Application of SLC7A5 as poor prognostic marker of cervical cancer and / or preparation of medicine for preventing and treating cervical cancer

Abstract

The invention provides application of SLC7A5 as a poor prognostic marker of cervical cancer and / or in preparation of drugs for preventing and treating cervical cancer, and belongs to the technical field of biological medicines. The expression of the SLC7A5 in cervical cancer tissues is higher than that of normal cervical tissues, and the high expression of the SLC7A5 in cervical squamous cell carcinoma or cervical adenocarcinoma is closely related to the adverse total survival rate of cervical cancer. The RNA interference technology is utilized to successfully knock down the expression of SLC7A5 in cervical cancer cells, so that the migration and invasion ability of the cervical cancer cells is obviously reduced. Therefore, the SLC7A5 can be developed and screened as a therapeutic target of cervical cancer and applied to preparation of drugs for preventing and treating cervical cancer.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of SLC7A5 as a poor prognosis marker for cervical cancer and / or in the preparation of drugs for preventing and treating cervical cancer. Background Art

[0002] Cervical cancer is one of the three major malignant tumors in women and poses a serious threat to women's health. Early cervical cancer can be cured by radical surgery and adjuvant chemoradiotherapy. There is currently a lack of effective treatments for recurrent and metastatic cervical cancer. The addition of bevacizumab to conventional cisplatin plus paclitaxel chemotherapy can improve the prognosis of cervical cancer patients and extend their survival by 3 months. In addition, a variety of immunotherapies such as anti-CTLA-4 / PD-L1 have also been used to treat cervical cancer. Despite these advances, the effective treatment of recurrent and metastatic cervical cancer remains a daunting challenge. There is an urgent need to provide diagnostic markers for poor prognosis of cervical cancer and to find effective drugs to treat cervical cancer.

[0003] Solute carrier family 7 member 5 (SLC7A5) is a key amino acid transporter that maintains the intracellular amino acid pool and helps cancer cells take up nutrients. So far, there have been no reports on the association of SLC7A5 with the early diagnosis, prognosis, and targeted therapy of cervical cancer. Summary of the invention

[0004] In view of this, the object of the present invention is to provide the use of SLC7A5 as a poor prognosis marker for cervical cancer and / or in the preparation of drugs for preventing and treating cervical cancer.

[0005] The present invention provides the use of SLC7A5 or SLC7A5 combined with NAT10 as a poor prognosis marker for cervical cancer in the preparation of a product for evaluating the prognosis effect of cervical cancer.

[0006] The present invention provides an application of a reagent for detecting the expression level of SLC7A5 or SLC7A5 and NAT10 in preparing a product for evaluating the prognosis of cervical cancer.

[0007] Preferably, the reagent for detecting the expression level of SLC7A5 includes a reagent for detecting the expression level of the SLC7A5 gene and / or a reagent for detecting the expression level of the SLC7A5 protein;

[0008] The reagent for detecting the expression level of the SLC7A5 gene includes qPCR-F with a nucleotide sequence as shown in SEQ ID NO: 1 and qPCR-R with a nucleotide sequence as shown in SEQ ID NO: 2;

[0009] The reagent for detecting the expression level of SLC7A5 protein includes an antibody against SLC7A5 protein.

[0010] The present invention provides an application of SLC7A5 as a drug target in the development, screening or preparation of drugs for preventing and / or treating cervical cancer.

[0011] The present invention provides use of an agent for targeted inhibition of SLC7A5 expression in the preparation of a drug for preventing and / or treating cervical cancer.

[0012] Preferably, the reagents for targeted inhibition of SLC7A5 expression include siRNA, shRNA and sgRNA targeting SLC7A5 and gene derivatives thereof.

[0013] Preferably, the gene-derived products of siRNA, shRNA or sgRNA targeting SLC7A5 include gene editing systems, recombinant expression vectors or recombinant virus strains.

[0014] Preferably, the prevention and / or treatment of cervical cancer includes inhibiting the migration and / or invasion of cervical cancer cells.

[0015] Preferably, the SLC7A5 comprises a SLC7A5 gene and / or a SLC7A5 protein;

[0016] The nucleotide sequence of the SLC7A5 gene is shown in SEQ ID NO: 3;

[0017] The amino acid sequence of the SLC7A5 protein is shown in SEQ ID NO:4.

[0018] Preferably, the cervical cancer includes cervical squamous cell carcinoma and / or cervical adenocarcinoma.

[0019] The present invention provides the application of SLC7A5 as a poor prognosis marker for cervical cancer in the preparation of a product for evaluating the prognosis of cervical cancer. The present invention analyzes the relationship between the expression level of SLC7A5 and the patient's survival in cervical squamous cell carcinoma and cervical adenocarcinoma (CESC) through the TCGA database. SLC7A5 is highly expressed in cervical cancer tissues than in normal cervical tissues, and whether in cervical squamous cell carcinoma or cervical adenocarcinoma, SLC7A5 high expression is closely related to its poor overall survival rate. At the same time, high expression of SLC7A5 is closely related to the poor prognosis of cervical cancer. According to bioinformatics analysis, whether it is a patient with cervical adenocarcinoma or a patient with cervical squamous cell carcinoma, the patient with high expression of SLC7A5 mRNA has a worse overall survival than the patient with low expression. It can be seen that the SLC7A5 can be used as a poor prognosis marker for cervical cancer in the preparation of a product for evaluating the prognosis of cervical cancer.

[0020] The present invention provides an application of a reagent for targeted inhibition of SLC7A5 expression in the preparation of a drug for preventing and / or treating cervical cancer. The present invention uses a reagent that specifically targets the SLC7A5 gene to knock out the expression of the SLC7A5 gene in cervical cancer cells. When the expression of SLC7A5 is knocked down, the scratch healing ability of cervical cancer cells is significantly reduced, indicating that the migration and invasion ability of cervical cancer cells are significantly reduced. SLC7A5 may be a potential therapeutic target for cervical cancer. The present invention provides a new idea for the development of drugs for preventing and / or treating cervical cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The results show that high expression of SLC7A5 is closely related to poor prognosis of cervical cancer, among which (A) shows the result of overexpression of SLC7A5 mRNA in cervical cancer compared with normal cervical tissue; (B) shows the result of correlation between overexpression of SLC7A5 mRNA and low OS of cervical cancer; (C) shows the result of correlation between high expression of SLC7A5 mRNA and low OS of cervical squamous cell carcinoma; (D) shows the result of correlation between overexpression of SLC7A5 mRNA and low OS of cervical adenocarcinoma; Note: OS, overall survival; NAT10, n-acetyltransferase 10; SLC7A5, solute carrier family 7 member 5; TCGA-CESC, The Cancer Genome Atlas Cervical Squamous Cell Carcinoma and Adenocarcinoma;

[0022] Figure 2 The results show that high expression of SLC7A5 and NAT10 is closely related to poor prognosis of cervical cancer, among which (A) is the OS comparison result between patients with high expression of NAT10 and SLC7A5 mRNA and those with low expression based on bioinformatics analysis; (B) is the OS comparison result between patients with high expression of NAT10 and SLC7A5 mRNA and those with low expression based on bioinformatics analysis; (C) is the OS comparison result between patients with high expression of NAT10 and SLC7A5 mRNA and those with low expression based on bioinformatics analysis;

[0023] Figure 3 The results of the abundance differences of 10 immune cell types enriched in the TCGA-CESC dataset based on the quanTIseq algorithm; the blue group represents the "low NAT10, low SLC7A5" group, and the red group represents the "high NAT10, high SLC7A5" group; the horizontal axis represents the 10 immune cell types, and the vertical axis represents the abundance of immune cell infiltration; Note: OS, overall survival; NAT10, n-acetyltransferase 10; SLC7A5, solute carrier family 7 member 5; TCGA-CESC, The Cancer Genome Atlas Cervical Squamous Cell Carcinoma and Adenocarcinoma;

[0024] Figure 4The results of the effects of knocking down SLC7A5 on the invasion and migration ability of cervical cancer cells, where (A) is the result of verifying the knockdown level of SLC7A5 mRNA in SiHa cells by qPCR (n=3); (B) is the result of Western blot detection of the knockdown efficiency of SLC7A5 in SiHa cells; (C) is the scratch healing result of SiHa cells with knockdown of SLC7A5 expression (n=3, scale bar=200mm); (D) is the migration and invasion ability of SiHa cells after knocking down SLC7A5 (n=3, scale bar=200mm); qPCR means quantitative PCR; Note: *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. DETAILED DESCRIPTION

[0025] The present invention provides the use of SLC7A5 as a poor prognosis marker for cervical cancer in the preparation of a product for evaluating the prognosis effect of cervical cancer.

[0026]

[0027] In the present invention, the expression level of the SLC7A5 gene or protein is correlated with the overall survival rate of cervical cancer patients. The cervical cancer preferably includes cervical squamous cell carcinoma and / or cervical adenocarcinoma. In one embodiment of the present invention, compared with normal cervical tissue, the expression of SLC7A5 in cervical cancer tissue is upregulated and closely correlated with the poor overall survival rate of cervical cancer. Whether in cervical squamous cell carcinoma or cervical adenocarcinoma, SLC7A5 overexpression is associated with low overall survival rate.

[0028] The present invention also provides the use of SLC7A5 combined with NAT10 as poor prognosis markers for cervical cancer in the preparation of a product for evaluating the prognosis effect of cervical cancer.

[0029] In the present invention, the overexpression of both SLC7A5 and NAT10 is associated with the overall survival rate of cervical cancer patients. In another embodiment of the present invention, when both NAT10 and SLC7A5 are highly expressed, the overall survival rate of cervical cancer patients is the lowest compared to when they are low expressed, and this phenomenon exists in both cervical adenocarcinoma and squamous cell carcinoma. NAT10 and SLC7A5 double positivity indicates a poor prognosis for cervical cancer.

[0030] In the present invention, the product includes a product capable of detecting the expression level of the SLC7A5 gene or protein, preferably including at least one of the following: a reagent, a kit, a detection system and a detection device.

[0031] The present invention provides an application of a reagent for detecting the expression level of SLC7A5 in preparing a product for evaluating the prognosis of cervical cancer.

[0032] In the present invention, the reagent refers to a reagent capable of detecting the transcription level and protein level of the SLC7A5 gene. The reagent for detecting the expression level of SLC7A5 preferably includes a reagent for detecting the expression level of the SLC7A5 gene and / or a reagent for detecting the expression level of the SLC7A5 protein. The reagent for detecting the expression level of the SLC7A5 gene includes a qPCR-F having a nucleotide sequence such as SEQ ID NO:1 (CCGTGAACTGCTACAGCGT) and a qPCR-R having a nucleotide sequence such as SEQ ID NO:2 (CTTCCCGATCTGGACGAAGC). The reagent for detecting the expression level of the SLC7A5 protein preferably includes an antibody against the SLC7A5 protein. The antibody preferably refers to an antibody capable of binding to the SLC7A5 protein through antigen-antibody specific affinity. The product includes reagents, kits, detection systems, detection devices, and the like.

[0033] In the present invention, the method for evaluating the prognosis of cervical cancer preferably includes using the reagent to detect the expression level of the SLC7A5 gene or protein. Compared with the healthy control group, when the expression of the SLC7A5 gene or protein is upregulated, the prognosis of cervical cancer patients is poor, and it is necessary to continue the treatment of cervical cancer as soon as possible; when the expression of the SLC7A5 gene or protein is downregulated compared with before treatment, and there is no significant difference compared with the healthy control group, the prognosis of cervical cancer patients is good.

[0034] Considering that knocking out the expression of SLC7A5 is beneficial to inhibiting the migration and invasion of cervical cancer, the present invention provides a use of SLC7A5 as a drug target in the development, screening or preparation of drugs for preventing and / or treating cervical cancer.

[0035] In the present invention, the drug target refers to a specific molecule or cell structure on which the drug acts when it exerts its pharmacological effect in vivo. In one embodiment of the present invention, knocking down the expression of SLC7A5 in cervical cancer cells by RNA interference technology can effectively inhibit the migration and invasion of cervical cancer cells, so the SLC7A5 can be used as a drug target for the development and screening of cervical cancer drugs.

[0036] The present invention provides use of an agent for targeted inhibition of SLC7A5 expression in the preparation of a drug for preventing and / or treating cervical cancer.

[0037] In the present invention, the SLC7A5 preferably includes the SLC7A5 gene and / or the SLC7A5 protein. The nucleotide sequence of the SLC7A5 gene is shown in SEQ ID NO: 3. The amino acid sequence of the SLC7A5 protein is shown in SEQ ID NO: 4.

[0038] In the present invention, the reagents for targeted inhibition of SLC7A5 expression preferably include siRNA, shRNA and sgRNA targeting SLC7A5 and their gene derivatives. Gene derivatives of siRNA, shRNA or sgRNA targeting SLC7A5 preferably include gene editing systems, recombinant expression vectors or recombinant virus strains. The gene editing system refers to a technology that can perform site-specific "editing" of the target gene to achieve modification of a specific DNA fragment, such as the CRISPR / Cas system. The recombinant expression vector refers to an expression plasmid cloned with the reagent. The recombinant virus strain refers to a virus strain that can enter the human or animal body under virus-mediated and stably express the target gene to exert the expected biological effect.

[0039] In the present invention, the prevention and / or treatment of cervical cancer preferably includes inhibiting the migration and / or invasion of cervical cancer cells. The cervical cancer preferably includes cervical squamous cell carcinoma and / or cervical adenocarcinoma.

[0040] In one embodiment of the present invention, RNA interference technology was used to successfully knock down the expression of SLC7A5 in Siha cells, which significantly reduced the scratch healing ability of cervical cancer cells. At the same time, the migration and invasion abilities of cervical cancer cells were significantly reduced. It can be seen that agents that target and inhibit the expression of SLC7A5 can be used as active ingredients of drugs to prevent and / or treat cervical cancer.

[0041] The following is a detailed description of the use of SLC7A5 provided by the present invention as a poor prognosis marker for cervical cancer and / or in the preparation of drugs for preventing and treating cervical cancer, in conjunction with the examples. However, they should not be construed as limiting the scope of protection of the present invention.

[0042] Example 1

[0043] Screening and analysis of a poor prognostic marker for cervical cancer

[0044] Materials and Methods

[0045] Bioinformatics Analysis

[0046] Public gene expression data and complete clinical data of cervical squamous cell carcinoma and cervical adenocarcinoma (CESC) were retrieved from The Cancer Genome Atlas (TCGA) (https: / / portal.gdc.cancer.gov / ). A total of 297 patients with cervical cancer were included in this study, including 245 cases of cervical squamous cell carcinoma, 48 cases of cervical adenocarcinoma, and 4 cases of other pathological types. The baseline data are shown in Table 1.

[0047] Table 1 Baseline data

[0048]

[0049] The transcripts per million (TPM) format was log2 transformed and processed for analysis using R version 4.2.2 (Lucent Technologies, State of New Jersey, US). The expression levels of NAT10 and SLC7A5 mRNA were divided into "high" and "low" groups using the "surv_categorize" function of the R package "survminer" (v0.4.9). Survival analysis of CESC patients was performed using tumor expression data from "survminer" and the R package "Survival" (v3.4.0), with the ordinate representing the survival rate and the abscissa representing the survival time. The p value was corrected for multiple tests using the Benjamini-Hochberg method.

[0050] result

[0051] According to the TCGA database, SLC7A5 is more highly expressed in cervical cancer tissues than in normal cervical tissues ( Figure 1 (A)) and is closely associated with poor overall survival in cervical cancer ( Figure 1 In both cervical squamous cell carcinoma and cervical adenocarcinoma, high expression of SLC7A5 is closely associated with poor overall survival ( Figure 1 (C) and (D)).

[0052] In addition, the analysis results also showed that when both NAT10 and SLC7A5 were highly expressed, the overall survival rate of cervical cancer patients was the lowest ( Figure 2 This phenomenon is found in both cervical adenocarcinoma and squamous cell carcinoma ( Figure 2 (B) and (C)). NAT10 and SLC7A5 double positivity indicates poor prognosis in cervical cancer. Samples with high expression of NAT10 and SLC7A5 have higher infiltration of M2 macrophages and lower infiltration of M1 macrophages ( Figure 3 ), the carcinogenic effects of NAT10 and SLC7A5 may be related to the immune microenvironment of the tumor.

[0053] Example 2

[0054] 1. Cell Culture and Reagents

[0055] Human cervical SiHa cells were purchased from Procell Company (Wuhan, China). The above cell lines were cultured in modified DMEM medium (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS; Procell, Wuhan, China) and 5% CO2.

[0056] 2. Cell Transfection and RNA Interference

[0057] Lipofectamine 3000 (Invitrogen, USA) was used to knock down the expression of SLC7A5 gene in Siha cells. The siRNA was ACATTGTGCTGGCATTATA.

[0058] Take SiHa cells in the logarithmic growth phase, digest them and plate them on a six-well plate. After 24 hours of plating, observe the cell confluence of about 50% to 75%, discard the original culture medium, rinse once with PBS, and add serum-free culture medium. Prepare the transfection complex, take an EP tube and add 125μl opti-MEN culture medium (Gibco, Grand Island, NY, USA) to dilute 5μl lipo3000, add 125μl opti-MEN culture medium and 5μl siRNA to another EP tube, mix well and incubate at room temperature for 5min, mix the contents of the AB tube, gently mix and incubate at room temperature for 15min, then add to the cells, gently mix and place in a cell culture incubator for continued culture, and replace with complete culture medium 24h after transfection. Extract RNA or protein 48-72h after transfection to verify the knockout efficiency.

[0059] 3. Cell Migration and Cell Invasion Assay

[0060] Wound healing was used to assess cell migration. Briefly, the monolayer was scratched with a pipette tip, and the wound width was captured at 0, 24 h, and 48 h using a Leica DMC4500 microscope (Leica, Wetzlar, Germany). Migration distance was analyzed using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

[0061] Transwell assays were performed using 8 μm chambers (Falcon, Corning, NY, USA). 4 The cells were suspended in a medium containing 2% FBS and loaded into the upper chamber. The lower chamber was filled with DMEM containing 20% ​​FBS. In the invasion assay, 50 μL of diluted Matrigel (BD Biosciences, Franklin Lakes, NJ, USA) was applied to the upper layer of each chamber. After 48 h of culture, the non-migrated cells on the inner surface of the upper layer of the chamber were wiped off with a cotton swab. The chamber was fixed with 4% paraformaldehyde and stained with 0.1% methylene blue for 30 min. Images were collected and analyzed using ImageJ software. A total of three independent experiments were performed.

[0062] 4. Western Blot Analysis

[0063] Total cell protein was extracted and subjected to sodium dodecyl polyacrylamide gel electrophoresis (SDS-PAGE) (EpiZyme, Cambridge, MA, USA), and then electrophoretically transferred to polyvinylidene fluoride (PVDF) membrane (Millipore Sigma, Burlington, MA, USA). Then, the PVDF membrane was blocked with rapid blocking solution (NCM Biotechnology, Suzhou, China), cut according to the predicted molecular weight, and incubated with SLC7A5 polyclonal antibody (1:1000, 28670-1-AP; Proteintech, Chicago, IL, USA) and Tubulin polyclonal antibody (1:30000, AP0064; Bioworld, Irving, TX, USA) at 4°C overnight. Horseradish peroxidase (HRP)-goat anti-rabbit antibody (1:5000, AP0063, Bioworld) or horseradish peroxidase-conjugated anti-mouse secondary antibody (1:5000, SA00001-1, Proteintech) was incubated at room temperature for 2 h. Immunoblot analysis was performed using the Tanon 5200 Multi-Intelligent Imaging System (ChampChemi 610, Beijing Saijing Technology Co., Ltd.).

[0064] 5.qRT-PCR

[0065] Total RNA was extracted using TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA) and reverse transcribed into cDNA. Then, qPCR was performed using SYBR Premix Ex Taq (Yeasen Biotech) with cDNA as template according to the manufacturer's instructions. The qPCR reaction system (Biological, Hunan, China) is shown in Table 2:

[0066] Table 2 qPCR reaction system

[0067] Component name Final reaction concentration Addition volume (μl) 2XSYBRGreenProTaqHSPremix(ROXplus)* 1X 10 template <100ng 2 Forward primer (10 μM) 0.2μM* 0.4 Reverse primer (10 μM) 0.2μM 0.4 RNase-free water - Refill to 20

[0068] The qPCR reaction program is shown in Table 3:

[0069] Table 3 qPCR reaction procedure

[0070]

[0071] The qPCR detection primers for SLC7A5 are as follows:

[0072] SLC7A5-F: CCGTGAACTGCTACAGCGT (SEQ ID NO: 1);

[0073] SLC7A5-R: CTTCCCGATCTGGACGAAGC (SEQ ID NO: 2).

[0074] All data were analyzed using GAPDH expression as an internal reference gene.

[0075] GAPDH-F: GGACGAGATCCCTCCAAAAT (SEQ ID NO: 5);

[0076] GAPDH-R: GGCTGTTGTCATACTTCTCATGG (SEQ ID NO: 6).

[0077] Adoption 2 -△△Ct The specific calculation steps are as follows:

[0078] (1) First calculate the ΔCt of all samples: target gene Ct - reference gene Ct.

[0079] (2) Calculate the mean ΔCt of the control group: use the AVERAGE function.

[0080] (3) Calculate the ΔΔCt of all samples: ΔCt of a single sample minus the mean ΔCt of the control group.

[0081] (4) Calculate the fold difference in expression level 2 -ΔΔCt .

[0082] result

[0083] RNA interference technology was used to successfully knock down the expression of SLC7A5 gene and its encoded protein in Siha cells ( Figure 4 Further cell experiment results showed that knocking down SLC7A5 expression significantly reduced the scratch healing ability of cervical cancer cells ( Figure 4 At the same time, the migration and invasion abilities of cervical cancer cells were significantly reduced ( Figure 4 The above results indicate that SLC7A5 can be used as a potential therapeutic target for cervical cancer to develop and screen drugs for cervical cancer.

[0084] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of SLC7A5 or SLC7A5 combined with NAT10 as adverse prognostic markers for cervical cancer in the preparation of products for evaluating the prognosis of cervical cancer.

2. Use of a reagent for detecting the expression level of SLC7A5 or SLC7A5 and NAT10 in the preparation of a product for evaluating the prognosis of cervical cancer.

3. The application according to claim 2, characterized in that: The reagent for detecting the expression level of SLC7A5 includes a reagent for detecting the expression level of the SLC7A5 gene and / or a reagent for detecting the expression level of the SLC7A5 protein; The reagent for detecting the expression level of the SLC7A5 gene includes qPCR-F with a nucleotide sequence as shown in SEQ ID NO: 1 and qPCR-R with a nucleotide sequence as shown in SEQ ID NO: 2; The reagent for detecting the expression level of SLC7A5 protein includes an antibody against SLC7A5 protein.

4. A use of SLC7A5 as a drug target in the development, screening or preparation of drugs for preventing and / or treating cervical cancer.

5. Use of an agent for targeted inhibition of SLC7A5 expression in the preparation of a drug for preventing and / or treating cervical cancer.

6. The use according to claim 5, characterized in that: The reagents for targeted inhibition of SLC7A5 expression include siRNA, shRNA and sgRNA targeting SLC7A5 and gene derivatives thereof.

7. The use according to claim 6, characterized in that: Gene-derived products of siRNA, shRNA or sgRNA targeting SLC7A5 include gene editing systems, recombinant expression vectors or recombinant virus strains.

8. The use according to claim 5, characterized in that: The prevention and / or treatment of cervical cancer includes inhibiting the migration and / or invasion of cervical cancer cells.

9. The use according to any one of claims 1, 2, 4 and 5, characterized in that: The SLC7A5 includes the SLC7A5 gene and / or the SLC7A5 protein; The nucleotide sequence of the SLC7A5 gene is shown in SEQ ID NO:4; The amino acid sequence of the SLC7A5 protein is shown in SEQ ID NO:

5.

10. The use according to any one of claims 1 to 8, characterized in that: The cervical cancer includes cervical squamous cell carcinoma and / or cervical adenocarcinoma.

Images