Microbial remediation agent for heavy metal remediation as well as preparation method and application of microbial remediation agent

Abstract

The invention discloses a microbial remediation agent for heavy metal remediation as well as a preparation method and application of the microbial remediation agent. The microbial remediation agent is prepared by loading pseudomonas aeruginosa onto a carrier, the carrier comprises the following components in parts by weight: 8-22 parts of chlorella pyrenoidosa solution, 1-3 parts of silicon fertilizer and 1-3 parts of nano zero-valent iron; the silicon fertilizer is obtained by mixing granite stone powder, marble powder and an alkali activator according to the mass ratio of (8-12): (0-12): (0.5-4) and then calcining; the alkali activator is solid sodium hydroxide or potassium hydroxide. The microbial remediation agent disclosed by the invention is high in activity, rapid in reproduction, environment-friendly, pollution-free and low in cost; the form of the heavy metal can be changed, and the high-toxicity form of the heavy metal is converted into the low-toxicity form, so that the toxicity and mobility of the heavy metal are reduced, and the pollution caused by the heavy metal is remarkably reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of heavy metal pollution remediation, and in particular to a microbial remediation agent for heavy metal remediation, and a preparation method and application thereof. Background Art

[0002] Heavy metals are a typical global environmental pollutant. Due to their bioaccumulation, difficulty in degradation and strong toxicity, they pose a high potential risk of environmental pollution. They have long been a research hotspot for many scholars and a focus of public attention. Research surveys in recent years have shown that mining activities have become one of the main sources of heavy metal pollution in the environment.

[0003] Lead-zinc tailings refer to waste generated during the lead-zinc ore dressing process, which is a type of traditional mining waste. Lead-zinc tailings mainly come from ore dressing plants or tailings ponds. Tailings ponds refer to places where dams are built to intercept valley mouths or enclosures to store tailings or other industrial waste discharged after ore selection in metal or non-metal mines. The main components of lead-zinc tailings include silicate minerals, clay minerals, sulfide minerals and oxide minerals, etc., and also contain a large amount of toxic and harmful elements, such as lead, zinc, arsenic, mercury, cadmium, etc. The large amount of lead-zinc tailings accumulated in tailings ponds has caused serious heavy metal pollution. If not treated, it will cause great harm to the environment.

[0004] There is no unified definition of the forms of heavy metals in soil. However, according to the definition of the International Union of Applied Chemistry (IUPAC), the meaning of "form" can be generally divided into two types: (1) chemical species, which refers to the actual form of an element in the environment as a certain ion or molecule; (2) forms of occurrence, which refers to the actual form of an element in the environment with a certain characteristic (physical, chemical or geological). The biological toxicity of heavy metals is not only related to their total amount, but also depends on their form distribution to a greater extent. After various forms of heavy metals enter the soil, they form different forms through various reactions such as dissolution, precipitation, coagulation, complexation and adsorption. Their migration and transformation characteristics, biological effectiveness (toxicity) and environmental effects are also different. Generally speaking, the exchangeable state and carbonate-bound state of heavy metals are effective states with high toxicity; the iron-manganese oxide-bound state, organic matter-bound state and residual state are stable states with low toxicity.

[0005] In order to deal with heavy metal pollution in tailings ponds in mining areas, traditional remediation methods mainly use physical and chemical means. Physical methods such as compost covering and soil mixing can slow down the spread of pollutants, but cannot completely remove heavy metals. Chemical methods include adsorption, ion exchange, reduction precipitation, etc. Although they can remove heavy metals to a certain extent, they often require a large amount of chemical agents and energy input, and there are problems such as secondary pollution and high costs. Different from traditional remediation methods, microbial remediation methods have attracted much attention from the scientific community in recent years and are considered to be a new remediation technology with potential. Microbial remediation uses the metabolic activities of microorganisms to convert heavy metal ions into inactive or water-soluble precipitates, thereby reducing their toxicity and mobility. It has the advantages of simple operation, low cost, and environmental friendliness. At present, there is still a lack of excellent microbial remediation agents for heavy metal remediation of lead and zinc tailings. Summary of the invention

[0006] The purpose of the present invention is to provide a microbial remediation agent for heavy metal remediation and a preparation method and application thereof in view of the above problems.

[0007] In order to achieve its purpose, the present invention adopts the following technical solution:

[0008] The first aspect of the present invention provides a microbial remediation agent for heavy metal remediation, which is prepared by loading Pseudomonas aeruginosa onto a carrier; the carrier comprises the following components in weight proportions: 8 to 22 parts of Chlorella pyrenoidosa algae liquid, 1 to 3 parts of silicon fertilizer, and 1 to 3 parts of nano zero-valent iron;

[0009] The silicon fertilizer is prepared by mixing granite powder, marble powder and alkali activator in a mass ratio of 8-12:0-12:0.5-4, calcining at 600-1000° C. and preparing into particles of 60-200 meshes;

[0010] The alkaline activator is solid sodium hydroxide or potassium hydroxide.

[0011] Preferably, in the microbial remediation agent, the cell number concentration of the Chlorella pyrenoidosa liquid is 10 6 ~10 9 / mL;

[0012] The microbial remediation agent is a 1.0×10 7 ~2.0×10 8 The CFU / mL Pseudomonas aeruginosa bacterial solution and the carrier are mixed at a mass ratio of 1 to 3:1 and then freeze-dried to obtain a powder;

[0013] The silicon fertilizer is prepared by mixing granite powder, marble powder and alkali activator in a mass ratio of 8-12:2-8:1-3 (preferably 9-10:2-4:1.5-2.5), calcining at 700-900° C. for 20-120 minutes (preferably 40-80 minutes) to form particles of 80-150 meshes;

[0014] The carrier comprises the following components in weight proportions: 10-20 parts of protein-core Chlorella algae liquid, 1-3 parts of silicon fertilizer, and 1-3 parts of nano zero-valent iron; or, the carrier comprises the following components in weight proportions: 10-15 parts of protein-core Chlorella algae liquid, 1-2 parts of silicon fertilizer, and 1-2 parts of nano zero-valent iron; preferably: 10-13 parts of protein-core Chlorella algae liquid, 1-1.5 parts of silicon fertilizer, and 1-1.5 parts of nano zero-valent iron, and more preferably: 10 parts of protein-core Chlorella algae liquid, 1 part of silicon fertilizer, and 1 part of nano zero-valent iron;

[0015] The heavy metals include Pb, Zn, Cd, and Cr;

[0016] The Pseudomonas aeruginosa is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with the deposit number being CGMCC No.31703.

[0017] The second aspect of the present invention provides a method for preparing any of the above-mentioned microbial remediation agents, comprising the following steps: taking a bacterial solution of Pseudomonas aeruginosa and a carrier, and mixing them evenly according to a proportion to obtain a microbial remediation agent.

[0018] Specifically, the above preparation method comprises the following steps:

[0019] (1) Preparation of Pseudomonas aeruginosa bacterial solution:

[0020] Take the Pseudomonas aeruginosa strain and inoculate it into the culture medium for expansion culture until OD 600 = 0.5-1.2 (preferably 0.8-1.2), then centrifuge to collect the cells, and suspend the cells in PBS buffer, physiological saline or sterile water to a set concentration;

[0021] (2) Preparation of carrier

[0022] Preparation of silicon fertilizer: Mix granite powder, marble powder and alkali activator according to mass ratio, calcine at 600-1000°C for 20-120 minutes to prepare 60-200 mesh particles;

[0023] Preparation of Chlorella pyrenoidosa algae liquid: Take Chlorella pyrenoidosa algae seeds and inoculate them into the culture medium for expansion culture until the growth retardation phase to the stable phase (preferably the logarithmic growth phase to the stable phase), then collect the algae by centrifugation, and resuspend the algae in sterile water, physiological saline or PBS buffer solution to a cell number concentration of 10 6 ~10 9 / mL;

[0024] The pyrenoid chlorella algae liquid, silicon fertilizer and nano zero-valent iron are mixed evenly according to a certain proportion to obtain a carrier;

[0025] (3) Preparation of microbial remediation agents

[0026] Take the prepared Pseudomonas aeruginosa bacterial solution and the carrier, mix them evenly according to the proportion, and obtain the product.

[0027] In the step (3), the prepared Pseudomonas aeruginosa bacterial solution and the carrier are mixed evenly according to a proportion, and then centrifuged to collect the precipitate to obtain;

[0028] Preferably, the precipitate is freeze-dried into powder to obtain the microbial repair agent, and the specific steps are: take the prepared Pseudomonas aeruginosa bacterial solution and the carrier, mix them evenly according to the proportion, centrifuge at 4-10°C, discard the supernatant, collect the precipitate, add a lyophilization protective agent according to 8-12wt% of the weight of the precipitate, mix well, and use a vacuum freeze dryer to freeze dry to obtain; preferably, the lyophilization protective agent is trehalose.

[0029] The third aspect of the present invention provides the use of any of the above-mentioned microbial remediation agents in remediating heavy metal pollution in the environment, wherein the environment includes heavy metal contaminated soil, tailings, and tailings ponds.

[0030] In the above-mentioned application technology scheme, the heavy metals include Pb, Zn, Cd, and Cr; 3 to 7 grams (preferably 4 to 6 grams) of microbial remediation agent are added to every 0.05 cubic meter of the sample to be treated, the microbial remediation agent is applied to the sample to be treated, mixed evenly and allowed to stand for 3 to 7 days (preferably 4 to 6 days), and the humidity in the sample is maintained at 60±10% during the remediation period.

[0031] Preferably, the microbial remediation agent is applied once every 3 to 7 days (preferably 4 to 6 days), and the mixture is allowed to stand after application, and the microbial remediation agent is applied multiple times until the toxic form of heavy metals therein is reduced to below the target concentration.

[0032] Preferably, in the above-mentioned application technology scheme, the environment is a lead-zinc tailings pond, and the microbial remediation agent is sprayed in the lead-zinc tailings pond site, mixed evenly, and allowed to stand.

[0033] The beneficial effects of the present invention are:

[0034] The microbial remediation agent provided by the present invention makes full use of industrial solid wastes, granite and marble processing wastes and scraps, and turns granite and marble wastes into treasures. Granite has a high silicon content, and these industrial fertilizers are used to prepare silicon fertilizers as carriers of Pseudomonas aeruginosa remediation agents. The active silicon in the remediation agent can enhance the adsorption capacity of the soil to heavy metals by forming a coprecipitation effect with heavy metals in the soil, increasing the cation exchange capacity (CEC) and organic matter (OM) content of the soil, and the active silicon has a high specific surface area, which can provide sufficient attachment sites for microorganisms, which is conducive to the attachment and growth of microorganisms; nano zero-valent iron assists in removing a variety of heavy metal ions through adsorption, reduction, precipitation and coprecipitation. At the same time, nano zero-valent iron has a certain pH adjustment function, which assists the microorganisms and algae in the microbial remediation agent to colonize in the tailings to play a role; the fermented algae liquid can provide certain nutrition and additional carbon sources for the colonization of microorganisms, enhance the activity of microorganisms, and enhance the environmental adaptability and stability of the remediation agent, so that it can maintain a high remediation efficiency in the high-pollution, oligotrophic high-pressure environment of tailings.

[0035] The microbial remediation agent of the present invention has high activity, fast reproduction, environmental protection and no pollution, and low cost; it can change the form of heavy metals, converting heavy metals from highly toxic forms to low toxic forms, so as to reduce the toxicity and mobility of heavy metals, and significantly reduce the pollution caused by heavy metals. The microbial remediation agent of the present invention can still maintain good heavy metal remediation ability under oligotrophic conditions, and is particularly suitable for heavy metal pollution control in lead-zinc tailings ponds in oligotrophic environments, providing an efficient and feasible remediation agent and heavy metal pollution remediation method for the remediation of mine tailings pond environments. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 It is a phylogenetic analysis tree constructed from the 16S rRNA sequences of the screened strains.

[0037] Figure 2 This is the colony morphology of the screened Pseudomonas aeruginosa.

[0038] Figure 3 This is the growth curve of the screened Pseudomonas aeruginosa.

[0039] Figure 4 Pb in the presence or absence of Pseudomonas aeruginosa 2+ Comparison of removal effects.

[0040] Figure 5 These are the removal rates of Pseudomonas aeruginosa in low (A) and high (B) concentration heavy metal culture media.

[0041] Figure 6 Pseudomonas aeruginosa and Pb 2+XPS spectrum of the reaction product.

[0042] Figure 7 This is the removal rate result of Pseudomonas aeruginosa under different carbon source and nitrogen source conditions.

[0043] Figure 8 It is the characterization (SEM, XPS) picture of the microbial remediation agent material of the present invention.

[0044] Fig. 9 This is a graph showing the conversion capability of the microbial remediation agent of the present invention on the forms of heavy metals. DETAILED DESCRIPTION

[0045] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0046] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0047] Example 1 Experiment on the removal of heavy metals by Pseudomonas aeruginosa QPBII-1

[0048] 1 Experimental Materials

[0049] 1.1 Sample source

[0050] Lead-zinc tailings samples: Tailings samples were collected from the Fankou lead-zinc tailings restoration area in Guangdong, placed in sterile plastic ziplock bags, taken back to the laboratory, and stored in a -20℃ refrigerator.

[0051] 1.2 Culture medium

[0052] The screening culture medium contains the following ingredients: Na2S2O3·5H2O (10 g / L); KNO3 (4 g / L); NaHCO3 (2 g / L); KH2PO4 (4 g / L); MgSO4·6H2O (1 g / L); CaCl2 (0.01 g / L); NH4Cl (1 g / L); peptone (10 g / L); yeast extract (5 g / L); NaCl (10 g / L).

[0053] The normal culture medium (LB) contained the following ingredients: peptone (10 g / L); yeast extract (5 g / L); NaCl (10 g / L).

[0054] The liquid culture medium does not contain agar, and the solid culture medium is prepared by adding agar to the liquid culture medium formula, and the final concentration of agar in the culture medium is 15 g / L.

[0055] The culture medium was sterilized in an autoclave at 121°C for 30 min before use.

[0056] 2 Experimental methods

[0057] 2.1 Isolation, screening and identification of target strains

[0058] 1. Isolation and screening of strains

[0059] Weigh 1g of tailings sample into a 15mL centrifuge tube, add 9mL of sterilized PBS solution in a clean bench, shake thoroughly at 160r / min for 30min, let stand for 15min until complete stratification, and obtain the original tailings solution, which is then gradiently diluted to a concentration of 10 -1 -10 -6 times the tailings sample dilution, and pipette 100 μL of the prepared tailings dilutions of different concentrations into the solid screening medium, evenly apply them on the solid screening medium, and gently spread them evenly with a spreader. Make 3 sets of repeated samples for each concentration gradient, and then place them in a constant temperature incubator at 37°C for static culture. Pay attention to observation after 18 hours. Once a complete and independent colony is formed, it needs to be picked and cultured as soon as possible to find the most suitable tailings dilution concentration. Then select single strains of different colonies in the liquid enrichment medium, cover the lid and shake and culture at 37°C and 160r / min.

[0060] When sticky, translucent colonies are observed in the culture medium, use an inoculation loop to dip the colonies in the liquid screening medium, streak culture on the solid screening medium, purify and isolate the bacteria, and culture in a microbial incubator at 37°C for 18 hours.

[0061] Select a single colony in the culture medium, use a pipette tip to pick up the colony, and put it into a new liquid screening culture medium. After blowing it several times, the purification is completed. Depending on the state of the colony, 3-5 single bacteria are picked for culture. Repeat this process three times to ensure that pure bacterial colonies are obtained.

[0062] 2. Identification of bacterial species

[0063] The strains were preliminarily identified based on their Gram staining results, morphological characteristics, and physiological characteristics. The 16S rRNA gene sequence was sequenced and compared with the NCBI library to determine that the strains screened were Pseudomonas, and a phylogenetic tree was constructed.

[0064] 16S rDNA universal primers: 27F (5'-AGAGTTTGATCMTGGCTCAG-3', SEQ ID NO.2) and 1492R (5'-TACGGYTACCTTGTTAYGACTT-3', SEQ ID NO.3). Sequencing was completed by Guangdong Meige Gene Technology Co., Ltd.

[0065] 2.2 Verification of the removal of heavy metals by Pseudomonas aeruginosa

[0066] Take the selected Pseudomonas aeruginosa strains and culture them in liquid screening medium at 37°C until OD 600 =1, take the bacterial solution for subsequent experiments. Set up two experimental groups: bacterial group and sterile group:

[0067] Bacteria group: 1 mL of Pseudomonas aeruginosa solution was inoculated into 40 mL of Pb 2+ In LB liquid medium, Pb 2+ The initial concentration in the LB liquid culture medium was 5 mg / L. The culture medium was placed in a constant temperature shaker at 37°C and cultured at 160 r / min. Samples were taken every 24 hours to measure the heavy metal concentration in the samples, and 3 parallel samples were set for each concentration.

[0068] Sterile group: The experimental method was the same as that of the bacterial group, except that no Pseudomonas aeruginosa solution was added.

[0069] 2.3 Factors affecting bacterial removal rate

[0070] Take the selected Pseudomonas aeruginosa strains and culture them in liquid screening medium at 37°C until OD 600 =1, take the bacterial solution for subsequent experiments.

[0071] 1. Set up experimental groups with different heavy metal concentrations

[0072] Take 1mL of Pseudomonas aeruginosa culture solution and inoculate it into 40mL of 5mg / L heavy metals (Pb 2+ 、Zn 2+ 、Cd 2+ Cr 6+ ) in LB liquid culture medium, and place the culture medium in a constant temperature shaker at 37°C for culture at 160r / min. The heavy metal concentration after the culture medium and the bacterial solution are evenly mixed is taken as the initial concentration. The heavy metal concentration in the culture medium is measured every 24 hours, and 3 parallel samples are set for each concentration.

[0073] Take 1mL of Pseudomonas aeruginosa culture solution and inoculate it into 40mL of 50mg / L heavy metals (Pb 2+ 、Zn 2+ 、Cd 2+ Cr 6+ ) in LB medium, and place the medium in a constant temperature shaker at 37°C for culture at 160r / min. The heavy metal concentration after the medium and the bacterial solution are evenly mixed is taken as the initial concentration. Sampling is performed once every 24 hours to determine the heavy metal concentration in the sample, and 3 parallel samples are set for each concentration.

[0074] 2. Set up the experimental group with additional carbon and nitrogen sources

[0075] The experimental group with additional carbon and nitrogen sources: physiological saline containing 5 mg / L heavy metals, 0.5 wt% glucose and 0.5 wt% sodium nitrite. Two control groups were also set up:

[0076] Sample group without additional carbon source: that is, no glucose was added to the normal saline, containing 5 mg / L heavy metals + 0.5 wt% sodium nitrite;

[0077] The sample group without additional nitrogen source: that is, no sodium nitrite was added to the normal saline, and it contained 5 mg / L heavy metals + 0.5 wt% glucose.

[0078] 1 mL of Pseudomonas aeruginosa bacterial solution was inoculated into 40 mL of normal saline (three experimental groups were included: containing additional carbon source and nitrogen source, without additional carbon source, and without additional nitrogen source), and then cultured in a constant temperature shaker at 30°C and 160 r / min. Samples were taken every 24 hours to determine the heavy metal concentration in the samples, and three parallel samples were set for each concentration.

[0079] 3. Heavy metal determination method

[0080] The samples were centrifuged at 4000 r / min for 5 min using a refrigerated centrifuge and filtered with a 0.45 μm filter membrane. The supernatant was used to determine the heavy metal concentration. The heavy metal ions (Pb 2+ 、Zn 2+ 、Cd 2+ Cr 6 + )concentration:

[0081] F-AAS instrument test conditions: wavelength: 283.3nm; slit width: 1.3mm; lamp current: 7.5mA; flame type: Air-C2H2; gas flow rate: 2L / min; auxiliary gas flow rate: 15L / min. The standard solutions with concentrations of 0, 1, 5, 10, 15, and 20mg / L were measured, and the standard curve was automatically generated by the flame atomic absorption spectrometer.

[0082] The calculation formula for heavy metal removal rate is:

[0083]

[0084] Where:

[0085] C0——heavy metal ion concentration before treatment;

[0086] C i ——Heavy metal ion concentration after treatment.

[0087] 3 Experimental results and analysis

[0088] 3.1 Identification of target strains

[0089] A strain (number: QPBII-1) was isolated by screening the screening medium. A single colony was isolated by streaking on a solid culture medium. After culturing at 37°C for 18 hours, a 1-2 mm yellow-green colony was formed with neat, moist edges and a convex middle. The colony morphology was Figure 2 After Gram staining, microscopic examination showed that Pseudomonas was a Gram-negative bacterium with a rod-shaped shape.

[0090] The isolated strain was subjected to 16S rRNA identification, and the gene sequence was determined as follows (SEQ ID NO.1):

[0091] GGGAGCTTGCTCCTGGATTCAGCGGCGGACGGGTGAGTAATGCCTAGGAATCTGCCTGGTAGTGGGGGATAACGTCCGGAAACGGGCGCTAATACCGCATACGTCCTGAGGGAGAAAGTGGGGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCAACAGAATAAGCACCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCAGCAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTACTGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCGACTAGCCGTTGGGATCCTTGAGATCTTAGTGGCGCAGCTAACGCGATAAGTCGACC。

[0092] The gene sequences were aligned using CLUSTALW and a phylogenetic tree was constructed using the neighbor-joining method as Figure 1As shown. According to sequence comparison analysis, the 16S rRNA gene sequence of the isolated strain has a similarity of 99.80% with Pseudomonas aeruginosa strain QK-1, 99.90% with Pseudomonas sp. H-59, and 99.90% with Pseudomonas aeruginosa strain PZ25. The phylogenetic tree ( Figure 1 ) all sequences have a similarity of more than 90%. The bacterial isolate was analyzed based on phenotypic and genotypic characteristics, and it was determined that the isolate was Pseudomonas aeruginosa, a Gram-negative bacterium, a motile species with polar flagella, and its colonies were smooth, raised, with complete and shiny edges, and were yellow-green in LB solid culture medium.

[0093] According to the growth curve, the logarithmic growth period of the bacteria is 4 to 8 hours. Figure 3 ) is a standard S-shaped curve with four distinct phases: hysteresis phase, logarithmic phase, stable phase, and decay phase. The bacterial solution entered the stable phase at the 12th hour and reached OD 600 =1. To ensure the stability and activity of the bacterial solution, the 12th hour bacterial solution was selected for subsequent operations in subsequent experiments.

[0094] The deposit information of Pseudomonas aeruginosa QPBII-1 is as follows:

[0095] The strain QPBII-1 was sent to the General Microbiology Center of China Microorganism Culture Collection Administration (CGMCC) for preservation in August 2024. The address of the preservation unit is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing; preservation date: August 23, 2024; preservation number: CGMCC No.31703; classification name: Pseudomonas aeruginosa.

[0096] 3.2 Pseudomonas aeruginosa against Pb 2+ Has a removal effect

[0097] The experimental results of the bacterial group and the sterile group are as follows Figure 4 Shown: Pb in the same culture medium but without Pseudomonas aeruginosa 2+ The concentration of Pb in the bacterial group remained almost unchanged over time. 2+ The concentration gradually decreased with time. When it was close to 100h, Pb 2+ The concentration is close to 0, indicating that Pb 2+The decrease in concentration is due to the action of Pseudomonas aeruginosa, not the reaction between the culture medium and heavy metals.

[0098] 3.3 Removal rate of heavy metals by Pseudomonas aeruginosa

[0099] The removal rates of heavy metals by Pseudomonas aeruginosa are shown in Figure 5 as shown in .

[0100] At low concentrations ( Figure 5 A), Pseudomonas aeruginosa QPBII-1 has a significant improvement in the removal of heavy metals: the initial concentration of Pb in the experimental group was 5 mg / L. 2+ 、Zn 2+ 、Cd 2+ Cr 6+ The highest removal rates reached 98.21%, 82.86%, 74.88% and 85.68% respectively.

[0101] At high concentrations ( Figure 5 B), the removal capacity of Pseudomonas aeruginosa was significantly reduced. When the initial heavy metal concentration was 50 mg / L, the removal rate of heavy metals by the strain decreased to 22.82% (Pb 2+ )、45.38%(Zn 2+ ), 52.78%(Cd 2+ )、31.45%(Cr 6+ ), which proves that although Pseudomonas aeruginosa can grow at high concentrations, its ability to remove heavy metals is inhibited to a certain extent.

[0102] The highest removal rates of eight experimental groups with different heavy metals were compared. The strain had a better removal rate when the heavy metal concentration was low. When the heavy metal concentration increased, the tolerance of the bacteria to heavy metals decreased, the growth was inhibited, and the ability to remove metals remained at a low level, indicating that Pseudomonas aeruginosa had a higher removal rate at low concentrations. As the initial heavy metal concentration increased, the effect of the strain on heavy metals weakened, which may be because the high concentration of heavy metals inhibited the strain's ability to degrade heavy metals.

[0103] Pseudomonas aeruginosa QPBII-1 and the initial concentration of 5 mg / L Pb 2+ XPS characterization of the reacted sediments showed a Pb 4f peak at 136.73 eV ( Figure 6 a), proving the existence of Pb(0). At the same time, the sample shows an O1s peak at 530.53 eV ( Figure 6b), that is, the oxygen element exists in the form of metal oxide, which proves the existence of PbO. Considering that the surface of metallic lead oxidizes rapidly when exposed to air, forming a PbO layer that protects Pb(0) from further oxidation, this proves the possibility of Pb(0) oxidation in air, and also shows that the strain can absorb Pb in aqueous solution through mechanisms such as surface group adsorption and electron transfer. 2+ It is reduced to Pb(0) and then oxidized to PbO in air.

[0104] Reducing the concentration of free heavy metals in water means that the bioavailability of heavy metals in the environment is reduced, because ionic heavy metals are more easily absorbed by aquatic organisms, enter the organisms, and increase the risk of heavy metal exposure in the entire ecosystem. The following possibilities exist for the effect of Pseudomonas aeruginosa QPBII-1 on metal ions: Pseudomonas aeruginosa QPBII-1 captures and fixes ionic heavy metals in water through adsorption on the cell surface; at the same time, they use specific enzymes to carry out biotransformation, converting heavy metal ions into insoluble metal sulfides, phosphates or carbonates. These transformation products precipitate due to their extremely low solubility, further reducing the free concentration of heavy metals; Pseudomonas aeruginosa QPBII-1 may also reduce the toxicity and migration ability of heavy metals through biological reduction, such as reducing Pb(Ⅱ) to Pb(0). These processes work synergistically to effectively reduce the mobility and bioavailability of heavy metals in water, thereby significantly reducing the toxic effects of heavy metals.

[0105] 3.4 Removal rate of bacteria under different carbon and nitrogen source conditions

[0106] The results are as follows Figure 7 As shown in the experiment with or without the addition of additional carbon and nitrogen sources, the results show that the removal rate of heavy metals by the target bacteria decreased under the condition of no carbon and nitrogen sources, but still maintained a relatively good removal function, and the removal rate of the four heavy metals was above 40%. This ability may be due to the metabolic adaptability of the strains. They may compensate for the lack of external nutrition by utilizing internally stored nutrients or through other metabolic pathways, thereby maintaining their biological activity and heavy metal removal function.

[0107] This discovery further confirmed the adaptability and functionality of the target bacteria in maintaining its heavy metal removal function under oligotrophic conditions, indicating that its preparation as a microbial remediation agent has creative application value in environmental remediation and pollution control.

[0108] Example 2 Microbial remediation agent of the present invention

[0109] 1. Preparation method of microbial remediation agent

[0110] The silicon fertilizer material with an average pore size of 3.408nm prepared in the laboratory and modified nano zero-valent iron are used as carriers of the microbial remediation agent, and the fermented protein core chlorella algae liquid is combined to improve the nutritional environment of the microbial remediation agent, and then the Pseudomonas aeruginosa agent is loaded on the carrier to obtain the microbial remediation agent of the present invention. The specific material ratio and preparation process are as follows:

[0111] 1. Nano-zero-valent iron (nZVI) is synthesized by our laboratory:

[0112] Ferric chloride (FeSO4·7H2O) was selected as the precursor and sodium borohydride (NaBH4) as the reducing agent. 2.00g FeSO4·7H2O was weighed and dissolved in 100mL ethanol-water solution (30% v / v) to obtain a ferrous ion solution; 1.08g NaBH4 was dissolved in 50mL ethanol-water solution (30% v / v) to obtain a sodium borohydride solution; the prepared ferrous ion solution was mixed with the sodium borohydride solution, and ball milling was performed under the condition of controlling the pH value to be around 2-3. A large amount of black fluffy solids appeared during the reaction. After the reaction was completed, deoxygenated water and anhydrous ethanol were used to wash alternately three times, and the mixture was placed in a glove box under a nitrogen atmosphere and dried to obtain pure nano zero-valent iron powder, which was stored in a dry environment at 4°C to avoid light. Before the experiment, the nZVI powder was ultrasonically treated for 30 minutes to ensure uniform dispersion. Nano zero-valent iron can also be directly purchased from commercial nano zero-valent iron products.

[0113] 2. Silicon fertilizer materials are synthesized by our laboratory:

[0114] Granite and marble powder were dried at 70℃ for 12h, crushed by ball mill until they passed through 200 mesh sieve, and granite powder (WG) and marble powder (MD) were obtained for standby use. Using the "alkali activation-calcination" process, WG, MD and alkali activator (solid NaOH) were mixed in a mass ratio of 10:3:2, loaded into a ceramic crucible, and placed in a programmable temperature-controlled muffle furnace for calcination: the temperature was raised to 800℃ at a heating rate of 10℃ / min, and calcined for 1h. After cooling, it was ground through a 100 mesh sieve to obtain silicon fertilizer.

[0115] 3. Preparation of Chlorella pyrenoidosa liquid:

[0116] The algae liquid is formed by expanding the algae species cultured in the laboratory, the algae species is Chlorella pyrenoidosa, and the algae species used are long-term stored in the laboratory where the research team is located. Commercially available Chlorella pyrenoidosa products can also be directly purchased for use in the present invention.

[0117] Chlorella pyrenoidosa was inoculated into BG11 medium at a rate of 5% and cultured at 25°C and 1500 lux / m 2After fermentation for 15 days under the light conditions of , the fermentation broth was collected, the pH value was adjusted to 6.8 ± 0.2, and centrifuged and sterilized. After centrifugation, the supernatant was discarded, the algal cells were collected, washed with sterile water, and resuspended in an appropriate amount of sterile water to prepare a concentration of 10 7 ~10 8 cells / mL of algal liquid.

[0118] 4. Preparation of carrier:

[0119] The prepared pyrenoid chlorella algae liquid is mixed with silicon fertilizer and nano zero-valent iron in proportion as a carrier of the microbial remediation agent. In this embodiment, a total of five carriers are prepared: wherein the mass ratios of pyrenoid chlorella algae liquid, silicon fertilizer, and nano zero-valent iron are 10:1:1, 15:1:1, 20:1:1, 10:0:1, and 10:1:0, respectively. Considering the cost-effectiveness issue, at the same weight, the material cost of nano zero-valent iron and silicon fertilizer is much higher than that of pyrenoid chlorella algae liquid, so the experimental group with a carrier ratio of 0:1:1 is not set.

[0120] 5. Preparation of microbial remediation agent:

[0121] The isolated Pseudomonas aeruginosa QPBII-1 strain was expanded and cultured using the screening medium in Example 1 at 37°C in a shaker at 160 rpm until the OD 600 = 1. The cultured bacterial agent was centrifuged at 4000 rpm for 5 min, and the sediment was retained. The suspension was suspended to 1.6×10 8 CFU / mL, and obtain liquid bacterial agent.

[0122] The liquid bacterial agent and the carrier are mixed in a mass ratio of 1:1, stirred at 30°C and 200rpm for 3min, and then centrifuged at 4°C and 4000rpm for 4 minutes using a refrigerated centrifuge, and the supernatant is discarded. 10wt% trehalose is added to the precipitate as a freeze-drying protective agent, mixed evenly, freeze-dried using a vacuum freeze dryer, and packaged after drying to obtain a microbial repair agent. The method of freeze drying in a vacuum freeze dryer is: the material mixed evenly with the freeze-drying protective agent is placed in a sterile centrifuge tube or a sterile plastic bag, and pre-frozen in a cold trap of a vacuum freeze dryer below -40°C for 2 hours, and then the pre-frozen sample is placed in the drying box of the freeze dryer, and freeze drying is started at a temperature of -90°C and a vacuum degree of <20Pa, and freeze drying is terminated after the material is freeze-dried to a constant weight.

[0123] Five different microbial remediation agents were prepared (ie, the distribution ratios of the carrier groups were different).

[0124] 2. Application of microbial remediation agents in tailings

[0125] The Guangdong Fankou lead-zinc tailings sample was spread flat in the experimental area with a thickness of about 5 cm. The prepared microbial remediation agent was evenly sprayed on the tailings surface using a handheld dry powder spray gun with a spraying amount of about 5 g / m 2 After spraying, use a sterilized stainless steel spatula to mix it evenly. Then, place the experimental area indoors, maintain the temperature at 20±5℃, and the relative humidity of the tailings sample at 60±10%. During the experiment, the tailings sample was sprayed with water mist every 24 hours to maintain a constant humidity. At the same time, only Pseudomonas aeruginosa QPBII-1 was suspended in PBS to 1.6×10 8 CFU / mL of liquid bacterial agent without carrier repair agent control, and untreated control without any repair agent.

[0126] On the 5th day after the application of the remediation agent, samples were taken from the tailings and the content and morphological changes of heavy metals in the samples were analyzed using atomic absorption spectrometry (AAS) and Tessier five-step extraction method. The experiment continued until the results of two consecutive sampling analyses showed that the morphological changes of heavy metals tended to be stable.

[0127] Tessier five-step extraction method is as follows:

[0128] Exchangeable state (F1): weigh about 1.0000g of sample into a 50mL polyethylene centrifuge tube, accurately add 8mL 1mol / LMgCl2 (HNO3 acidified, pH 7.0), shake well, place in a constant temperature shaker for 1 hour (the shaking rate is 250rpm, to ensure that the mixture in the centrifuge tube is in a suspended state). The temperature is controlled at 22±5℃ (the same below), take out; centrifuge at 4000rpm for 4 minutes, transfer the supernatant through 0.45μm filtration into a polyethylene vial, add 1mL concentrated nitric acid and refrigerate at 4℃. Add about 8mL of ultrapure water to the residue, shake by hand to resuspend the residue, centrifuge at 4000rpm for 20 minutes, and discard the supernatant.

[0129] Carbonate bound state (F2): Add 8 mL of 1 mol / L NaAc (HAc acidified, pH 5.0) to the residue of the previous stage, shake well, place in a constant temperature (22±5°C) shaker for 5 hours, centrifuge at 4000 rpm for 4 minutes, and other steps are the same as before.

[0130] Iron and manganese oxide bound state (F3): Add 20 mL of 0.04 mol / L NH2OH·HCl 25% HAc solution to the residue from the previous step, adjust the pH to 2.0, place in a constant temperature water bath at (96±3)°C for 6 hours, cool, centrifuge at 4000 rpm for 4 minutes, and follow the same steps as before.

[0131] Organic matter bound state (F4): Add 3mL 0.02mol / L HNO3 solution and 5mL 30% H2O2 solution to the residue of step 3, and adjust the pH to 2.0. Nitrate at (85±2)℃ for 2 hours with intermittent stirring; add 3mL 30% H2O2 solution and continue nitrification for 3 hours with intermittent stirring; add 5mL 3.2mol / L NH4Ac 20% HNO3 solution, dilute to 20mL, and shake at constant temperature at (22±5)℃ for 30 minutes. Centrifuge at 4000rpm for 4 minutes, and other steps are the same as before.

[0132] Residue state (F5): Take out the residue from the previous level, dry it at 105℃ and then digest it. The determination steps refer to the total amount determination method to extract the residual heavy metals.

[0133] After each step is completed, the supernatant needs to be centrifuged and stored, and the heavy metal concentration in this form is determined by atomic absorption spectroscopy (F-AAS). The F-AAS instrument test conditions are the same as those in Example 1.

[0134] 3. Results and Analysis

[0135] 1. Material characterization of microbial remediation agents

[0136] The material characterization of the microbial remediation agent prepared with Chlorella pyrenoidosa liquid, silicon fertilizer and nano zero-valent iron in a mass ratio of 10:1:1 was carried out. Figure 8 ), through the SEM image, it can be seen that there are a large number of bacteria attached to nano zero-valent iron on the surface of the material, and at the same time, a peak can be observed at 706eV in the XPS image, which can further prove the existence of nano zero-valent iron in the microbial remediation agent, and prove that the nano zero-valent iron and other materials in the microbial remediation agent suffer less loss during the preparation process, and the carrier can still maintain its original function after the preparation is completed.

[0137] The active silicon in the remediation agent can enhance the soil's adsorption capacity for heavy metals by forming co-precipitation with heavy metals in the soil, increasing the soil's cation exchange capacity (CEC) and organic matter (OM) content, etc. At the same time, active silicon has a high specific surface area, which can provide sufficient attachment sites for microorganisms, which is conducive to the attachment and growth of microorganisms; nano zero-valent iron assists in the removal of various heavy metal ions through the synergistic effects of adsorption, reduction, precipitation and co-precipitation. At the same time, nano zero-valent iron has a certain pH adjustment function, which assists the microorganisms and algae in the microbial remediation agent to colonize in the tailings; the fermented algae liquid can provide certain nutrients and additional carbon sources for the colonization of microorganisms, enhance the activity of microorganisms, and enhance the environmental adaptability and stability of the remediation agent, so that it can maintain a high remediation efficiency in the highly polluted, oligotrophic and high-pressure environment of tailings.

[0138] 2. Comparison of repair effects

[0139] The effects of microbial remediation agents with different carrier component ratios on heavy metals in tailings samples were explored by comparing the heavy metal morphology data before and after remediation. In untreated tailings samples, the distribution of heavy metal forms of Pb, Zn, Cd and Cr showed that the four heavy metals mainly existed in a residual state, accounting for 43%, 34%, 51% and 44% of their total amount, respectively; followed by iron and manganese oxide binding states, accounting for 20%, 24%, 19% and 20%, respectively. Although these metals exist mainly in a residual state, the proportion of the residual state does not exceed 50%, proving that the heavy metals in the tailings samples are still in a state that may be absorbed and utilized by plants and organisms, and there is a greater risk of contaminating the surrounding ecosystem through migration and transformation. Therefore, it is particularly necessary to transform the heavy metal form into a more stable form and further increase the proportion of organic binding and residual states.

[0140] After 5 days of applying the microbial remediation agent, the results showed that ( Fig. 9 ): Compared with the control group without any repair agent, the different forms of heavy metals in the experimental group with the repair agent showed a significant transformation trend. Only the carrier-free group of Pseudomonas aeruginosa showed a certain ability to transform heavy metal forms, which increased the organic binding state (F4) of heavy metals Pb, Zn, and Cd by 1%, 2%, and 3% of the total amount, and the residual state (F5) by 7%, 9%, 5%, and 6% respectively; accordingly, the exchangeable state (F1) and carbonate binding state (F2) of heavy metals (Pb, Zn, Cd, Cr) decreased significantly, among which the exchangeable state decreased more significantly, and the four heavy metals decreased to 5%, 7%, 7%, and 5% respectively; the iron-manganese oxide binding state of heavy metals did not change significantly, which may be because the microorganism has little effect on this form of heavy metals. In general, the treatment of Pseudomonas aeruginosa can promote the transformation of these heavy metal elements from forms that are easier to be absorbed and utilized by plants to forms that are difficult to be absorbed and utilized by plants.

[0141] In the remediation agent treatment group containing a carrier, no matter what carrier the microbial remediation agent is loaded with, the heavy metal conversion efficiency of heavy metals Pb, Zn, Cd, and Cr is higher than that of the heavy metal remediation agent without a carrier. The effects of increasing the proportion of the residual state (F5) and decreasing the proportion of the exchangeable state (F1) and carbonate-bound state (F2) are more obvious.

[0142] In contrast, different carrier ratios produced different effects on the distribution of heavy metal forms. When three carriers were used simultaneously, for the heavy metal Pb, the morphological transformation effect of the carrier ratio of 20:1:1 was better than that of the ratio of 10:1:1; for the heavy metals Zn, Cd, and Cr, the remediation agent with a ratio of 10:1:1 had a better final effect. In the microbial remediation agent prepared with a mass ratio of 10:1:1 of Chlorella algae liquid, silicon fertilizer, and nano-zero-valent iron, the percentage of Pb in F1 decreased from 6% to 2%, Zn from 7% to 4%, Cd from 10% to 2%, and Cr from 7% to 2%. On the contrary, in F5, the percentages of Pb, Zn, Cd, and Cr increased to 50%, 44%, 64%, and 55%, respectively. . The reason for this phenomenon may be that lead (Pb) tends to combine with organic matter in the algae liquid, while zinc (Zn), cadmium (Cd), and chromium (Cr) may be more easily adsorbed or precipitated by silicon fertilizer or reduced by nano-zero-valent iron. For the heavy metal Zn, the percentage of the iron-manganese oxide-bound state (F3) decreased and increased after adding a relatively low proportion of algae liquid. This change may be due to the fact that the addition of algae liquid, nano-zero-valent iron and silicon fertilizer enhanced the adsorption capacity of Zn in the iron-manganese oxide-bound state (F3). Similarly, the experimental groups with only algae liquid and silicon fertilizer or only algae liquid and nano-zero-valent iron also showed a certain heavy metal conversion effect, but compared with the total percentage of the stable state (F3, F4, F5), it was proved that the repair effect of the three carriers added at the same time was better. After the tailings were repaired by the microbial remediation agent with the three carriers, the exchangeable state of the four metals was less than or equal to 5%. In general, the treatment with a carrier ratio of 10:1:1 had the most positive effect on the morphological distribution of Pb, Zn, Cd and Cr, because it promoted the formation of more stable forms, thereby reducing the environmental risk of heavy metals in the tailings. Combining the experimental results with cost accounting, the optimal ratio of the three carrier materials was finally determined to be 10:1:1.

[0143] The above results indicate that the application of microbial remediation agents promotes the transformation of heavy metals from forms with higher bioavailability to forms with lower bioavailability. The reason for this phenomenon may involve that the microorganisms in the microbial remediation agents change the chemical forms of heavy metals in the soil through their metabolic activities. Pseudomonas aeruginosa may promote the precipitation and fixation of heavy metals by secreting organic acids, chelating agents and other substances to reduce the soil pH. In addition, the metabolites of Pseudomonas aeruginosa may form insoluble complexes with heavy metals, thereby reducing the bioavailability of heavy metals. At the same time, carbonate precipitation (MICP) induced by Pseudomonas aeruginosa may also promote the fixation of heavy metals. Carbonates combine with heavy metal ions to form insoluble carbonates, reducing the bioavailability of heavy metals. These biochemical processes work together to cause the transformation of heavy metal forms from exchangeable to residual states, thereby reducing the environmental risks of heavy metals.

[0144] At the same time, the tailings pond is an oligotrophic environment. Without the addition of other modifiers (such as additional carbon sources, nitrogen sources), the microbial remediation agent of the present invention still has the function of changing the form of heavy metals, which further illustrates that the microbial remediation agent of the present invention has good application value in heavy metal management and bioremediation of tailings ponds.

Claims

1. A microbial remediation agent for heavy metal remediation, characterized in that: The method is prepared by loading Pseudomonas aeruginosa onto a carrier; the carrier comprises the following components in weight proportions: 8 to 22 parts of Chlorella pyrenoidosa algae liquid, 1 to 3 parts of silicon fertilizer, and 1 to 3 parts of nano zero-valent iron; The silicon fertilizer is prepared by mixing granite powder, marble powder and alkali activator in a mass ratio of 8-12:0-12:0.5-4, calcining at 600-1000° C. and preparing into particles of 60-200 meshes; The alkaline activator is solid sodium hydroxide or potassium hydroxide.

2. The microbial remediation agent according to claim 1, characterized in that: The cell number concentration of the pyrenoid chlorella algae liquid is 10 6 ~10 9 / mL; The microbial remediation agent is a 1.0×10 7 ~2.0×10 8 The CFU / mL Pseudomonas aeruginosa bacterial solution and the carrier are mixed at a mass ratio of 1 to 3:1 and then freeze-dried to obtain a powder; The silicon fertilizer is prepared by mixing granite powder, marble powder and alkali activator in a mass ratio of 8-12:2-8:1-3, calcining at 700-900° C. for 20-120 minutes to form particles of 80-150 meshes.

3. The microbial remediation agent according to claim 1, characterized in that: The carrier comprises the following components in weight proportion: 10-20 parts of Chlorella pyrenoidosa liquid, 1-3 parts of silicon fertilizer, and 1-3 parts of nano zero-valent iron; or, The carrier comprises the following components in weight proportions: 10-15 parts of pyrenoid chlorella algae liquid, 1-2 parts of silicon fertilizer, and 1-2 parts of nano zero-valent iron; preferably: 10-13 parts of pyrenoid chlorella algae liquid, 1-1.5 parts of silicon fertilizer, and 1-1.5 parts of nano zero-valent iron; The heavy metals include Pb, Zn, Cd, and Cr; The Pseudomonas aeruginosa is deposited in the General Microbiological Center of China National Microbiological Culture Collection Administration, with the deposit number being CGMCC No.31703.

4. The method for preparing the microbial remediation agent according to any one of claims 1 to 3, characterized in that: The method comprises the following steps: taking a bacterial liquid of Pseudomonas aeruginosa and a carrier, and mixing them evenly according to a certain proportion to obtain the product.

5. The preparation method according to claim 4, characterized in that: The steps include: (1) Preparation of Pseudomonas aeruginosa bacterial solution: Take the Pseudomonas aeruginosa strain and inoculate it into the culture medium for expansion culture until OD 600 = 0.5-1.2, then centrifuge to collect the cells, and suspend the cells in PBS buffer, physiological saline or sterile water to the set concentration; (2) Preparation of carrier Preparation of silicon fertilizer: Mix granite powder, marble powder and alkali activator according to mass ratio, calcine at 600-1000°C for 20-120 minutes to prepare 60-200 mesh particles; Preparation of Chlorella pyrenoidosa algae liquid: Take Chlorella pyrenoidosa algae seeds and inoculate them into the culture medium for expansion culture until the growth retardation period ~ stable period, then collect the algae by centrifugation, and resuspend the algae in sterile water, saline or PBS buffer solution to a cell number concentration of 10 6 ~10 9 / mL; The pyrenoid chlorella algae liquid, silicon fertilizer and nano zero-valent iron are mixed evenly according to a certain proportion to obtain a carrier; (3) Preparation of microbial remediation agents Take the prepared Pseudomonas aeruginosa bacterial solution and the carrier, mix them evenly according to the proportion, and obtain the product.

6. The preparation method according to claim 5, characterized in that: In the step (3), the prepared Pseudomonas aeruginosa bacterial solution and the carrier are mixed evenly according to a proportion, and then centrifuged to collect the precipitate to obtain; Preferably, the precipitate is freeze-dried into powder to obtain the microbial repair agent, and the specific steps are: take the prepared Pseudomonas aeruginosa bacterial solution and the carrier, mix them evenly according to the proportion, centrifuge at 4-10°C, discard the supernatant, collect the precipitate, add a lyophilization protective agent according to 8-12wt% of the weight of the precipitate, mix well, and use a vacuum freeze dryer to freeze dry to obtain; preferably, the lyophilization protective agent is trehalose.

7. Use of the microbial remediation agent according to any one of claims 1 to 3 in remediating heavy metal pollution in an environment, wherein the environment includes heavy metal contaminated soil, tailings, and tailings ponds.

8. The use according to claim 7, characterized in that: The heavy metals include Pb, Zn, Cd, and Cr. 3 to 7 grams of microbial remediation agent is added to every 0.05 cubic meters of the sample to be treated. The microbial remediation agent is applied to the sample to be treated, mixed evenly, and then allowed to stand for 3 to 7 days. During the remediation period, the humidity in the sample is maintained at 60±10%.

9. The use according to claim 8, characterized in that: The microbial remediation agent is applied once every 3 to 7 days, and the solution is left to stand after application. The microbial remediation agent is applied multiple times until the toxic form of heavy metals therein is reduced to below the target concentration.

10. The use according to claim 8 or 9, characterized in that: The environment is a lead-zinc tailings pond, and the microbial remediation agent is sprayed in the lead-zinc tailings pond, mixed evenly, and allowed to stand.

Images