Biological material for overexpressing chicken lnc-CA13 gene and application thereof

Abstract

The invention relates to the field of biology, in particular to a biological material for overexpressing a chicken lnc-CA13 gene and application of the biological material. The chicken lnc-CA13 gene provided by the invention is inserted into a lentiviral vector, a biological material (recombinant vectors (lentiviral recombinant vectors, lnc-CA13-4) and recombinant bacteria) capable of improving the expression of the chicken lnc-CA13 gene can be obtained, the biological material can effectively improve the expression quantity of the chicken lnc-CA13 gene, and the overexpression efficiency at the gene level is 95.85%. The chicken lnc-CA13 gene is constructed on a lentiviral vector and is suitable for in-vivo and in-vitro research; meanwhile, the invention has important scientific significance and application prospects in the aspects of deeply researching the functions of the chicken lnc-CA13 gene and the like.

Description

Technical Field

[0001] The present invention relates to the biological field, and in particular to a biomaterial for overexpressing a chicken lnc-CA13 gene and an application thereof. Background Art

[0002] The main manifestation of chicken cross beak is the dislocation of the upper and lower beaks and the state of cross. Since 1934, at least 12 chicken breeds have been publicly reported to have cross beaks in the world, with an incidence of 0.2%-7.4%; about 30% of local chicken breeds in China have cross beaks. Chickens with deformed beaks cannot eat and drink normally, resulting in stunted growth and development, and the mortality rate is several times higher than that of normal chickens. The reproductive capacity of adult chickens is also more than 50% lower than that of normal chickens. Taking a breeder farm with an annual output of tens of millions of chickens as an example, the economic loss caused by cross beaks is as high as 6 million yuan each year. Cross beaks are formed during the brooding period and are extremely hidden. Cross beaks will also appear in the offspring of normal individuals, which seriously restricts the industrial development of local chicken breeds. The transcript characteristics of the bilateral mandibular condyles of cross beak chickens showed that the CA13 gene was downregulated in the condyle of the short bone ramus of chickens with deformed beaks, which reduced the ability of carbonic anhydrase to participate in osteoblast mineralization, caused bone formation disorders in the mandibular ramus on that side, and formed cross beaks. Among them, the lnc-CA13 gene, as an upstream regulatory factor of the CA13 gene, is downregulated in the condyle on the short bone branch side of the cross-beak chicken. Therefore, the lnc-CA13 gene plays an important role in regulating the development of the chicken mandible.

[0003] At present, there is no report on how to effectively increase the expression of the chicken lnc-CA13 gene, which has hindered the functional research of the gene to a certain extent. Therefore, developing a method that can effectively increase the expression of the chicken lnc-CA13 gene has broad application prospects for the functional research of the chicken lnc-CA13 gene. Summary of the invention

[0004] The purpose of the present invention is to provide a biomaterial for overexpressing the chicken lnc-CA13 gene and its application to solve the problems existing in the above-mentioned prior art. Inserting the chicken lnc-CA13 gene provided by the present invention into a lentiviral vector can effectively increase the expression amount of the chicken lnc-CA13 gene, providing a new way to obtain the chicken lnc-CA13 gene.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a chicken lnc-CA13 gene, and the sequence of the chicken lnc-CA13 gene is shown in SEQ ID NO.1.

[0007] The present invention provides a recombinant vector for overexpressing a chicken lnc-CA13 gene. The recombinant vector is obtained by inserting the chicken lnc-CA13 gene into a multiple cloning site of a basic vector; the sequence of the chicken lnc-CA13 gene is shown in SEQ ID NO.1.

[0008] Preferably, the basic vector is a lentiviral expression vector.

[0009] Further preferably, the lentiviral expression vector is a GL159 vector.

[0010] Preferably, the multiple cloning site of the basic vector is the AgeI restriction site and the EcoRI restriction site of the basic vector.

[0011] The present invention provides a method for constructing the above-mentioned recombinant vector, comprising the step of connecting the chicken lnc-CA13 gene and a basic vector.

[0012] Further preferably, the basic vector is a lentiviral expression vector.

[0013] Further preferably, the lentiviral expression vector is a GL159 vector.

[0014] Preferably, the ligated reaction system is 20 μL, including 1 μL chicken lnc-CA13 gene, 3 μL basic vector, 2 μL 10×T4 DNAligase Buffer, 1 μL T4 DNAligase and the balance water.

[0015] The present invention provides a recombinant bacterium containing the above recombinant vector.

[0016] Preferably, the basic bacteria of the recombinant bacteria is Escherichia coli.

[0017] The present invention provides the use of the above-mentioned chicken lnc-CA13 gene, the above-mentioned recombinant vector or the above-mentioned recombinant bacteria in overexpressing the chicken lnc-CA13 gene.

[0018] The present invention provides the use of the above-mentioned chicken lnc-CA13 gene, the above-mentioned recombinant vector or the above-mentioned recombinant bacteria in preparing a product overexpressing the chicken lnc-CA13 gene.

[0019] The present invention discloses the following technical effects:

[0020] The chicken lnc-CA13 gene provided by the present invention is inserted into a lentiviral vector, and a biological material (recombinant vector (lentiviral recombinant vector, lnc-CA13-4) and a recombinant bacterium) for improving the expression of the chicken lnc-CA13 gene can be obtained. The biological material can effectively increase the expression of the chicken lnc-CA13 gene, and the overexpression efficiency at the gene level is 95.85%. The chicken lnc-CA13 gene is constructed on a lentiviral vector, which is suitable for in vivo and in vitro research; at the same time, the present invention has important scientific significance and application prospects for in-depth research on the function of the chicken lnc-CA13 gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0022] Figure 1 This is the GL159 vector map in the embodiment of the present invention;

[0023] Figure 2 It is the map of the expression gene structure gag / pol and the regulatory gene rel vector (H1 vector);

[0024] Figure 3 This is a map of the VSVG vector (H2 vector) expressing the envelope protein;

[0025] Figure 4 Fluorescence microscopy images of chicken DF1 cells in the lentivirus group transfected with the lnc-CA13-4 recombinant lentivirus; A is the white light group; B is the fluorescence group; the magnification is 100×;

[0026] Figure 5 This is the H35370 recombinant vector map;

[0027] Figure 6 The expression of lnc-CA13 gene in chicken DF1 cells after lentivirus transfection with lnc-CA13-4 recombinant lentivirus was induced. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] Example 1 Preparation of overexpression lentiviral clones

[0034]

[0035] (2) Synthesize the target sequence

[0036] The full-length sequence of the chicken lnc-CA13 gene was amplified using the RACE technique, the target sequence (chicken lnc-CA13 gene) was synthesized using a nucleic acid synthesizer, and appropriate restriction endonuclease sites were added at both ends to complete the vector construction. The sequence after adding restriction endonuclease sites at both ends is as shown in SEQ ID NO.2, specifically: ACTAGT TTCGAA , where the underlined part is the restriction site.

[0037] (3) Preparation of linearized lentiviral expression vector

[0038] The lentiviral expression vector (named GL159 by Heyuan Biotechnology Co., Ltd., and the map of the vector is shown in Figure 2) was cleaved with restriction endonucleases. Figure 1 As shown, the vector is disclosed in the Chinese application document with application number "202011419453.X" and title "Lentivirus Packaging Vector and Packaging Method" and application number "202410265890.2" and title "A Lentivirus Envelope Protein and Its Use"). The enzyme digestion reaction system is: 2μg of lentivirus expression vector, 10× reaction buffer (10× cutsmart buffer) 5μL, restriction endonuclease (AgeI enzyme and EcoRI enzyme 1μL each) 2μL, deionized water supplemented 50μL, incubated in a 37℃ water bath for more than 2h. The enzyme digestion product was subjected to agarose gel electrophoresis to detect the enzyme digestion effect, and the target vector band was cut from the gel after agarose gel electrophoresis, and the TaKaRaMiniBEST Agarose Gel DNA Extraction Kit Ver.3.0 was used for gel recovery to obtain a linearized lentivirus expression vector.

[0039] (4) Overexpression fragment into expression vector

[0040] The double-enzyme linearized vector and the chicken lnc-CA13 gene were connected by T4 DNA ligase and connected at 16°C overnight to obtain a connection product, namely the H35370 recombinant vector (lentiviral recombinant vector, lnc-CA13-4), the map of which is shown in Figure 5 The reaction system is shown in Table 1.

[0041] Table 1 Ligation reaction system

[0042] Reagents Positive control (μL) Self-ligation control (μL) Connectome (μL) Chicken lnc-CA13 gene 10mM - - 1 Linearized lentiviral expression vector 40ng / μL 3 3 3 10×T4 DNA ligase Buffer 2 2 2 T4DNAligase 1 1 1 <![CDATA[ddH2O]]> Make up 20 Make up 20 Make up 20

[0043] (5) Transformation of E. coli DH5α competent cells

[0044] Add 10 μL of the ligation reaction product to 100 μL of E. coli DH5α competent cells, flick the tube wall several times to mix, place on ice for 30 minutes, heat shock at 42°C for 90 seconds, incubate in an ice-water bath for 2 minutes, add 500 μL of LB medium, and place on a shaker at 37°C for 1 hour. Take an appropriate amount of bacterial solution and evenly spread it on a plate containing antibiotics, and invert and culture it in a constant temperature incubator for 12-16 hours.

[0045] (6) Identification of positive transformants by colony PCR

[0046] The transformants grown on the plate were picked and resuspended in 10 μL LB culture medium. 1 μL was taken as a template and sent to Heyuan Biotechnology for colony PCR identification to obtain the correct positive clone verified by sequencing. Forward sequencing primer H101-MluI: GTAGACATAATAGCAACAGACATAC (SEQ ID NO.3); reverse sequencing primer CMV-F: CGCAAATGGGCGGTAGGCGTG (SEQ ID NO.4), and the correct positive clone was obtained. The correct positive clone contained the H35370 recombinant vector, and the partial nucleotide sequence of the recombinant vector is shown in SEQ ID NO.7, specifically:

[0047]

[0048] (7) Plasmid extraction

[0049] The correct positive clones verified by sequencing were subjected to plasmid mini-extraction. The steps were as follows: the positive clones with correct sequencing were transferred to 10 mL of LB liquid culture medium containing ampicillin, cultured at 37°C overnight, and the plasmids were extracted using the Tiangen Endotoxin-free Plasmid Mini-Extraction Kit. The detailed steps are as follows:

[0050] 1. Collect the overnight culture solution into a labeled 5 mL centrifuge tube and centrifuge at 12000 rpm for 2 min to collect the bacteria;

[0051] 2. Discard the supernatant, add 250 μL of cell resuspension solution, and shake thoroughly to make the bacterial mass evenly suspended;

[0052] 3. Add 250 μL of cell lysis buffer and 10 μL of proteinase K, invert 5-6 times, and gently mix; let stand for 1-2 minutes to lyse and clarify the cells;

[0053] 4. Add 350 μL of neutralizing solution, mix by inverting to completely precipitate the protein, and place in an ice bath for 5 minutes;

[0054] 5. Centrifuge at 10000 rpm for 10 min, discard the protein, and collect the supernatant into another clean and sterile 1.5 mL EP tube;

[0055] 6. Centrifuge at 12000rpm for 5min. Prepare the labeled recovery column and transfer the supernatant to the recovery column. Centrifuge at 12000rpm for 1min and discard the waste liquid at the bottom.

[0056] 7. Add 600 μL of pre-prepared rinse solution, centrifuge at 12000 rpm for 1 min, discard the lower layer of waste liquid, repeat once, centrifuge at 12000 rpm for 2 min to further remove the residual rinse solution;

[0057] 8. Transfer the recovery column to a new 1.5mL EP tube in a clean bench, let it stand for 10-20 minutes, and dry naturally;

[0058] 9. Add 95 μL Nuclease-Free Water to the recovery column, let it stand for 2 minutes, centrifuge at 12000 rpm for 2 minutes, collect the samples, number them, perform electrophoresis, determine the concentration, and conduct quality inspection.

[0059] Example 2 Lentivirus packaging

[0060] Virus packaging involves three plasmids, namely, the tool vector plasmid GL159 carrying the target sequence (see Example 1), the expression gene structure gag / pol and the regulatory gene rel vector (H1 vector, the map of which is shown in FIG. Figure 2As shown, the vector is disclosed in the document "Studying the relationship between TUBB3 and the expression of CD44, CD133, PD-L1 and p53 using a lentiviral expression system", the application number "202410861933.3" and the name "Lentiviral envelope protein, its encoding nucleic acid molecule and recombinant lentivirus including it" and the application number "202410265890.2" and the name "A lentiviral envelope protein and its use" in the Chinese application document. In the document "Studying the relationship between TUBB3 and the expression of CD44, CD133, PD-L1 and p53 using a lentiviral expression system", the full name of the H1 vector is psPAX2 vector, in "Lentiviral envelope protein, its encoding nucleic acid molecule and recombinant lentivirus including it", the full name of the H1 vector is gag-pol Helper plasmid, and in "A lentiviral envelope protein and its use" the full name of the H1 vector is gag-pol Helper plasmid and the expression envelope protein VSVG vector (H2 vector, its map is as shown Figure 3 As shown, the vector is disclosed in the documents “Pcgf2 promotes the reprogramming of chicken embryo fibroblasts to form induced pluripotent stem cells”, “Study on the application of different viral vector systems in buffalo somatic cell transgenesis”, “Construction of MARC-145 cell line stably expressing porcine CD163 receptor” and the Chinese application document with application number “202410861933.3” and titled “Lentiviral envelope protein, its encoding nucleic acid molecules and recombinant lentiviruses including it”. In the document “Pcgf2 promotes the reprogramming of chicken embryo fibroblasts to form induced pluripotent stem cells”, the full name of the H2 vector is the auxiliary plasmid VSVG, in the document “Study on the application of different viral vector systems in buffalo somatic cell transgenesis”, the full name of the H2 vector is the envelope plasmid pCMV-VSVG, in the document “Construction of MARC-145 cell line stably expressing porcine CD163 receptor”, the full name of the H2 vector is the packaging auxiliary plasmid VSVG, and in “Lentiviral envelope protein, its encoding nucleic acid molecules and recombinant lentiviruses including it”, the full name of the H2 vector is VSVG plasmid.

[0061] 1. Preparation of Plasmid

[0062] The three plasmid DNAs in the lentiviral packaging system were extracted using Qiagen's plasmid extraction kit. The plasmid DNA was dissolved in sterilized TE, and its concentration and purity were determined by ultraviolet absorption to ensure that the A260 / A280 of the extracted plasmid DNA was between 1.8 and 2.0.

[0063] 2. Plasmid Transfection and Lentivirus Harvest

[0064] (1) 24 h before transfection, 293T cells in the logarithmic growth phase were digested with trypsin and the cell density was adjusted to about 5 × 10 cells / mL in a medium containing 10% serum. 6cells / 15mL, re-inoculated into a 10 cm diameter cell culture dish, cultured in a 37°C, 5% CO2 incubator; cultured for 24 hours, and used for transfection when the cell density reached 70%-80%;

[0065] (2) The medium was changed to serum-free medium 2 h before transfection;

[0066] (3) Add the prepared DNA solutions (20 μg of GL159 vector, 15 μg of H1 vector, and 10 μg of H2 vector) to a sterilized centrifuge tube, mix well with the corresponding volume of GeneCare transfection reagent, adjust the total volume to 1 mL, and incubate at room temperature for 15 min;

[0067] (4) slowly adding the mixture dropwise to the 293T cell culture medium, mixing well, and culturing in a cell culture incubator at 37°C and 5% CO2;

[0068] (5) After 6 h of culture, discard the culture medium containing the transfection mixture, add 10 mL of PBS solution and wash once, gently shake the culture dish to wash the remaining transfection mixture and then discard;

[0069] (6) Slowly add 20 mL of cell culture medium containing 10% serum and continue culturing in a 37°C, 5% CO2 incubator for 48-72 h.

[0070] 3. Lentivirus Concentration and Purification

[0071] (1) According to the cell status, collect the 293T cell supernatant 48 hours after transfection (transfection is counted as 0 hours);

[0072] (2) Centrifugation at 4000 g for 10 min at 4°C to remove cell debris;

[0073] (3) Filter the supernatant with a 0.45 μm filter into a 40 mL ultracentrifuge tube;

[0074] (4) Balance the samples separately, place the ultracentrifuge tubes containing the virus supernatant one by one into the Beckman ultracentrifuge, and centrifuge at 25,000 rpm for 2 h. The centrifugation temperature is controlled at 4°C.

[0075] (5) After centrifugation, discard the supernatant, remove the liquid remaining on the tube wall, add virus storage solution (which can be replaced by PBS or cell culture medium), and gently pipette repeatedly to resuspend;

[0076] (6) After being fully dissolved, centrifuge at high speed at 10,000 rpm for 5 min, take the supernatant and aliquot to obtain the lnc-CA13-4 recombinant lentivirus;

[0077] (7) Prepare samples for testing.

[0078] 4. Lentivirus quality testing

[0079] (1) Physical index detection

[0080] 1) Color determination: The lentivirus storage solution is a pink clear liquid when determined by naked eyes;

[0081] 2) Determination of viscosity: Use a 20-200 μL pipette to slowly absorb 50 μL of lentivirus storage liquid. There should be no obvious viscosity or aspiration lag.

[0082] (2) Sterility testing

[0083] The virus was added to 293T cells for verification. After 24 hours of normal culture, microscopic examination showed no bacterial or fungal contamination. At the same time, referring to the empty cell group, there were no obvious particles in the intercellular space and the culture medium was clear and transparent.

[0084] (3) Titer detection

[0085] 1) One day before the assay, 293T adherent cells were plated in a 96-well plate with 4 × 10 4 cells, volume 100 μL;

[0086] 2) Prepare 7-10 sterile EP tubes according to the expected titer of the virus and add 90 μL of serum-free medium to each tube;

[0087] 3) Take 10 μL of the virus stock solution to be tested and add it to the first tube. After mixing, take 10 μL and add it to the second tube. Continue the same operation until the last tube.

[0088] 4) Select the desired cell wells, discard 90 μL of culture medium, add 90 μL of diluted virus solution, and culture in an incubator;

[0089] 5) After 24 h of culture, add 100 μL of complete culture medium. Be careful not to blow up the cells.

[0090] 6) After 4 days of culture, the fluorescence expression was observed. The number of fluorescent cells decreased with the increase of dilution multiple.

[0091] Non-targeting sequence lentiviral particles were provided by Heyuan Biotech Co., Ltd.

[0092] Example 3 Lentivirus infection of chicken DF1 cells

[0093] The lnc-CA13-4 recombinant lentivirus and non-targeting sequence lentiviral particles prepared according to the method of Example 2 were transfected into chicken DF1 cells, which expressed the lnc-CA13 gene. The infection efficiency of the lnc-CA13-4 recombinant lentivirus was detected using a fluorescence microscope.

[0094] (1) Experimental grouping: The experiment was divided into three groups: a group not transfected with any lentivirus (blank control group), a group transfected with the lnc-CA13-4 recombinant lentivirus (lnc-CA13-4), and a group transfected with the non-targeting sequence lentivirus particles (control group, NC). The cell number and culture conditions were the same in all groups.

[0095] (2) Cell infection test method: Chicken DF1 was cultured at 1×10 5 Cells / well were inoculated in a 12-well plate, mixed and cultured in a 37°C, 5% CO2 incubator for 24 h; after 24 h of culture, the medium containing the three antibodies was replaced, the lentivirus stock solution was taken, placed on ice until completely dissolved, and centrifuged briefly; 1×10 8 TU / mL of lentivirus was mixed with DMEM medium containing 10% FBS at a volume ratio of 3:50 (multiplicity of infection index MOI is 60), and then Polybrene-Plus, a gene transfection enhancement solution of GeneCare, was added at a concentration of 1 μg / μL, mixed well, and added to the cell wells; cultured at 37°C, 5% CO2 for 13 hours, replaced with DMEM containing 10% FBS, and cultured for another 96 hours.

[0096] (3) At 24h, 48h, 72h and 96h after cell infection, the cells were observed and photographed using a fluorescence microscope, and the total cells were observed and photographed using a bright field microscope. Figure 4 As shown, the infection efficiency of cells in 72h was more than 80%. It can be seen that the lentivirus containing the chicken lnc-CA13 gene designed and synthesized by the present invention and the non-targeting sequence can effectively infect chicken DF1 cells.

[0097] Example 4 Overexpression of the lnc-CA13 gene in chicken DF1 by recombinant lentivirus

[0098] Real-time PCR was used to detect the effect of the lentiviral vector lnc-CA13-4 provided by the present invention on the expression level of the lnc-CA13 gene in chicken DF1 cells, as follows:

[0099] The PCR primer sequences for real-time PCR detection of lnc-CA13 are:

[0100] Forward primer F: 5'-GACAGGAATGCAGTGCAGAA-3', SEQ ID NO. 5;

[0101] Reverse R: 5'-CGAACAAAGACCTCCAGGAT-3', SEQ ID NO.6.

[0102] (1) Experimental grouping: The experiment was divided into three groups: a group not transfected with any lentivirus (blank control group, Blank), a group transfected with the chicken lnc-CA13 gene lentivirus (lnc-CA13-4 group, lnc-CA13-4), and a group transfected with the NC (non-targeting sequence) lentivirus (control group, NC). The cell number and culture conditions of all groups were the same.

[0103] (2) RNA extraction and real-time PCR detection: Trizol A was added to the infected cells to fully lyse the cells, and the total RNA of each group of cells was extracted using the chloroform-isopropanol method. The extracted mRNA was reverse transcribed into cDNA. The cDNA of each group of cells was used as a template, and the GAPDH gene was used as an internal reference. Real-time PCR was used to detect the expression of the lnc-CA13 gene. The results are shown in Figure 2. Figure 6 The results show that the chicken lnc-CA13 gene provided by the present invention promotes the expression of the chicken lnc-CA13 gene in chicken DF1 cells. Compared with the lentivirus constructed using a non-targeted sequence, the lentivirus constructed using the chicken lnc-CA13 gene provided by the present invention can significantly improve the expression of the chicken lnc-CA13 gene, and the overexpression efficiency at the gene level is 95.85%.

[0104] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A chicken lnc-CA13 gene, characterized in that: The sequence of the chicken lnc-CA13 gene is shown in SEQ ID NO.

1.

2. A recombinant vector for overexpressing chicken lnc-CA13 gene, characterized in that: The recombinant vector is a vector in which the chicken lnc-CA13 gene is inserted into the multiple cloning site of the basic vector; the sequence of the chicken lnc-CA13 gene is shown in SEQ ID NO.

1.

3. The recombinant vector according to claim 2, characterized in that The basic vector is a lentiviral expression vector.

4. The recombinant vector according to claim 2, characterized in that The multiple cloning sites of the basic vector are the Age I restriction site and the EcoR I restriction site of the basic vector.

5. The method for constructing the recombinant vector according to claim 2, characterized in that: The construction method includes the steps of connecting the chicken lnc-CA13 gene and the basic vector.

6. The construction method according to claim 5, characterized in that: The ligation reaction system is 20 μL, including 1 μL chicken lnc-CA13 gene, 3 μL basic vector, 2 μL 10×T4 DNA ligase Buffer, 1 μL T4 DNA ligase and the balance water.

7. A recombinant bacterium containing the recombinant vector according to any one of claims 2 to 4.

8. The recombinant bacterium according to claim 7, characterized in that The basic bacteria of the recombinant bacteria is Escherichia coli.

9. Use of the chicken lnc-CA13 gene according to claim 1, the recombinant vector according to any one of claims 2 to 4, or the recombinant bacteria according to claim 7 or 8 in overexpressing the chicken lnc-CA13 gene.

10. Use of the chicken lnc-CA13 gene according to claim 1, the recombinant vector according to any one of claims 2 to 4, or the recombinant bacteria according to claim 7 or 8 in preparing a product overexpressing the chicken lnc-CA13 gene.

Images