Application of PCR (Polymerase Chain Reaction) amplification reagent and kit in multiple digital PCR amplification

Abstract

The invention belongs to the technical field of PCR (Polymerase Chain Reaction) detection, and particularly relates to application of a PCR amplification reagent and a kit in multiplex digital PCR amplification. Wherein the PCR amplification reagent comprises at least one of a hot start Taq DNA polymerase, a Tris buffer solution, KCl, MgCl2, dNTP, betaine, a nonionic surfactant, bovine serum albumin and formamide. The PCR amplification reagent is used for digital PCR amplification and detection reaction, has the advantages of high amplification efficiency, strong specificity and high sensitivity, still keeps stable performance after repeated freezing and thawing, and has good storage and use stability.

Description

Technical Field

[0001] The present application belongs to the field of PCR detection technology. Specifically, the present application relates to the application of PCR amplification reagents and kits in multiplex digital PCR amplification. Background Art

[0002] Digital PCR (dPCR) technology is a technology for absolute quantitative detection of nucleic acid molecules. It can perform accurate absolute quantitative detection without relying on control samples and standard curves. It has better sensitivity, specificity and accuracy than traditional fluorescent quantitative PCR. Its advantages in detecting extremely small amounts of nucleic acid samples, detecting rare mutations in complex backgrounds, identifying small differences in expression, and detecting copy number variations have been widely recognized.

[0003] However, existing digital PCR kits have obvious deficiencies in amplification efficiency, droplet generation, sensitivity and stability. Its amplification efficiency is easily affected by the reagent ratio, resulting in inaccurate test results; during the droplet generation process, due to the imbalance of the oil phase and the water phase ratio, droplet fusion or uneven distribution often occurs, reducing the droplet recognition rate and affecting the accuracy of the Poisson distribution; the sensitivity is limited, and the detection ability of extremely low concentration samples is insufficient, which limits its application in low copy number samples; in addition, the performance of the reaction premix is ​​prone to decline after repeated freezing and thawing or long-term storage, which is manifested as reduced amplification efficiency or increased nonspecific amplification, and poor stability; at the same time, some kits have poor compatibility with multiple fluorescent channels, which is prone to signal interference or inaccurate detection in multi-gene detection. Summary of the invention

[0004] The present application aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, one purpose of the present application is to provide a single-channel multi-gene detection PCR amplification reagent particularly suitable for the Sminer 405 PCR amplification instrument, which has high detection sensitivity and strong specificity in practical applications, and its performance remains stable after repeated freezing and thawing, and has good storage and use stability.

[0005] In one aspect of the present application, the present application proposes a PCR amplification reagent. According to an embodiment of the present application, the PCR amplification reagent includes: hot start Taq DNA polymerase, Tris buffer, KCl, MgCl2, dNTP, betaine, nonionic surfactant, bovine serum albumin, formamide and at least one of dimethyl sulfoxide. In some examples of the present application, the aforementioned PCR amplification reagent is used in digital PCR amplification and detection reactions with high amplification efficiency, strong specificity, high sensitivity, and after repeated freezing and thawing, the performance remains stable, and has good storage and use stability.

[0006] In the second aspect of the present application, the present application proposes a kit. According to an embodiment of the present application, the kit includes: the PCR amplification reagent described in the first aspect of the present application. In some examples of the present application, the aforementioned kit has good stability, high sensitivity, and strong specificity in the PCR amplification reaction, and can be used for single-channel multi-gene digital PCR amplification.

[0007] In the third aspect of the present application, the present application proposes a method for detecting PCR amplification products. According to an embodiment of the present application, the method comprises: mixing at least one nucleic acid to be tested, the PCR amplification reagent, the amplification primer and the fluorescent probe described in the first aspect of the present application; performing multiple digital PCR detection on the mixed treatment product; and obtaining the copy number concentration of the nucleic acid to be tested based on the fluorescent signal. In some examples of the present application, single-channel multi-gene digital PCR amplification and detection can be achieved based on this method.

[0008] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become apparent from the description below, or will be learned through the practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The above and / or additional aspects and advantages of the present application will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0010] Figure 1 A schematic diagram of the ACTB melting curve provided in the examples of the present application;

[0011] Figure 2 A schematic diagram of the GAPDH melting curve provided in the examples of the present application;

[0012] Figure 3 A schematic diagram of the TBP melting curve provided in the examples of the present application;

[0013] Figure 4 A schematic diagram of ACTB amplification efficiency provided in an embodiment of the present application;

[0014] Figure 5 A schematic diagram of the GAPDH amplification efficiency provided in the embodiments of the present application;

[0015] Figure 6 A schematic diagram of TBP amplification efficiency provided in an embodiment of the present application;

[0016] Figure 7 A schematic diagram of the ACTB primer probe concentration gradient provided in the embodiments of the present application;

[0017] Figure 8 A schematic diagram of the concentration gradient of GAPDH primer probe provided in the embodiments of the present application;

[0018] Fig. 9 A schematic diagram of the TBP primer probe concentration gradient provided in the embodiments of the present application;

[0019] Fig.10 Schematic diagram of droplet generation by the reaction premix of the present application provided in the embodiment of the present application; wherein A is the original quality control image; B is the image generated by algorithm recognition;

[0020] Fig.11 A one-dimensional scatter diagram of formula 1 provided in an embodiment of the present application;

[0021] Fig.12 A one-dimensional scatter diagram of formula 2 provided in an embodiment of the present application;

[0022] Fig.13 A one-dimensional scatter diagram of formula 3 provided in an embodiment of the present application;

[0023] Fig.14 A one-dimensional scatter diagram of formula 4 provided in an embodiment of the present application;

[0024] Fig.15 A one-dimensional scatter diagram of formula 5 provided in an embodiment of the present application;

[0025] Fig.16 A one-dimensional scatter diagram of formula 6 provided in an embodiment of the present application;

[0026] Fig.17 A one-dimensional scatter diagram of formula 7 provided in an embodiment of the present application;

[0027] Fig.18 A one-dimensional scatter diagram of formula 8 provided in an embodiment of the present application;

[0028] Fig.19 A one-dimensional scatter diagram of formula 9 provided in an embodiment of the present application;

[0029] Fig. 20 A one-dimensional scatter diagram of formula 10 provided in an embodiment of the present application;

[0030] Fig.21 A sensitivity diagram of the Medcalc statistical analysis of ACTB provided in the embodiment of the present application;

[0031] Fig. 22 A schematic diagram of droplet generation by reaction premix in a purchased digital PCR kit provided in an embodiment of the present application;

[0032] Fig.23 A one-dimensional scatter diagram of the reaction premix in a commercially available digital PCR kit provided in an embodiment of the present application;

[0033] Fig.24A schematic diagram showing the comparison results of copy number detection between a commercially available digital PCR kit provided in an embodiment of the present application and the kit of the present application (same primer and probe template);

[0034] Fig.25 A one-dimensional scatter diagram of a reaction premix (formula 10) provided in an embodiment of the present application that was repeatedly frozen and thawed 0 times;

[0035] Fig.26 A one-dimensional scatter diagram of a reaction premix (formula 10) provided in an embodiment of the present application after five freeze-thaw cycles;

[0036] Fig. 27 A one-dimensional scatter diagram of the reaction premix (formula 10) provided in an embodiment of the present application after repeated freezing and thawing 10 times. DETAILED DESCRIPTION

[0037] The embodiments of the present application are described in detail below. The embodiments described below are exemplary and are only used to explain the present application, and cannot be understood as limiting the present application.

[0038] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of this application, unless otherwise specified, the meaning of "plurality" is two or more.

[0039] In this document, the terms "include" or "comprising" are open expressions, that is, including the contents specified in the present application but not excluding other contents.

[0040] As used herein, the terms "optionally", "optional" or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.

[0041] At present, there are many types of digital PCR detection systems, and the selection of generated oil and droplet stabilizer is different. In order to match the unique amplification mode, unique biochip structure and stable generated oil component of Juexin Bio, in one aspect of this application, this application proposes a PCR amplification reagent. The amplification reagent includes: hot start Taq DNA polymerase, Tris buffer, KCl, MgCl2, dNTP, betaine, non-ionic surfactant, bovine serum albumin, formamide and dimethyl sulfoxide. At least one of the following.

[0042] In some examples of the present application, the aforementioned nonionic surfactant is selected from Triton.

[0043] In some examples of the present application, the concentration of the aforementioned hot start Taq DNA polymerase is selected from 0.15-0.30 U / μl, optionally 0.15 U / μl, 0.2 U / μl, 0.25 U / μl, 0.3 U / μl. In some preferred examples of the present application, the concentration of the aforementioned hot start Taq DNA polymerase is 0.2 U / μl.

[0044] In some examples of the present application, the concentration of the aforementioned Tris buffer is selected from 140-220 mM, optionally 140 mM, 160 mM, 180 mM, 200 mM, 220 mM. In some preferred examples of the present application, the concentration of the aforementioned Tris buffer is 180 mM.

[0045] In some examples of the present application, the concentration of the aforementioned KCl is selected from 50-70 mM, optionally 50 mM, 60 mM, 70 mM. In some preferred examples of the present application, the concentration of the aforementioned KCl is 60 mM.

[0046] In some examples of the present application, the concentration of the aforementioned MgCl2 is selected from 3.6-4.4 mM, optionally 3.6 mM, 3.8 mM, 4 mM, 4.2 mM, 4.4 mM. In some preferred examples of the present application, the concentration of the aforementioned MgCl2 is 4 mM.

[0047] In some examples of the present application, the concentration of the aforementioned dNTP is selected from 0.1-0.4 mM, optionally 0.1 mM, 0.2 mM, 0.3 mM, 0.4 mM. In some preferred examples of the present application, the concentration of the aforementioned dNTP is 0.2 μM.

[0048] In some examples of the present application, the concentration of the aforementioned betaine is selected from 800-1200 mM, optionally 800 mM, 900 mM, 1000 mM, 1100 mM, 1200 mM. In some preferred examples of the present application, the concentration of the aforementioned betaine is 1000 mM.

[0049] In some examples of the present application, the concentration of Triton is selected from 0.3-0.5%, optionally 0.3%, 0.4%, 0.5%. In some preferred examples of the present application, the concentration of Triton is 0.4%.

[0050] In some examples of the present application, the concentration of the bovine serum albumin is selected from 2-4 mg / ml, optionally 2 mg / ml, 2.5 mg / ml, 3 mg / ml, 3.5 mg / ml, 4 mg / ml. In some preferred examples of the present application, the concentration of the bovine serum albumin is 3 mg / ml.

[0051] In some examples of the present application, the concentration of the formamide is selected from 1-3%, optionally 1%, 2% or 3%. In some preferred examples of the present application, the concentration of the formamide is 2%.

[0052] Digital PCR reaction based on the above concentration of PCR reagents can achieve absolute quantification with high precision and accuracy, low detection limit and high amplification efficiency.

[0053] In another aspect of the present application, the present application provides a kit, which includes: the above-mentioned PCR amplification reagent.

[0054] In some examples of the present application, the above-mentioned kit further includes: at least one of: quality control products, amplification primers, fluorescent probes and deionized water.

[0055] It should be noted that the kit of the present application uses sterile highly deionized water with a resistivity of 18.2 MΩ, which is used to completely eliminate the interference of foreign ions on the amplification system.

[0056] Based on the above kit, it has good stability, high specificity and low detection limit in multi-gene digital PCR amplification.

[0057] In another aspect of the present application, the present application proposes a method for detecting PCR amplification products. The method comprises: mixing at least one nucleic acid to be detected, the PCR amplification reagent described in the first aspect of the present application, amplification primers and fluorescent probes; performing multiple digital PCR detection on the mixed product; and obtaining the copy number concentration of the nucleic acid to be detected based on the fluorescent signal.

[0058] In some examples of the present application, the above method is suitable for detecting one or more genes simultaneously. In one example of the present application, the simultaneous detection of three genes is achieved based on the above method.

[0059] In some examples of the present application, the nucleic acid to be detected is selected from ACTB, GAPDH and TBP genes.

[0060] In some examples of the present application, the 5' end of the fluorescent probe in the above method carries a reporter group, and the 3' end of the fluorescent probe in the above method carries a quencher group.

[0061] In some examples of the present application, the aforementioned fluorescent group is selected from at least one of FAM, HEX, ROX, Cy5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye650 and IR Dye 750. In a specific example of the present application, the fluorescent group is selected from FAM, HEX, CY5 and ROX. Among them, an internal reference fluorescent group is included.

[0062] In some examples of the present application, the aforementioned quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA, and Eclipse. In a specific example of the present application, the quenching group is selected from TAMRA and BHQ.

[0063] In some examples of the present application, the aforementioned amplification primers of the ACTB gene have nucleotide sequences as shown in SEQ ID NO: 1-2. The aforementioned fluorescent probe of the ACTB gene has a nucleotide sequence as shown in SEQ ID NO: 3.

[0064] In some examples of the present application, the aforementioned amplification primers for the GAPDH gene have nucleotide sequences as shown in SEQ ID NOs: 4-5. The aforementioned fluorescent probe for the GAPDH gene has a nucleotide sequence as shown in SEQ ID NO: 6.

[0065] In some examples of the present application, the aforementioned TBP gene amplification primers have nucleotide sequences as shown in SEQ ID NOs: 7-8. The aforementioned TBP gene fluorescent probe has a nucleotide sequence as shown in SEQ ID NO:9.

[0066] It should be noted that the above-mentioned amplification primer sequences and fluorescent probe sequences are shown in Table 1.

[0067] Table 1

[0068] ACTB-F GTGCGTGACATTAAGGAGAAGCTG SEQ ID NO:1 ACTB-R GCAGCTCGTAGCTCTTCTCCA SEQ ID NO:2 ACTB-P (ACTB probe) CTACGTCGCCTGGACTTCGA SEQ ID NO:3 GAPDH-F AGAAGTATGACAACAGCCTCAAGATC SEQ ID NO:4 GAPDH-R GTCCTTCCACGATACCAAAGTTG SEQ ID NO:5 GAPDH-P (GAPDH probe) CAGCAATGCCTCCTGCACCA SEQ ID NO:6 TBP-F CATGACCCCCATCACTCCTG SEQ ID NO:7 TBP-R GTCAAGTTTACAACCAAGATTCACTGTG SEQ ID NO:8 TBP-P (TBP probe) CGCCAGCTTCGGAGAGTTCTG SEQ ID NO:9

[0069] It should be noted that in the above-mentioned digital PCR amplification product detection, the primer length is between 18bp-30bp, the TM value is between 60 and 70°C, the probe length is between 25bp-30bp, and each pair of primers has high specificity. There is no interaction between each primer probe, so that the primer probes corresponding to multiple genes can be compatible in a single tube.

[0070] In the above-mentioned digital PCR amplification product detection, a specific fluorescent probe is added at the same time as a pair of primers. When the probe is complete (containing both the fluorescent group and the quenching group), the fluorescent signal emitted by the reporter group is absorbed by the quenching group. During PCR amplification, the 5'-3' exonuclease activity of the Taq enzyme cleaves and degrades the probe, separating the reporter fluorescent group and the quenching fluorescent group to generate a fluorescent signal, that is, each time a DNA chain is amplified, a fluorescent molecule is formed, thereby achieving complete synchronization between the accumulation of the fluorescent signal and the formation of the PCR product.

[0071] In some examples of the present application, the PCR amplification reaction is performed in a PCR amplification reaction system encapsulated in oil-in-water droplets.

[0072] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the amplification primers of the above-mentioned ACTB gene is selected from 0.5-0.9 μM, optionally 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, preferably 0.9 μM.

[0073] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the fluorescent probe of the above-mentioned ACTB gene is selected from 0.2-0.6 μM, optionally 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, preferably 0.6 μM.

[0074] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the amplification primers of the above-mentioned GAPDH gene is selected from 0.5-0.9 μM, optionally 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, preferably 0.9 μM.

[0075] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the fluorescent probe of the above-mentioned GAPDH gene is selected from 0.2-0.6 μM, optionally 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, preferably 0.6 μM.

[0076] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the amplification primer of the above-mentioned TBP gene is selected from 0.5-0.9 μM, optionally 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, preferably 0.9 μM.

[0077] In some examples of the present application, in the above-mentioned PCR amplification reaction system, the concentration of the fluorescent probe of the above-mentioned TBP gene is selected from 0.2-0.6 μM, optionally 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, preferably 0.6 μM.

[0078] In some examples of the present application, the PCR amplification reaction conditions are: denaturation: 95°C, 1 min; amplification: 95°C 30s→61°C 30s, 45 cycles.

[0079] The PCR amplification product detection based on the above method has a low detection limit, high detection accuracy, and is suitable for rapid detection of multiple samples.

[0080] The scheme of the present application will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present application and should not be considered as limiting the scope of the present application. If no specific technology or conditions are indicated in the embodiments, the technology or conditions described in the literature in this area or the product specification are carried out. The reagents used or the instruments that do not indicate the manufacturer are all conventional products that can be obtained commercially.

[0081] Example 1: Optimization of PCR amplification kit

[0082] This example takes the detection of ACTB, GAPDH and TBP genes as an example to optimize the components of the digital PCR amplification kit.

[0083] Primer and probe design: The nucleotide sequences of primers and probes for each gene are shown in Table 1.

[0084] PCR amplifier: Manufacturer: Xi'an Juexin Biotechnology Co., Ltd., Product No.: Sminer 405;

[0085] Fluorescent dyes: FAM, HEX, CY5 and ROX. Among them, FAM represents blue, HEX represents green, CY5 represents red, and ROX is an internal reference dye, representing yellow.

[0086] 1. Optimization of primer and probe specificity and concentration, and amplification procedures

[0087] The primers, probe concentrations, and amplification procedures were optimized using commercially available Sybr Green dye reaction premixes for specificity testing. Figure 1-3Melting curves of ACTB, GAPDH and TBP were shown, and the results showed strong specificity, no dimer and nonspecific amplification. The commonly used qPCR probe method reaction premix available on the market was used, and the equipment used in the optimization process was ABI 7500. The amplification efficiency of three sets of primer probes and templates was tested. The pre-denaturation temperature and time in the amplification program were parameters set according to the performance of the enzyme in the purchased premix, the denaturation time was set according to general experience, and the temperature and time of the annealing and extension steps were parameters set according to the Tm value of the designed primer probe. The commonly used primer probe concentrations of 500nM and 200nM for qPCR were used to test the qPCR amplification efficiency. When the amplification efficiency reached 90%-110%, the primer probe concentration gradient experiment was carried out on the Sminer 405-PM digital PCR platform. The primer and probe concentrations are shown in Table 2, and the amplification efficiency is shown in Figure 4-6 , the amplification efficiency is normal at 90%-110%, and the best is 95%-105%. The amplification efficiencies of the three sets of primer probes are 104.806%, 101.047%, and 104.902%, respectively; the primer probe concentration gradient display diagrams are shown in Figures 7-9, and the results show the relationship between the positive droplet fluorescence value and the primer probe concentration gradient. The five concentration gradients are: primer / probe = 500 / 200nM, 600 / 300nM, 700 / 400nM, 800 / 500nM, 900 / 600nM;

[0088] Table 2

[0089]

[0090]

[0091] 2. Optimization of PCR amplification reagents

[0092] 2.1 The PCR reaction premix and the oil phase of Juexin Bio were tested for droplet generation. Each formula was tested for droplet generation. Since there were not many components with high viscosity in the formula, there was no droplet generation problem in all formulas. The droplet identification display was Fig.10 ,Based on the original quality control image, the algorithm is used for recognition. Each droplet that meets the standard will be recognized by the algorithm and will turn green. The larger the green area, the higher the recognition rate. The parameters for generating droplets are shown in Table 3;

[0093] Table 3

[0094]

[0095] 2.2 In order to improve the sensitivity, stability and amplification efficiency of PCR amplification reagents, the inventors optimized the concentration of each component in the amplification reagents.

[0096] The PCR amplification reagents include: 0.15U / μl-0.3U / μl hot-start Taq DNA polymerase; 140mM-220mM Tris buffer; 50mM-70mM KCL; 3.6mM-4.4mM MgCl2; 0.1μM-0.4μM dNTP; 800mM-1200mM betaine; 0.3%-0.5% Triton; 2.0mg / ml-4.0mg / ml BSA; 1.0%-3.0% formamide; and deionized water.

[0097] The formula and figure numbers in the optimization process are shown in Table 4, and the droplet digital PCR reaction system is shown in Table 5. Figure 11-20 The figure shows the dPCR amplification efficiency of 10 formulations. The clear distinction between positive and negative droplets indicates high amplification efficiency, while the unclear distinction between positive and negative droplets indicates low amplification efficiency.

[0098] Table 4 Recipes and figure numbers during optimization

[0099]

[0100] Table 5 Droplet digital PCR reaction system

[0101] Components Volume in 20μL reaction system (μL) PCR Amplification Reagents (5X) 4 Each primer pair (100 μM) 0.36 Each probe (100 μM) 0.12 Microdroplet stabilizer (10%) 2 ROX Dye (50X) 0.4 template 10

[0102] 2.3 Amplification product detection: After the amplification is completed, the amplification product is placed on a bioanalyzer (manufacturer: Xi'an Juexin Biotechnology Co., Ltd., item number: Sminer 405-PR) for film reading and detection. The film reading parameters are shown in Table 6.

[0103] Table 6

[0104] Fluorescence channels Exposure time (ms) Gain FAM 900 120 HEX 200 1 CY5 900 120 ROX 900 120

[0105] 3. Sensitivity

[0106] The droplet digital PCR reaction system in Table 5 of this application was used, and the primer probe sequences and fluorescent reporter groups corresponding to ACTB in Table 1 were used to perform LOD (sensitivity) detection. 100 copies / μL was diluted 2X until it could not be detected. The results showed that the concentration of 3.125 copies / μL was detectable, and 1.5625 copies / μL was undetectable. The test between 3.125 copies / μL and 1.5625 copies / μL was performed. The diluted sample concentrations were 3.125 copies / μL, 2.34375 copies / μL, 1.5625 copies / μL, 1.171875 copies / μL, and 0.78125 copies / μL, respectively. 24 parallel PCR tests were performed on the droplet digital PCR instrument. The results were analyzed for dose response using Medcalc software, as shown in Fig.21 As shown, each channel can still accurately detect samples as low as 2.34375 copies / μL. The detection rate is calculated as follows: detection rate = (number of detections / number of detections) 100%, where the ACTB 95% confidence sensitivity is 2.12091 copies / μL, and the 95% confidence interval is 1.81303-2.81674 copies / μL.

[0107] 4. Data comparison: Compare the commercially available digital PCR detection kit (manufacturer: BIO-RAD, catalog number: 1864033) with the kit of this application (formula 10).

[0108] 4.1 Replace the reaction premix in the purchased kit with the reaction premix of this application for digital PCR test, and generate a droplet diagram as shown in 22 and a one-dimensional scatter plot as shown in Fig.23 ,The results show that many droplets merge, and the effective droplet recognition rate is low, ,and the Poisson distribution principle cannot be applied.

[0109] 4.2 Compare the copy number results of the kit of this application with the copy number results of the purchased kit detected on its corresponding digital PCR platform. See the comparison chart Fig.24 The results showed that the copy numbers were basically consistent, and the reason for the slight deviation was the sample addition error when preparing different reaction systems.

[0110] 5. Stability

[0111] 5.1 The reaction premix was repeatedly frozen and thawed between -20℃ and room temperature for 0, 5, and 10 times to test whether the amplification efficiency and specificity were reduced. The figure shows a one-dimensional scatter plot. Raindrops can represent reduced amplification efficiency and non-specific amplification. Figure 25-27 The results showed that repeated freezing and thawing 10 times did not affect the performance of the mix, and it had high stability.

[0112] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0113] Although the embodiments of the present application have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limitations on the present application. Ordinary technicians in this field can change, modify, replace and modify the above embodiments within the scope of the present application.

Claims

1. A PCR amplification reagent, characterized in that: include: Hot start Taq DNA polymerase, Tris buffer, KCl, MgCl2, dNTP, betaine, non-ionic surfactant, bovine serum albumin, formamide and at least one of dimethyl sulfoxide.

2. The amplification reagent according to claim 1, characterized in that The nonionic surfactant is selected from Triton; Optionally, the concentration of the hot start Taq DNA polymerase is selected from 0.15-0.3 U / μl; Optionally, the concentration of the Tris buffer is selected from 140-220 mM; Optionally, the concentration of KCl is selected from 50-70 mM; Optionally, the concentration of MgCl2 is selected from 3.6-4.4 mM; Optionally, the concentration of the dNTP is selected from 0.1-0.4 mM; Optionally, the concentration of betaine is selected from 800-1200 mM; Optionally, the concentration of Triton is selected from 0.3-0.5%; Optionally, the concentration of bovine serum albumin is selected from 2-4 mg / ml; Optionally, the concentration of formamide is selected from 1-3%.

3. The amplification reagent according to claim 2, characterized in that The concentration of the hot start Taq DNA polymerase is 0.2U / μl; Optionally, the concentration of the Tris buffer is 180 mM; Optionally, the concentration of KCl is 60 mM; Optionally, the concentration of MgCl2 is 4 mM; Optionally, the concentration of the dNTP is 0.2 μM; Optionally, the concentration of betaine is 1000 mM; Optionally, the concentration of Triton is 0.4%; Optionally, the concentration of bovine serum albumin is 3 mg / ml; Optionally, the concentration of formamide is 2%.

4. A kit, characterized in that: include: The PCR amplification reagent according to any one of claims 1 to 3.

5. The kit according to claim 4, characterized in that Further including: At least one of quality control products, amplification primers, fluorescent probes and deionized water.

6. A method for detecting PCR amplification products, characterized in that: include: Mixing at least one nucleic acid to be tested, the PCR amplification reagent according to any one of claims 1 to 3, amplification primers and a fluorescent probe; Perform multiplex digital PCR detection on the mixed processing products; Based on the fluorescence signal, the copy number concentration of the nucleic acid to be detected is obtained.

7. The method according to claim 6, characterized in that The nucleic acid to be tested is selected from ACTB, GAPDH and TBP genes; Optionally, the 5' end of the fluorescent probe carries a reporter group, and the 3' end of the fluorescent probe carries a quencher group; Optionally, the fluorescent group is selected from at least one of FAM, HEX, ROX, CY5.5, CY5, Atto 425, TET, JOE, VIC, R6G, Yakima Yellow, Quasar570, Quasar670, Cy3, NED, Cy5.5, Cy7, Texas Red, Atto 590, IR Dye650 and IR Dye 750; Optionally, the quenching group is selected from at least one of BHQ1, BHQ2, BHQ3, MGB, BBQ 650, Dabcyl, DBQ1, TAMRA, and Eclipse.

8. The method according to claim 7, characterized in that The amplification primers of the ACTB gene have the nucleotide sequences shown in SEQ ID NO: 1-2; Optionally, the fluorescent probe of the ACTB gene has a nucleotide sequence as shown in SEQ ID NO: 3; Optionally, the amplification primers for the GAPDH gene have nucleotide sequences as shown in SEQ ID NO: 4-5; Optionally, the fluorescent probe of the GAPDH gene has the nucleotide sequence shown in SEQ ID NO: 6; Optionally, the amplification primers for the TBP gene have nucleotide sequences as shown in SEQ ID NOs: 7-8; Optionally, the fluorescent probe of the TBP gene has a nucleotide sequence as shown in SEQ ID NO:

9.

9. The method according to claim 8, characterized in that The PCR amplification reaction is carried out in a PCR amplification reaction system; Optionally, in the PCR amplification reaction system, the concentration of the amplification primers of the ACTB gene is selected from 0.5-0.9 μM, preferably 0.9 μM; Optionally, in the PCR amplification reaction system, the concentration of the fluorescent probe of the ACTB gene is selected from 0.2-0.6 μM, preferably 0.6 μM; Optionally, in the PCR amplification reaction system, the concentration of the amplification primers of the GAPDH gene is selected from 0.5-0.9 μM, preferably 0.9 μM; Optionally, in the PCR amplification reaction system, the concentration of the fluorescent probe of the GAPDH gene is selected from 0.2-0.6 μM, preferably 0.6 μM; Optionally, in the PCR amplification reaction system, the concentration of the amplification primers of the TBP gene is selected from 0.5-0.9 μM, preferably 0.9 μM; Optionally, in the PCR amplification reaction system, the concentration of the fluorescent probe of the TBP gene is selected from 0.2-0.6 μM, preferably 0.6 μM.

10. The method according to any one of claims 6 to 9, characterized in that: The PCR amplification reaction conditions are: Denaturation: 95°C, 1 min; Amplification: 95°C 30 s → 61°C 30 s, 45 cycles.

Images