccine. Using mRNA as the main component of the vaccine has the advantages of rapid development, high safety, and easy industrialization. Using mRNA as the main component of the vaccine, the vaccine is synthesized by in vitro enzymatic method, and the preparation process is mature, without the need to use cells to proliferate the virus or produce recombinant proteins. Using a very small dose can achieve sufficient protection, and it is superior to other existing tumor vaccine technologies in terms of safety and effectiveness. In addition, NID1 is significantly highly expressed in a variety of malignant tumors. Compared with existing anti-tumor mRNA vaccines, the mRNA vaccine with NID1 as the antigen has obvious therapeutic and preventive effects on lung cancer and liver cancer.

[0030] Preferably, the administration of the vaccine includes aerosol administration, intravenous injection, subcutaneous injection, intramuscular injection, and ocular administration.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] The present invention discloses a nucleic acid molecule capable of effectively preventing and treating tumors, wherein the nucleic acid molecule comprises at least one nucleotide encoding NID1 protein, or a lipid nanoparticle of the nucleotide. The nucleic acid molecule or its lipid nanoparticle has good immunogenicity, can induce a strong cellular and humoral immune response in a short time, can express NID1 protein in the body after the nucleic acid molecule or its lipid nanoparticle is delivered into the body, triggers the body's immune response, and can cause the body to produce an immune response against tumors. At the same time, the nucleic acid molecule or its lipid nanoparticle only needs a low dose to effectively inhibit tumor growth. In addition, the nucleic acid molecule or its lipid nanoparticle is quick and easy to prepare, can be mass-produced in a short time, is conducive to the industrialization of the drug and reduces the cost of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a diagram showing the sequence alignment results of mNID1 (mouse source) before and after mRNA sequence optimization;

[0034] Figure 2 This is a diagram showing the sequence alignment results of the hNID1 (human) mRNA sequence before and after optimization;

[0035] Figure 3 This is the mRNA vaccine IVT template plasmid map;

[0036] Figure 4 Schematic diagram of the complete structure of non-modified and modified NID1 mRNA;

[0037] Figure 5 This is the agarose gel electrophoresis imaging result of NID1 mRNA;

[0038] Figure 6 This is a graph showing the results of WB detection of the translation efficiency of artificially prepared NID1 mRNA in HEK293T cells;

[0039] Figure 7 The particle size and distribution test results of the prepared LNP-mRNA are shown in FIG.

[0040] Figure 8 This is the experimental flow chart of the effect of NID1-mRNA vaccine on the treatment of liver cancer;

[0041] Fig. 9 This is a diagram showing the effect of NID1-mRNA vaccine in treating liver cancer. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical scheme and effect of the present invention clearer and more specific, the present invention is further described in detail with reference to the following embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0043] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0044] Example 1. Preparation of mRNA encoding NID1 antigen

[0045] (1) NID1 mRNA sequence optimization:

[0046] The current mainstream codon optimization algorithm mainly uses CAI optimization as an indicator to measure the degree of consistency between the codon usage frequency of the heterologous mRNA sequence and the optimal codon usage frequency of the host cell. However, codons are not the only factor that affects protein expression, especially when mRNA is synthesized in large quantities in a test tube by T7 RNA polymerase. In addition to CAI as an indicator, GC content, secondary structure (free energy), T7 RNA polymerase-sensitive transcription terminators, T7 RNA polymerase-like promoters within the mRNA sequence, and the selection of UTRs should also be considered, which will seriously affect the expression of artificially synthesized mRNA in cells and in vivo.

[0047] In this study, a software platform specially developed by Shenzhen Hongxin Biological (magicRNA) Company for mRNA sequence optimization was used. Its algorithm focuses on the balance of multiple factors (GC content, codon usage frequency and secondary structure, transcription terminator, and T7 RNA polymerase-like promoter avoidance). The sequences of mNID1 (mouse source) and hNID1 (human source) were optimized by magicRNA platform technology (at the same time, the optimized sequence avoided the BsaI restriction site so that the plasmid could be cut at the artificially designed BsaI restriction site after polyA to obtain a linearized IVT template). The GC content of mNID1 increased from 55.6% to 63.4%, and the CAI increased from 0.91 to 0.98, and the optimized sequence NID1_a (SEQ ID NO: 1) of mNID1 mRNA was obtained; the GC content of hNID1 increased from 57.4% to 62.95%, and the CAI increased from 0.80 to 0.98, and the optimized sequence NID1_b (SEQ ID NO: 2) of hNID1 mRNA was obtained. NO:2); Figure 1-2 The following are the sequence comparison results of mNID1 (mouse source) and hNID1 (human source) mRNA sequences before and after optimization.

[0048] (2) Construction of IVT (in vitro transcription) template plasmid:

[0049] The UTR sequence of mRNA in this study comes from the 5'UTR (Mod) and 3'UTR (Mod) of the ModeRNA COVID-19 vaccine (mRNA-1273). This study chose to first send the T7promoter-UTR (Mod)-120A-BsaI tandem sequence to GenScript for synthesis and then insert it between the HindIII and EcoR1 restriction sites of the pUC57 vector to obtain an IVT framework empty vector named: pIVT-T7-UTR (Mod)-120A-BsaI, where the sequences of each element are as follows:

[0050] T7 promoter (promoter sequence): 5'-TAATACGACTCACTATA-3' (SEQ ID NO: 3);

[0051] 5'-UTR (Morderna) sequence:

[0052] 5'-GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCC GGCGCCGCCACC-3' (SEQ ID NO: 4);

[0053] 3'-UTR (Morderna) sequence:

[0054] 5'-CTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCA GCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGTCTTTGAATAAAGTCT GAGTGGGCGGTAGC (SEQ ID NO: 5);

[0055] PolyA (120A) sequence:

[0056] 5'-AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA GAGACC (SEQ ID NO: 6) (wherein "TGAGACC" is a BsaI restriction site).

[0057] On this basis, according to the principle of seamless cloning, the present invention designed primers (see Table 1) to insert the optimized NID1_a and NID1_b into the IVT framework empty vector, respectively, to obtain pIVT-T7-+NID1a-120A-BsaI and pIVT-T7-+NID1b-120A-BsaI plasmids ( Figure 3 ), and screened and preserved colonies with polyA tail length > 110A through competent transformation and monoclonal sequencing. The strains were used for amplification culture and extraction of IVT template plasmids.

[0058] Table 1 Primers required for construction of NID1 mRNA template plasmid

[0059]

[0060] (3) Preparation of NID1 mRNA (m1ψ-modified and unmodified mRNA):

[0061] 1) The pIVT-UTR+NID1_a-120A-BsaI constructed in the previous step and

[0062] The pIVT-UTR+NID1_b-120A-BsaI plasmid was amplified and cultured in 100 mL LB medium, and then the plasmid was extracted using Axygen's plasmid extraction kit (MD-P-25). The plasmid was digested with BsaI restriction endonuclease and then linearized using DNA purification magnetic beads (Novozymes), and dissolved in enzyme-free water and placed at -20°C.

[0063] 2) In vitro transcription and synthesis of RNA (Table 2):

[0064] Table 2 Components of in vitro transcription system (100 μL)

[0065] Component name concentration 10× Transcription Buffer 10μL NTP (25 mM each in A, G, C, U / ml) 7.5 μL each DNA template (linearized template plasmid) Final concentration: 50ng / μL Inorganic pyrophosphatase (10 μM) 5.0μL RNase inhibitor (U / μL) 3.0μL T7 RNA polymerase (50U / μL) 10.0μL <![CDATA[Supplementary enzyme-free H2O]]> To a total volume of 100 μL

[0066] After flicking to mix, place at 37°C for 1 hour, add 75 μL of DNase I and incubate at 37°C to eliminate DNA for half an hour, take out and mix once, then add an equal volume of enzyme-free water to mix, and then add 1.8 times the volume of RNA purification magnetic beads (Novozyme) to purify the synthesized RNA.

[0067] 3) RNA capping reaction (10 mL capping reaction system):

[0068] Take 5.0mg of RNA synthesized in the previous step, add enzyme-free H2O to a total volume of 7.0mL, mix well, place at 70℃ for heat denaturation for 5 minutes, and then immediately place on ice for 5 minutes; then add 1.0mL of 10× capping buffer; 0.5mL of GTP (10mM), 0.5mL of SAM (4mM) 0.5mL of vaccinia virus capping enzyme (Cap0); 0.5mL of 2'-O-methyltransferase (Cap1); mix well and react at 37℃ for 30 minutes, take out and gently invert and mix every 10 minutes. After the capping reaction is completed, add 0.5 times the volume of RNA purification magnetic beads (Novozyme) for RNA purification.

[0069] 4) Oligo(dT)25 affinity filler (Thermo) was used to purify RNA products that were interrupted and degraded by transcription, thereby improving the purity and uniformity of mRNA products.

[0070] 5) RNA quality testing:

[0071] First, the concentrations of four NID1 mRNAs (m1ψ modified or natural unmodified NID1_a and NID1_b mRNAs) were measured by Nano-drop UV spectrophotometer, and the purity of mRNA was determined by the values ​​of OD280 / 260 and OD260 / 230. Second, the integrity and size of mRMA were detected by agarose gel electrophoresis. The specific steps were as follows: 1.0 μg of mRNA sample was diluted with 5 μL of enzyme-free water, added with an equal volume of 2× RNA loading buffer and mixed, heated at 85°C for 2 minutes, and immediately placed on ice for 2 minutes, then electrophoresed at 100V for 30 minutes in a 1.5% agarose gel, and RNA marker (Thermo, SM1821) was used to indicate the size of the sample RNA. The UV gel imaging results are shown in Figure 2. Figure 5 .

[0072] 6) Screening of translation efficiency of mRNA vaccine candidates at the cellular level:

[0073] 24 hours before mRNA transfection, 293T cells were plated in 24-well plates, and then the cells were transfected at a ratio of 0.5 μg mRNA + 1.5 μL lip3000 transfection reagent per well, and collected after 24 hours; the cell samples were lysed with cell lysis buffer, the lysate supernatant was collected by centrifugation, 5× SDS loading buffer was added, and then Western-blot experiments were performed after denaturation at 98°C for 5 minutes. The primary antibody was NID1 monoclonal antibody (Abcam), and ECL chemiluminescence detection was used to determine the expression levels of the four mRNAs in 293T cells ( Figure 6). The present invention selects one mRNA with better translation expression from human and mouse NID1 mRNAs for LNP nanoparticle packaging and animal experiments.

[0074] Example 2. Encapsulation and Identification of LNP-mRNA Liposome Nanoparticles

[0075] (1) Preparation of liposome nanoparticles:

[0076] First, the ionizable lipid (patent number: CN202111017566.1) and the structural lipid (cholesterol), auxiliary lipid (DSPC), and PEGylated lipid (PEG2000-DMG) were dissolved in anhydrous ethanol (organic phase) at a molar ratio of 44.2:9.9:44.2:1.7, and then the organic phase dissolved in the liposomes and the 25mM sodium citrate acid solution dissolved in the mRNA (aqueous phase) were mixed in a microfluidic chip at a volume ratio of 1:3 using a microfluidic preparation system (Miana, INano E), and the mixing flow rate was 12mL / h to prepare a crude solution of lipid nanoparticles. The resulting solution was then diluted with PBS and ultrafiltered at 1500rcf for 20min at 4°C using a 15mL or 50mL ultrafiltration centrifuge tube (Millipore, 100K), and ultrafiltered for 3 times, and finally the molar ratio of the ionizable lipid to the mRNA was about 5:1.

[0077] (2) Characterization of lipid nanoparticles:

[0078] Characterization of particle size, PDI and potential: The particle size and PDI of the prepared lipid nanoparticles were measured by Nano-ZSZEN3600 (Malvern). The prepared LNP-mRNA liposome nanoparticles were diluted 100 times with PBS solution for particle size or potential measurement, with a stabilization time of 120s, 3 cycles, and 10 cycles each time. The test results showed that the particle sizes of the prepared LNP-NID1_amRNA and LNP-NID1_b mRNA nanoparticles were 82.83nm and 84.27nm, respectively, and the PDI was less than 0.1( Figure 7 ), the potential was measured to be around 0.5 mV.

[0079] Encapsulation efficiency determination: According to the standard procedure of Quant-iT RiboGreen RNA kit, the mRNA concentration before and after x-100 demulsification was detected, and the LNP encapsulation efficiency was calculated. The general process is: add 498μL 1×TE and 498μL 2% concentration Triton-100 solution to 2μL ultrafiltered LNP-mRNA sample, analyze the absorbance with a microplate reader after adding luminescent liquid, and calculate the mRNA concentration according to the standard curve. The results showed that the encapsulation efficiency of the prepared LNP-NID1_a mRNA and LNP-NID1_b mRNA samples was 93.6% and 94.6%, respectively, R 2 >0.99.

[0080] Example 3. Animal experiments to verify the efficacy of mRNA vaccines

[0081] Select SPF-grade C57BL / 6 mice (6-8 weeks, weighing 16-20g) that have passed quarantine and reached the weight standard to establish an orthotopic liver cancer tumor model. The orthotopic liver cancer inoculation is as follows: After the mice are anesthetized, they are placed in a supine position and fixed on a test board. The hair is shaved and the skin is disinfected with iodine. A longitudinal incision is made along the midline of the abdomen under the xiphoid process, and the skin and peritoneum are cut layer by layer to fully expose the left lobe of the liver. Use a 50μL microsyringe to extract 50μL containing 1×10 5 1753p53- / -cMyc cell suspension was inserted into the liver parenchyma at a 20° angle for about 0.5 cm and the cell suspension was slowly injected. The needle was left there for a while. After the injection, the needle was pulled out and the needle hole was immediately pressed lightly with a cotton swab until the liver surface stopped bleeding. The abdomen was closed layer by layer. The mice were kept after surgery and were allowed to eat and drink freely. Grouping: Male C57BL / 6 mice were randomly divided into a control group (PBS) and a NID1-mRNA vaccine treatment group, with 5 mice in each group. When the orthotopic tumor model was successfully established by bioluminescence (day 7), PBS or vaccine treatment was given on days 7 and 14, respectively, that is, 50 μL (LNP-mRNA) vaccine was injected into each mouse by intramuscular injection (IM). Each vaccine contained 1 μg, 5 μg or 10 μg NID1-mRNA vaccine, respectively. The mental state, diet, defecation, body weight and activity of C57BL / 6 mice were regularly observed, the biological signals of the orthotopic tumor were measured weekly, and the survival of the mice was checked. The experiment ended on day 21 (see Figure 8 ).

[0082] The results showed that only 1 μg of NID1-mRNA vaccine was needed to prolong the survival of mice with liver cancer. Compared with 1 μg of NID1-mRNA vaccine, 5 μg of vaccine significantly inhibited the growth of liver cancer tumors. In terms of safety, up to 10 μg of NID1-mRNA vaccine had no significant effect on the weight of mice (see Fig. 9The above experiments prove that low-dose NID1-mRNA vaccine can significantly prolong the survival rate of tumor-bearing mice and effectively inhibit tumor growth, while high-dose vaccine still has good safety.

[0083] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A nucleic acid molecule encoding NID1 antigen, characterized in that The nucleotide sequence of the nucleic acid molecule is as shown in (a) or (b): (a) the nucleotide sequence is shown in SEQ ID NO: 1 or SEQ ID NO: 2; (b) A nucleotide sequence derived from (a) having a function of encoding NID1 antigen, wherein the nucleotide sequence in (a) is substituted, deleted or added with at least one nucleotide.

2. The nucleic acid molecule according to claim 1, wherein The nucleic acid molecule includes at least one of DNA, ASO, siRNA, miRNA, mRNA and aptamer.

3. A nucleic acid-liposome complex, characterized in that: The nucleic acid-liposome complex comprises the nucleic acid molecule according to claim 1 or 2, and cationic lipid nanoparticles encapsulating the nucleic acid molecule.

4. The nucleic acid-liposome complex according to claim 3, characterized in that The molar ratio of the cationic lipid nanoparticles to the nucleic acid molecules is (2-10):

1.

5. The nucleic acid-liposome complex according to claim 3, characterized in that: The cationic lipid nanoparticles include the following components in molar percentages: 15-49% cationic lipids, 40-50% structural lipids, 5-20% auxiliary lipids and 1-5% PEGylated lipids.

6. The nucleic acid-liposome complex according to claim 5, characterized in that The structural lipid includes cholesterol or a derivative thereof, the auxiliary lipid includes any one of DSPC, DOPE, DOPG and DOPS, and the PEGylated lipid includes PEG-DMG or PEG-DSPE.

7. The method for preparing the nucleic acid-liposome complex according to claim 5 or 6, characterized in that: The following steps are involved: S1, dissolving the cationic lipid, the structural lipid, the auxiliary lipid and the PEGylated lipid in an organic solvent to obtain an organic phase; S2, dissolving the nucleic acid molecule in a solvent buffer to obtain an aqueous phase; S3, the organic phase and the aqueous phase are fully mixed to obtain a liposome mixed solution encapsulating the nucleic acid molecules, and then the storage buffer is used to replace the solvent buffer in the mixed solution and the solvent in the organic phase to obtain the nucleic acid-liposome complex.

8. The preparation method according to claim 7, characterized in that: The total concentration of cationic lipids, structural lipids, auxiliary lipids and PEGylated lipids in the organic phase is 1-30 mg / mL, the concentration of nucleic acid molecules in the aqueous phase is 0.2-1.5 mg / mL, and the volume ratio of the organic phase to the aqueous phase is 1:(2-6).

9. Use of the nucleic acid molecule according to claim 1 or 2, and / or the nucleic acid-liposome complex according to any one of claims 3 to 6 in the preparation of a drug for preventing or treating malignant tumors.

10. The use according to claim 9, characterized in that The medicine includes vaccines, and the malignant tumors include liver cancer and lung cancer.

Images