SgRNA combination for efficiently targeting sheep P53 gene and application of sgRNA combination

Abstract

The invention relates to an sgRNA combination for efficiently targeting a sheep P53 gene and application of the sgRNA combination in the field of variation or genetic engineering. The invention provides application of a substance for regulating and controlling activity or content of P53 in preparation of a product for improving cell mutation efficiency. Wherein the nucleotide sequence of the P53 coding gene is Gene ID: 443421, and the update date is March 5, 2024; the substance for regulating and controlling the activity or content of P53 is a molecule containing SEQ ID No: 3 or / and SEQ ID No: 4, the sheep cell mutation efficiency can be improved by targeting a P53 coding gene, and the method can be applied to construction of a cell model.

Description

Technical Field

[0001] The present invention relates to a highly efficient targeted sheep in the field of mutation or genetic engineering P53 sgRNA combinations of genes and their applications. Background Art

[0002] The CRISPR / Cas9 system is a genome-directed editing technology developed in recent years. The system consists of Cas9 endonuclease, CRISPR RNA (crRNA, the same sequence as the genomic target site) and trans-activating CRISPR RNA (tracrRNA). CrRNA and tracrRNA can be fused and simplified into single-stranded guide RNA (sgRNA). Under the guidance of sgRNA, the Cas9 protein can scan the PAM sequence (5'-NGG-3') in the genome, identify and cut the DNA single strands that are identical and complementary to the crRNA sequence, thereby inducing DNA double-strand breaks at the target site and activating the cell's non-homologous end joining (NHEJ) and homology repair (HDR) repair mechanisms to achieve precise editing of the target gene. The CRISPR / Cas9 system is easy to operate and highly efficient, and is widely used in research in biology, medicine, and agriculture. In large animals, the main uses of the CRISPR / Cas9 system include creating large animal models of human diseases, improving production traits, breeding for disease resistance, and preparing large animal bioreactors.

[0003] P53 is an important transcription factor and is recognized as a "genome guardian" of cells. P53 regulates the transcription of many target genes and coordinates multiple signaling pathways. Its classical functions include inducing cell apoptosis, controlling cell cycle progression, and promoting DNA damage repair. In addition, P53 also plays important non-classical functions in tissue regeneration and cell proliferation induced by apoptosis, coordinated growth, cell senescence, cell competition, cell autophagy, and adaptive responses to nutritional stress at the organism level. P53 It is also an important tumor suppressor gene that inhibits the transformation of normal cells into cancer cells. More than 50% of all human cancers will have mutations in this gene, and this proportion can reach more than 80% in human malignant tumors. It is the gene with the highest correlation with human tumors discovered so far.

[0004] Created based on the CRISPR / Cas9 system P53 Mutant gene editing cell models and animal models are powerful tools for basic and clinical research on cancer. Academician Zhou Qi's team at the Institute of Zoology, Chinese Academy of Sciences, conducted a study on macaques. P53Six sgRNAs were designed for the gene, and the T7EI test results showed P53 The gene editing efficiency is 17-34%; Professor Wei Hongjiang's team from Yunnan Agricultural University targeted the southern Yunnan small-eared pig P53 The corresponding sgRNAs were designed for the 4th and 5th exons of the gene, P53 The gene editing efficiencies were 61.9% and 50%, respectively. Takeshige Otoi's team at Tokushima University in Japan targeted pigs P53 Two sgRNAs were designed for the 3rd and 4th exons of the gene, and 6 of the 9 offspring obtained carried P53 mutation, and the gene editing efficiency is 66.7%. From the above examples, we can see that with the continuous maturity and improvement of CRISPR gene editing technology, P53 The efficiency of gene editing is also gradually improving. However, considering the long creation cycle and high cost of gene editing large animals, further screening for more efficient gene targeting is necessary. P53 sgRNA is prepared more quickly, efficiently and at a lower cost P53 Gene mutation human large animal cancer models still have important research value. Summary of the invention

[0005] The main problem to be solved by the present invention is how to improve P53 Gene editing efficiency.

[0006] In order to solve the above problems, the present invention provides an application of a substance for regulating the activity or content of P53.

[0007] The present invention provides the use of a substance for regulating the activity or content of P53 in the preparation of a product for improving the efficiency of cell mutation; P53 The nucleotide sequence of the encoding gene is Gene ID: 443421, updated on March 5, 2024; the product is an RNA molecule containing SEQ ID No: 3 and / or SEQ ID No: 4.

[0008] In the above application, the regulation of P53 activity or content may be down-regulation, inhibition or reduction of P53 activity or content.

[0009] In the above application, the substance for regulating the activity or content of P53 may be any of the following substances: g1) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 3; g2) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 4; g3) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6; g4) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 7 and SEQ ID No: 8.

[0010] In the above application, the improving the cell mutation efficiency may be improving the sheep cell mutation efficiency.

[0011] In the above application, the performance of improving cell mutation efficiency can be any of the following: B1) Improve the level of monoclonal cells P53 Gene mutation efficiency; B2) Improve the efficiency of biallelic homozygous mutation.

[0012] The single-stranded RNA molecules described above also fall within the scope of protection claimed by the present invention.

[0013] The present invention also provides a product for improving cell mutation efficiency, and the product may be any of the following: g1) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 3; g2) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 4; g3) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6; g4) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 7 and SEQ ID No: 8.

[0014] The present invention also provides a biomaterial, which may be any of the following: 1) a recombinant vector containing the single-stranded RNA molecule described above; 2) a recombinant microorganism containing the recombinant vector described in 1); 3) a recombinant cell containing the recombinant vector described in 1); 4) an animal cell line containing the recombinant vector described in 1); 5) Animal tissue containing the recombinant vector described in 1); 6) Animal organs containing the recombinant vector described in 1).

[0015] In a specific embodiment, the recombinant vector may be recombinant plasmids pX458-P53 sgRNA1 and pX458-P53 sgRNA2.

[0016] The structure of the recombinant plasmid pX458-P53 sgRNA1 is described as follows: the fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector is replaced with the Mix1 sticky end sequence formed by annealing SEQ ID No: 5 and SEQ ID No: 6, and the other sequences of the pX458 vector are kept unchanged to obtain a recombinant vector, which is named recombinant plasmid pX458-P53 sgRNA1.

[0017] pX458-P53 sgRNA1 contains a sgRNA1 gene expression cassette having a nucleotide sequence of 5′-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGACCTGCCCAGTGCAGCTATgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt-3′ (SEQ ID No: 9). As shown in the 251st to 346th nucleotides of No. 9, the 1st to 241st nucleotides are the promoter for initiating the transcription of the sgRNA1 gene, and the 347th to 352nd nucleotides are the termination sequence for terminating the transcription of the sgRNA1 gene.

[0018] The structure of the recombinant plasmid pX458-P53 sgRNA2 is described as follows: the fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector is replaced with the Mix2 sticky end sequence formed by annealing SEQ ID No: 7 and SEQ ID No: 8, and the other sequences of the pX458 vector are kept unchanged to obtain a recombinant vector, which is named recombinant plasmid pX458-P53 sgRNA2.

[0019] pX458-P53 sgRNA2 contains a sgRNA2 gene expression cassette having a nucleotide sequence of 5′-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAAGCTGGAGCACATGACGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt-3′ (SEQ ID No: 10). The sgRNA2 gene is as shown in SEQ ID No: 11 . As shown in the 251st to 346th nucleotides of No. 10, the 1st to 241st nucleotides are the promoter for initiating the transcription of the sgRNA2 gene, and the 347th to 352nd nucleotides are the termination sequence for terminating the transcription of the sgRNA2 gene.

[0020] The present invention also provides the use of the above-mentioned biomaterial in improving the efficiency of cell mutation.

[0021] In the aforementioned biological material or application, the cells may be monoclonal cells.

[0022] Furthermore, the cells may be sheep fetal fibroblasts.

[0023] The purpose of the present invention is to provide a highly efficient sheep targeting P53 Gene sgRNA combination and its application to solve the current large animal P53 The problem of insufficient gene editing efficiency is P53 Provide technical support for the efficient creation of gene-edited sheep (human large animal cancer model). BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 For Sheep P53 Schematic diagram of gene structure and sgRNA target sites. sgRNA target site 1 (sgRNA1) is located at P53 Gene( P53The nucleotide sequence of the gene is Gene ID: 443421, updated on March 5, 2024) at positions 9252-9271, and the sgRNA target 2 (sgRNA2) is located at P53 Positions 9327-9346 of the gene.

[0025] Figure 2 Sheep monoclonal cell level P53 Gene mutation efficiency statistics table.

[0026] Figure 3 The figure shows the PCR gel electrophoresis of 27 monoclonal clones identified by PCR using primer set PCR-F: 5'-tgtacattcgacccttgggtact-3', PCR-R: 5'-ccaccgctcaccatcgctatagt-3'. + / + indicates wild type, - / - indicates biallelic homozygous mutation, and l / l indicates at least one allele mutation.

[0027] Figure 4 for P53 Representative sequencing results of biallelic homozygous mutations and at least one allele mutation. A is the sequencing of 15 homozygous mutations and the corresponding base deletion types (the 15 mutation types are completely consistent); B is a representative sequencing result selected from 11 monoallelic mutations or biallelic mutations (double peaks represent mutations, and all 11 sequencing results are double peaks). DETAILED DESCRIPTION

[0028] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0029] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0030] The sheep primary fetal fibroblasts in the following examples have been described in: Han Hongbing, MAYonghe, Wang Tao, Lian Ling, Tian Xiuzhi, HU Rui, Deng Shoulong, LI Kongpan, Wang Feng, LI Ning, Liu Guoshi, Zhao Yaofeng and Lian Zhengxing, One-Step Generation of Myostatin Gene Knockout Sheep Via the CRISPR / Cas9 System, Frontiers of Agricultural Science and Engineering, 2014, 1(1): 2. The public can obtain the biological material from the applicant, and the biological material is only used for repeating the experiments of the present invention and cannot be used for other purposes.

[0031] Example 1. Screening and application of sgRNA for P53 gene editing 1. Design P53- crRNA1 and P53- crRNA2 Log in to the NCBI database (www.ncbi.nlm.nih.gov), search and download sheep P53 Gene sequence (GeneID: 443421). Sheep P53 The gene is 12903 bp in length and consists of 11 exons and 10 introns ( Figure 1 ). According to the sgRNA design principles such as "the length is generally 20nt; the GC content is preferably between 40-60%, and it should not end with more than 4 Ts; if a U6 promoter-driven sgRNA expression vector is constructed, the 5' base of the sgRNA should be considered to be G or GG to improve its transcription efficiency; it should be designed on an independent exon and as close to the N-terminal position of the protein as possible", P53Gene exon 5 (CDS-4), two crRNAs were artificially designed, crRNA1 and crRNA2 were both 20 nt in length, with a GC content of 60%, and the specific sequences were crRNA1: 5'-GACCUGCCCAGUGCAGCUAU-3' (SEQ ID No: 1), crRNA1 corresponding target sequence: 5'-GACCTGCCCAGTGCAGCTAT-3', crRNA2: 5'-GAAGCUGGAGCACAUGACGG-3' (SEQ ID No: 2), crRNA2 corresponding target sequence: 5'-GAAGCUGGAGCACAUGACGG-3' ( Figure 1 ).

[0032] Based on the above two crRNA sequences, two sgRNA sequences were designed. The sgRNA sequence consists of 20nt crRNA (variable sequence) and 76nt tracrRNA (fixed sequence). The sequence information of sgRNA1 and sgRNA2 is as follows: P53 sgRNA1: 5'-GACCUGCCCAGUGCAGCUAUguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3' (SEQ ID No: 3) P53 sgRNA2: 5'-GAAGCUGGAGCACAUGACGGguuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugc-3' (SEQ ID No: 4) 2. Construction of pX458-sgRNA1 and pX458-sgRNA2 plasmids The two pairs of primers required for constructing pX458-sgRNA1 and pX458-sgRNA2 plasmids were sent to Qingke Biosynthesis. The specific experimental steps are as follows: The synthetic primers for crRNA1 are as follows: crRNA1-F: 5'-caccg GACCTGCCCAGTGCAGCTAT -3' (SEQ ID No: 5); crRNA1-R: 5'-aaacatagctgcactgggcaggtcc-3' (SEQ ID No: 6); The synthetic primers for crRNA2 are as follows: crRNA2-F: 5'-caccg gaagctggagcacatgacgG-3' (SEQ ID No:7); crRNA2-R: 5'-aaacccgtcatgtgctccagcttcc-3' (SEQ ID No: 8).

[0033] After the above oligos were synthesized, the two pairs of primers crRNA1-F / crRNA1-R and crRNA2-F / crRNA2-R were first phosphorylated, and the 10 μL system was: 1 μL upstream primer (100 μM), 1 μL downstream primer (100 μM), 1 μL T4 ligation buffer (10×), 1 μL T4 PNK, 6 μL ddH2O. Then annealing was performed: 37°C for 30 min, and then the temperature was reduced from 95°C to 25°C at a rate of 5°C / min to obtain annealing Mix1 and annealing Mix2.

[0034] Subsequently, the commercial pX458 empty plasmid (Addgene plasmid #48138) was digested with BbsI, and after gel purification and recovery, annealing Mix1 or annealing Mix2 and the pX458 linear plasmid recovered after gel excision were ligated using T4 ligase. The ligation conditions were as follows: 1 μL annealing Mix1 or annealing Mix2, 1 μL pX458 digestion product, 1 μL T4 ligation buffer (10×), 1 μL T4 ligation, 6 μL ddH2O, and ligation in a 16°C metal bath overnight.

[0035] Finally, the two ligation products were transformed using DH5α competent cells. After 12 hours of plating, single clones were picked and plasmids were extracted and sent to the company for sequencing to verify whether the connection was correct. Recombinant plasmids pX458-P53 sgRNA1 and pX458-P53 sgRNA2 were obtained respectively.

[0036] The structure of the recombinant plasmid pX458-P53 sgRNA1 is described as follows: the fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector is replaced with the Mix1 sticky end sequence formed by annealing SEQ ID No: 5 and SEQ ID No: 6, and the other sequences of the pX458 vector are kept unchanged to obtain a recombinant vector, which is named recombinant plasmid pX458-P53 sgRNA1.

[0037] pX458-P53 sgRNA1 contains a sgRNA1 gene expression cassette having a nucleotide sequence of 5′-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGACCTGCCCAGTGCAGCTATgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt-3′ (SEQ ID No: 9). As shown in the 251st to 346th nucleotides of No. 9, the 1st to 241st nucleotides are the promoter for initiating the transcription of the sgRNA1 gene, and the 347th to 352nd nucleotides are the termination sequence for terminating the transcription of the sgRNA1 gene.

[0038] The structure of the recombinant plasmid pX458-P53 sgRNA2 is described as follows: the fragment between 5'-caccgggtcttcgagaagacct-3' and 5'-aaacaggtcttctcgaagaccc-3' of the pX458 vector is replaced with the Mix2 sticky end sequence formed by annealing SEQ ID No: 7 and SEQ ID No: 8, and the other sequences of the pX458 vector are kept unchanged to obtain a recombinant vector, which is named recombinant plasmid pX458-P53 sgRNA2.

[0039] pX458-P53 sgRNA2 contains a sgRNA2 gene expression cassette having a nucleotide sequence of 5′-gagggcctatttcccatgattccttcatatttgcatatacgatacaaggctgttagagagataattggaattaatttgactgtaaacacaaagatattagtacaaaatacgtgacgtagaaagtaataatttcttgggtagtttgcagttttaaaattatgttttaaaatggactatcatatgcttaccgtaacttgaaagtatttcgatttcttggctttatatatcttgtggaaaggacgaaacaccgGAAGCTGGAGCACATGACGGgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt-3′ (SEQ ID No: 10). The sgRNA2 gene is as shown in SEQ ID No: 11 . As shown in the 251st to 346th nucleotides of No. 10, the 1st to 241st nucleotides are the promoter for initiating the transcription of the sgRNA2 gene, and the 347th to 352nd nucleotides are the termination sequence for terminating the transcription of the sgRNA2 gene.

[0040] 3. Cell transfection The constructed pX458-P53 sgRNA1 and pX458-P53sgRNA2 plasmids were extracted using the Tiangen Plasmid Extraction Kit (DP120), and the concentration was qualified when it reached above 1000ng / μL. The primary sheep fetal fibroblasts were revived and subcultured, and the basic culture medium was DMEM / F12 (gibco, 11320033), plus 10% FBS (gibco, A5256701) and 1% double antibody (gibco, 15070063).

[0041] After the cells grew stably, 1×10 6 cells, using Lonza's Nucleofector TM 2b electroporator, A033 electroporation program, and the matching Basic Nucleofector ®Kit for Primary Mammalian Fibroblasts (VPI-1002) was used to electro-transfect 7.5 μg of pX458-P53 sgRNA1 and 7.5 μg of pX458-P53 sgRNA1 plasmid into sheep fetal fibroblasts. BD FACSAria TM The EGFP-positive single cells (the pX458 plasmid contains the Cas9 / EGFP / u6-sgRNA co-expression structure) were sorted into two 96-well plates using a III flow sorter. The basal culture medium remained DMEM / F12, but the FBS was increased to 20%, and the antibiotics were changed to 1% triple antibody.

[0042] The sorted 96-well plate was placed in a cell culture incubator for culture. After 10 days, 41 single clones were observed under a microscope, with a formation rate of 21.35% ( Figure 2 ).

[0043] 4. Cell Lysis Prepare cell lysis buffer: Tris-HCl (1M, PH=8.0) 2 mL, Triton X-100 0.45 mL, NP-40 0.45 mL, proteinase K 0.02 g, add deionized water to dissolve and dilute to 50 mL, filter with a 0.22 μm filter, and store at 4°C. Select 27 monoclonal cell lines with good growth, digest with trypsin, continue to culture and freeze half, and lyse the other half with cell lysis buffer.

[0044] 5. Verification of sheep fibroblast cell line preparation efficiency and gene mutation efficiency The PCR identification primer set PCR-F / PCR-R was designed, where PCR-F: 5'-tgtacattcgacccttgggtact-3', PCR-R: 5'-ccaccgctcaccatcgctatagt-3', and sent to the company for synthesis. PrimeSTAR Max DNA Polymerase (Takara) was used to amplify the lysis buffer. The PCR reaction system was as follows: 25μL PrimeSTAR Max Premix (2×), 1μL PCR-F, 1μL PCR-R, 1μL lysis buffer, 22μL ddH2O; the amplification program was as follows: 98℃ 1min30s, 98℃ 10s +60℃ 15s + 72℃ 10s (35cycles), 72℃ 10s, and stored at 4℃. After amplification, the band size was observed by gel electrophoresis ( Figure 3 ), and the remaining PCR products were sent to the company for Sanger sequencing to detect whether the single clone was mutated.

[0045] The results are as follows Figure 4 As shown: Among the 27 monoclonal cell lines (C1-C27), 26 of them had P53 Gene editing, among which 15 monoclones were homozygous mutations (C2 / C3 / C5 / C6 / C8 / C9 / C10 / C11 / C13 / C17 / C21 / C22 / C25 / C26 / C27), and the mutation type was consistent. P53 Compared with wild-type cells, homozygous mutants have two homologous chromosomes. P53 The following gene mutations occurred: P53 "5'-tatgggtcgactcgccgcccccgcccggcacccgcgtccgcgccatggccatctacaagaagctggagcacatga-3' in the gene P53 A 75 bp deletion mutation occurred at position 9269-9343 of the gene, causing a change in the amino acid of P53, thus P53 Gene knockout. Figure 4 A in the middle shows a representative sequencing result and the corresponding mutation type selected from 15 homozygous mutations; the sequencing results of 11 monoclonal clones were double peaks (C1 / C4 / C7 / C14 / C15 / C16 / C18 / C19 / C20 / C23 / C24), that is, at least one allele was mutated. Figure 4 Middle B is a representative sequencing result selected from 11 monoallelic or biallelic mutations. P53 The efficiency of preparing gene-mutated sheep fibroblast cell lines was as high as 96.3%, of which the efficiency of biallelic homozygous mutation reached 55.56% ( Figure 2 ).

[0046] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that the present invention can be further improved. In a word, according to the principles of the present invention, the application is intended to include any changes, uses or improvements to the present invention, including departure from the disclosed scope in the application, and changes made with conventional techniques known in the art.

Claims

1. Use of a substance that regulates the activity or content of P53 in the preparation of a product that improves the efficiency of cell mutation, wherein P53 The nucleotide sequence of the encoding gene is Gene ID: 443421, updated on March 5, 2024; the product contains a molecule that can express SEQ ID No: 3 and / or SEQ ID No:

4.

2. The use according to claim 1, characterized in that: The regulating the activity or content of P53 is to downregulate, inhibit or reduce the activity or content of P53.

3. The use according to claim 1 or 2, characterized in that: The substance that regulates the activity or content of P53 is a substance containing any of the following: g1) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 3; g2) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 4; g3) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6; g4) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 7 and SEQ ID No:

8.

4. The use according to claim 1 or 2, characterized in that: The method of improving cell mutation efficiency is to improve sheep cell mutation efficiency.

5. The use according to claim 4, characterized in that: The improvement of cell mutation efficiency is manifested in any of the following: B1) Improve the level of monoclonal cells P53 Gene mutation efficiency; B2) Improvement P53 Bi-allelic homozygous mutation efficiency of genes.

6. The single-stranded RNA molecule for use according to claim 3.

7. Biomaterial, characterized in that The biological material is any of the following: 1) A recombinant vector containing the single-stranded RNA molecule of claim 6; 2) a recombinant microorganism containing the recombinant vector described in 1); 3) a recombinant cell containing the recombinant vector described in 1); 4) an animal cell line containing the recombinant vector described in 1); 5) Animal tissue containing the recombinant vector described in 1); 6) Animal organs containing the recombinant vector described in 1).

8. A product for improving cell mutation efficiency, characterized in that: The product is any of the following: g1) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 3; g2) a single-stranded RNA molecule having a nucleotide sequence of SEQ ID No: 4; g3) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 5 and SEQ ID No: 6; g4) a double-stranded DNA molecule consisting of the nucleotide sequences of SEQ ID No: 7 and SEQ ID No:

8.

9. Use of the biomaterial according to claim 8 in improving cell mutation efficiency.

10. The biomaterial according to claim 8, or the use according to claim 9, characterized in that: The cells are sheep fetal fibroblasts.

Images