A nucleic acid aptamer binding to CD5 protein and its application

Abstract

The present invention discloses a nucleic acid aptamer binding to CD5 protein, the sequence of which is shown in SEQ ID NO.1 to SEQ ID NO.6, and by improving the screening conditions, a nucleic acid aptamer with small molecular weight, stable chemical properties, easy storage and labeling, which can bind to CD5 protein with high affinity, is screened and obtained. The aptamer is measured by surface plasmon resonance (SPR) and dot hybridization experiments to have high affinity and high specificity, and can be used in detection, diagnosis, imaging and treatment, and has broad application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a nucleic acid aptamer binding to CD5 protein and an application thereof. Background Art

[0002] T-cell surface glycoprotein CD5, also known as Lymphocyte antigen T1 and Leu-1, is a 67kDa single-chain transmembrane glycoprotein in the scavenger receptor superfamily. Members of this family are secreted or membrane-anchored proteins that are mainly found in cells associated with the immune system. This protein is a single-channel type I transmembrane glycoprotein that exhibits topological domains and transmembrane features in its subcellular localization, and is mainly found on the surface of thymocytes, T lymphocytes, and B lymphocyte subsets. It has recently been recognized as a marker for mouse and human DC subsets.

[0003] Since the rise of research on nucleic acid aptamers binding to CD5 protein in the biomedical field, its potential in immune regulation, disease diagnosis and treatment has gradually emerged. As an important marker on the surface of T cells, CD5 protein is closely related to a variety of immunopathological processes, especially playing a core role in T cell lymphoma, autoimmune diseases and certain infectious diseases. However, although some progress has been made in the research on CD5 protein and its related nucleic acid aptamers, the existing nucleic acid aptamer technology binding to CD5 protein still faces many challenges.

[0004] According to multiple studies, although the currently screened nucleic acid aptamers that bind to CD5 protein can bind to CD5 protein to a certain extent, their actual application effects are mixed. These aptamers often have problems such as large molecular weight, unstable chemical properties, and difficulty in preservation. In addition, their affinity and specificity are often not effectively guaranteed during the binding process with CD5 protein. These problems not only limit the accuracy of aptamers in disease diagnosis, but also affect their effectiveness in treatment.

[0005] Especially in the field of disease diagnosis, although the existing detection methods based on nucleic acid aptamers that bind to CD5 proteins have developed, they still have many shortcomings. For example, some detection methods rely on specific instruments and equipment, which are complicated and costly to operate and cannot meet the needs of clinical rapid and accurate diagnosis. In addition, due to the stability of aptamers, some detection methods are prone to false positive or false negative results in actual applications, further increasing the difficulty and risk of diagnosis.

[0006] Meanwhile, in terms of treatment, although some studies have attempted to use nucleic acid aptamers that bind to CD5 proteins for targeted therapy, the binding force between the aptamers and CD5 proteins is not strong enough or the specificity is not high enough, which often leads to poor treatment effects. This not only wastes medical resources, but also brings unnecessary pain and burden to patients. Summary of the invention

[0007] In order to overcome at least one of the defects described in the above-mentioned prior art, the present invention provides a nucleic acid aptamer binding to CD5 protein and its application, which can provide a nucleic acid aptamer that can bind to CD5 protein with high affinity and has a small molecular weight, stable chemical properties, easy storage and labeling, and can maintain high affinity and high specificity binding to CD5 protein, and can be used for detection, diagnosis, imaging and treatment, etc., and has broad application prospects.

[0008] The technical solution adopted by the present invention to solve the problem is:

[0009] A nucleic acid aptamer that binds to CD5 protein, the nucleic acid aptamer having a nucleotide sequence as shown in SEQ ID NO.1; or a nucleotide sequence that has at least 30% homology with SEQ ID NO.1 and binds to CD5 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in SEQ ID NO.1.

[0010] Based on the SELEX technology, the inventors designed and synthesized a random single-stranded DNA library and corresponding primers to screen for nucleic acid aptamers that have small molecular weight, stable chemical properties, are easy to store and label, and can bind to CD5 protein with high affinity. Thus, a nucleic acid aptamer that binds to CD5 protein with high affinity is obtained, which is FF-01 (SEQ ID NO.1). The nucleic acid aptamer has high affinity with CD5 protein and high specificity.

[0011] It can be understood that the nucleotide sequence that has at least 30%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 96%, at least 98% or at least 99% homology with the nucleic acid aptamer provided by the present invention and binds to the CD5 protein, for example, the nucleotide sequence shown in any one of the above nucleic acid aptamers can be deleted or added, and still has a high affinity with the CD5 protein and is still within the scope of protection of the present invention.

[0012] In some ways, as an improvement to the above technical solution, a certain position on the nucleotide sequence of the above-mentioned nucleic acid aptamer can be modified, for example, phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium or isotopization, etc., provided that the nucleic acid aptamer sequence obtained after such modification has desirable properties, for example, it can have an affinity for binding to CD5 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0013] Therefore, in some embodiments, the nucleotide sequence of the nucleic acid aptamer is modified and the modified nucleic acid aptamer specifically binds to the CD5 protein, and the modification is selected from at least one of phosphorylation, methylation, amination, thiolation, replacement of oxygen with sulfur, replacement of oxygen with selenium and isotopization, which is still within the scope of protection of the present invention.

[0014] On the other hand, the present invention provides a conjugate or derivative of a nucleic acid aptamer, wherein the nucleic acid aptamer has a nucleotide sequence as shown in SEQ ID NO.1; the conjugate of the nucleic acid aptamer includes a fluorescent marker; the derivative of the nucleic acid aptamer includes a thiophosphate backbone or peptide nucleic acid that binds to the CD5 protein, which is modified from the nucleotide sequence backbone of the nucleic acid aptamer or the conjugate of the nucleic acid aptamer.

[0015] The conjugate of the nucleic acid aptamer described in the present invention refers to connecting other groups to the nucleic acid aptamer, such as fluorescent markers with marking functions, such as FAM, radioactive substances, therapeutic substances, biotin, digoxin, nanoluminescent materials, small peptides, siRNA or enzyme labels, so that the nucleic acid aptamer sequence obtained after modification has desirable properties, for example, it can have an affinity for binding to CD5 protein that is equal to or higher than that of the parent nucleic acid aptamer sequence before modification, or although the affinity is not significantly improved, it has higher stability.

[0016] In other words, the above aptamers, whether partially substituted or modified, have substantially the same or similar molecular structures, physicochemical properties and functions as the original aptamers, and can be used to bind to CD5 protein.

[0017] In addition, the present invention also provides nucleic acid aptamer derivatives, which are obtained by transforming the nucleotide sequence skeleton of the above-mentioned nucleic acid aptamer into a phosphorothioate skeleton that binds to the CD5 protein, or are peptide nucleic acids that bind to the CD5 protein that are transformed from the nucleic acid aptamer or the conjugate of the nucleic acid aptamer in any of the above-mentioned technical solutions. The condition is that the derivatives have a molecular structure, physicochemical properties and functions that are substantially the same or similar to the original nucleic acid aptamer, and all bind to the CD5 protein.

[0018] The term "phosphorothioate backbone" as used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to that the non-bridging oxygen atoms of the phosphodiester backbone of RNA and DNA aptamers can be replaced by one or two sulfur atoms, resulting in a phosphorothioate backbone with phosphorothioate or phosphorodithioate bonds, respectively. Such phosphorothioate backbones are known to have increased binding affinity to their targets, as well as enhanced resistance to nuclease degradation.

[0019] The term "peptide nucleic acid" used in the present invention has the meaning generally understood by those of ordinary skill in the art, and refers to an artificially synthesized DNA molecule analog, first reported by Nielsen et al. in 1991. Oligonucleotide mimics linked by peptide bonds were synthesized using N-2-(aminoethyl)-glycine units instead of sugar-phosphate backbones as repeating structural units, and are called peptide nucleic acids. Since peptide nucleic acids (PNA) do not have phosphate groups like those on DNA or RNA, there is a lack of electrical repulsion between PNA and DNA, making the binding strength between the two greater than the binding strength between DNA.

[0020] In another aspect, the present invention provides a product for purifying or detecting CD5 protein, wherein the product comprises the nucleic acid aptamer as described above or the conjugate or derivative of the nucleic acid aptamer as described above; the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.

[0021] In another aspect, the present invention provides a method for screening a nucleic acid aptamer that binds to a CD5 protein, the method comprising the following steps:

[0022] (1) Synthesizing random single-stranded DNA library and primers;

[0023] (2) Magnetic bead screening: Perform at least 5 rounds of counter-screening and screening, and add serum in the 5th round.

[0024] Furthermore, in step (2), 5% serum was added in the fifth round, and the serum was human serum (normal human serum, purchased from Beijing Solebow Technology Co., Ltd., item number: SL010).

[0025] The method for screening nucleic acid aptamers binding to CD5 protein provided by the present invention is based on the SELEX screening method. In the step of magnetic bead screening, serum is added from the fifth round for blocking to further improve the specificity and stability of the nucleic acid aptamer.

[0026] The conventional conditions for nucleic acid aptamer screening are carried out in ionic buffers, while a certain concentration of serum is added under the screening conditions. On the one hand, because the serum contains abundant proteins, it can compete with the proteins on the surface of magnetic beads to bind to the library, thereby removing those sequences that have weak binding ability to the target CD5 protein or are only adsorbed. On the other hand, the aptamer binds to the target in the serum environment, which can better meet the actual detection environment of the later application based on nucleic acid aptamer development.

[0027] Studies have shown that the use of high-concentration serum in subsequent rounds of screening can screen for nucleic acid aptamers with higher affinity and better specificity.

[0028] In another aspect, the present invention provides use of the nucleic acid aptamer as described above, or a conjugate or derivative of the nucleic acid aptamer as described above for preparing a reagent for detecting or purifying CD5 protein.

[0029] In another aspect, the present invention provides use of the nucleic acid aptamer as described above, or a conjugate or derivative of the nucleic acid aptamer as described above for preparing a drug targeting CD5 protein.

[0030] In some embodiments, the present invention provides the use of the above-mentioned nucleic acid aptamer, its conjugate or its derivative in any one of the group consisting of:

[0031] 1) Quantitative or qualitative detection of CD5 protein;

[0032] 2) Purification of CD5 protein;

[0033] 3) Imaging of CD5 protein;

[0034] 4) Preparation of drugs targeting CD5 protein;

[0035] 5) Preparing reagents or drugs for diagnosing and treating abnormal CD5 expression.

[0036] The beneficial effects of the nucleic acid aptamer binding to CD5 protein provided by the present invention are:

[0037] 1. By improving the screening conditions, a nucleic acid aptamer with stable chemical properties, easy storage and labeling, which can bind to CD5 protein with high affinity and high specificity, was screened;

[0038] 2. The structure is relatively stable, simple, easy to modify, can be synthesized artificially in a short period of time, has stable chemical properties, and is easy to store and label;

[0039] 3. It can be used for detection, diagnosis, imaging and treatment, such as purification or high-sensitivity detection of CD5 protein; preparation of drugs targeting CD5 protein; reagents or drugs for diagnosis and treatment of abnormal CD5 expression, etc., and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a schematic diagram of the binding ability of the enriched library obtained in the first to fifth rounds of screening with the CD5 target protein detected by flow cytometry in Example 1;

[0041] Figure 2 This is the SPR affinity detection data diagram of the nucleic acid aptamer FF-01 and the CD5 target protein in Example 2;

[0042] Figure 3 The SPR affinity detection data of nucleic acid aptamer FF-01 and non-target proteins such as USO1, IL-12p40, KMT2C, LIFsR, and RRAGC in Example 3;

[0043] Figure 4 The binding of different concentrations of CD5 target protein was detected by the dot hybridization experiment based on nucleic acid aptamer FF-01 in Example 4. DETAILED DESCRIPTION

[0044] For better understanding and implementation, the technical solutions in the embodiments of the present invention will be clearly and completely described and discussed below in conjunction with the accompanying drawings of the present invention. Obviously, what is described here is only a part of the examples of the present invention, not all the examples. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0045] In order to facilitate the understanding of the embodiments of the present invention, the following will be further explained by taking specific embodiments as examples in conjunction with the drawings, and each embodiment does not constitute a limitation on the embodiments of the present invention.

[0046] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0047] Example 1: Screening of ssDNA nucleic acid aptamers for CD5 target protein

[0048] The method for screening ssDNA nucleic acid aptamers binding to CD5 targets in this embodiment comprises the following steps:

[0049] 1. Synthesize the random single-stranded DNA library and primers shown in the following sequence:

[0050] Random single-stranded DNA library:

[0051] 5'-TTCAGCACTCCACGCATAGC(36N)CCTATGCGTGCTACCGTGAA-3'(SEQ ID NO.2);

[0052] Among them, "36N" represents a sequence formed by connecting 36 arbitrary nucleotide bases. The library was synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0053] Primer information is shown in Table 1 and was synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0054] Table 1. Primers and their sequences

[0055] Primer name Sequence (5'-3') Lib13-S1 TTCAGCACTCCACGCATAGC(SEQ ID NO.3) Lib13-A2 CCTATGCGTGCTACCGTGAA(SEQ ID NO.4) Lib13-FAM-S1 FAM-TTCAGCACTCCACGCATAGC(SEQ ID NO.5) Lib13-Biotin-A2 Biotin-CCTATGCGTGCTACCGTGAA(SEQ ID NO.6)

[0056] Among them, S in the primer name represents the forward primer, and A in the primer name represents the reverse primer.

[0057] The primers were prepared into 100 μM storage solution with DPBS buffer (calcium chloride 0.1 g / L, potassium chloride 0.2 g / L, potassium dihydrogen phosphate 0.2 g / L, magnesium chloride hexahydrate 0.1 g / L, sodium chloride 8 g / L, sodium hydrogen phosphate dodecahydrate 2.8915 g / L; pH 7.4, 25°C) and stored at -20°C for later use.

[0058] 2. Target immobilized magnetic beads screening

[0059] The magnetic bead method was used for screening, and a total of 5 rounds of screening were performed. The screening process of each round is shown in Table 2.

[0060] Table 2. Screening process of CD5 target protein aptamers

[0061]

[0062]

[0063] The specific screening process is as follows:

[0064] 1) Carboxyl magnetic beads to immobilize CD5 protein

[0065] Take 50 μL of carboxyl magnetic beads (Jiangsu Zecheng Biotechnology Co., Ltd., catalog number: FM2221), wash them 4 times with 200 mL of DPBS, fish the beads with a magnet, and remove the supernatant. Take 100 μL each of the prepared NHS (N-hydroxysuccinimide; 0.1 M aqueous solution) and EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4 M aqueous solution), mix them in equal volumes, add them to the magnetic beads, incubate at 25°C for 20 minutes to activate the carboxyl groups on the surface of the magnetic beads, and wash the magnetic beads twice with DPBS buffer for later use.

[0066] Take 10 μL of CD5 protein (purchased from Abclonal, RP00158, concentration 1 mg / mL), add 80 μL of 10 mM sodium acetate at pH 5.5, mix well, and add to the above activated magnetic beads. Incubate at 25°C on a vertical mixer for 60 minutes, and the CD5 protein is coupled to the surface of the magnetic beads through the amino groups on the protein surface.

[0067] After the coupling is completed, place the coupling tube on a magnetic stand, discard the supernatant, take 100 μL 1M ethanolamine pH 8.5 and add it to the magnetic beads, incubate on a 25°C vertical mixer for 10 minutes to block the unreacted activation sites on the surface of the magnetic beads. Place on a magnetic stand and discard the blocking solution. Wash the magnetic beads 4 times with 200 μL DPBS and mark them as MB-CD5.

[0068] 2) Counter-screening and screening

[0069] Preparation of reverse screening magnetic beads: Couple the His protein to the magnetic beads. The His protein is synthesized by GenScript Biotech Co., Ltd. and is 9 consecutive histidines. The steps for coupling the His protein are the same as those for coupling the CD5 protein. The concentration of the His protein is 1 mg / mL, and it is diluted with a 10 mM NaAC solution at pH 4.0. Specifically, take 10 μL of His protein and add 80 μL of a 10 mM NaAC solution at pH 4.0 and mix well. The rest of the steps are the same. The coupled magnetic beads are labeled MB-His.

[0070] Library dissolution and denaturation treatment: Take 1OD random single-stranded nucleotide library, centrifuge at 12000rpm for 5 minutes, centrifuge the library to the bottom of the tube, dissolve it to 10μM with DPBS buffer, mix it and dispense it into PCR tubes for denaturation treatment. The treatment process is as follows: The PCR instrument is set to 95℃ for 10 minutes. The purpose of this step is to unwind the folded chain, then keep it at 4℃ for 5 minutes, and then balance it to room temperature. Add the treated library to 50μL of MB-His magnetic beads, mix it and incubate it at room temperature for 30 minutes on a vertical mixer. Place it on a magnetic stand, collect the supernatant, mark it as pool-, and use the supernatant as a single-stranded nucleic acid library for positive screening with MB-CD5 magnetic beads. In each round of magnetic bead screening, MB-His is used for reverse screening before the positive screening targeting CD5 protein, and the reverse screening supernatant is used as a single-stranded nucleotide library for positive screening with MB-CD5 magnetic beads. Specifically, add the library pool- after counter-screening to 50 μL MB-CD5 magnetic beads and incubate at 25°C for 40 minutes on a vertical mixer. Then, place it on a magnetic stand, discard the supernatant, retain the magnetic beads, and wash the magnetic beads 4 times with 200 μL DPBS. Finally, add 200 μL DPBS to the washed magnetic beads, boil them in a boiling water bath for 10 minutes, collect the supernatant, and mark it as elution-CD5.

[0071] The nucleic acid molecules in elution-CD5 were used as templates and amplified by ordinary PCR. The method is as follows: add all template elution-CD5 to 2mL PCR mix and mix well, divide the template and PCR mix mixture into 100μL / tube and add it to the PCR tube. The amplification conditions are as follows: 95℃ pre-denaturation for 2 minutes, 95℃ denaturation for 60 seconds, 60℃ annealing for 60 seconds, 72℃ extension for 60 seconds, a total of 25 cycles, and store at 4℃. PCR mix is ​​prepared with dNTPs (P031-02) purchased from Novozymes and rtaq enzyme (R500Z) purchased from Takara Biotech.

[0072] The amplified product was purified using commercially purchased Tiandirenhe SA magnetic beads (SM017100) to prepare a secondary library for the next round of screening. Add 1 / 5 volume of 4M sodium chloride to 2mL of PCR product, and then add 160uL of SA magnetic beads that have been washed with DPBS and the supernatant removed. After incubation on a shaker at room temperature for 30 minutes, remove the supernatant of the PCR product. Wash the magnetic beads three times with DPBS containing 0.02% Tween20, add 100uL of 40mM sodium hydroxide solution after removing the supernatant, and remove the magnetic beads by magnetic attraction after incubation for three minutes. Then add 4uL of 1M hydrochloric acid to the supernatant to neutralize the single chain, and then add 104uL of 2*DPBS to dilute and neutralize the salt concentration, and finally obtain 208uL of the secondary library dissolved in 1*DPBS, which can be used as the library for the next round of screening.

[0073] The magnetic bead method was repeated for 5 rounds. Each operation used the secondary library obtained in the previous operation as the starting nucleic acid library. After the library was denatured and renatured, it was incubated with MB-His and MB-CD5 magnetic beads for reverse and forward screening, respectively. Figure 1 As shown, flow cytometry was used to detect the changes in the CD5 protein recognition ability of the single-stranded DNA library in each round during the screening process. Figure 1 Tube1 represents the blank control, CD5-NEG-P(n) represents the affinity of each round of single-stranded DNA library with the reverse screening magnetic beads, and CD5-P(n) represents the affinity of each round of single-stranded DNA library with the positive screening magnetic beads. P1, P2, P3, P4, and P5 represent the libraries screened in the first, second, third, fourth, and fifth rounds, respectively. When the recognition ability of the single-stranded DNA library for CD5 protein meets the requirements, that is, the binding ability of the screened single-stranded DNA library with the target protein is higher than that of the library initially input for screening ( Figure 1 ), it can be seen that the single-stranded DNA library obtained in the 4th and 5th rounds has a high affinity to the target, and P5 is much higher than P1 and P2, which meets the sequencing requirements. The obtained single-stranded DNA library is analyzed by high-throughput sequencing.

[0074] 3. Analysis and identification of nucleic acid aptamers obtained after screening: After high-throughput sequencing analysis of the obtained enriched library products, several sequences were selected and synthesized by Genewise Biotechnology (Jiangsu) Technology Co., Ltd., and the affinity was tested.

[0075] In subsequent tests, one sequence with the strongest binding ability was identified from the 20 sequences obtained in the final fifth round. The nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.1 was named FF-01.

[0076] Example 2: Surface Plasmon Resonance (SPR) Detection of Affinity between Nucleic Acid Aptamer FF-01 and CD5 Target Protein

[0077] Suzhou Genewise Biotechnology Co., Ltd. was commissioned to synthesize the nucleic acid aptamer FF-01 (SEQ ID NO.1), which was diluted with DPBS buffer to 400 nM, 200 nM, 100 nM, 50 nM, 25 nM, and 12.5 nM, respectively.

[0078] 1. Couple the CD5 protein to the second channel on the surface of the CM5 chip. The specific method is as follows: first clean the chip with 50mM NaOH, inject 20μL, flow rate 10μL / min, then mix equal volumes of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride; 0.4M aqueous solution) and NHS (N-hydroxysuccinimide; 0.1M aqueous solution) and inject 50μL to activate the chip, flow rate 5μL / min. Dilute the CD5 protein with 10mM sodium acetate at pH 5.5 to a final concentration of 50μg / mL and inject it, the injection volume is 50μL, the flow rate is 5μL / min, and the CD5 protein coupling amount is 3500Ru. After the injection is completed, inject ethanolamine to block the chip, flow rate 10μL / min, and inject 100μL. The first channel is treated as above, the steps of coupling His protein, activation and blocking steps are exactly the same, and it is used as the control channel.

[0079] 2. Detection: Use a surface plasmon resonance instrument (GE Healthcare, model: Biacore 8K) to set the detection parameters. The diluted 6 aptamer samples flow through channels 1 and 2 in turn. The program for each aptamer is as follows: injection 30 μL / min, time 3 minutes, dissociation 30 μL / min, time 3 minutes, regeneration 1M NaCl 30 μL / min, time 30 seconds, and the diluted 6 nucleic acid aptamers are injected in turn.

[0080] The affinity test data of nucleic acid aptamer FF-01 and CD5 protein can be found in Figure 2 The KD value was 15.6nM, indicating the binding ability of the corresponding nucleic acid aptamer with the target protein CD5 protein. These data indicate that the FF-01 nucleic acid aptamer has a strong binding with the CD5 protein detected by the SPR instrument.

[0081] Example 3: Study on the specificity of nucleic acid aptamer FF-01

[0082] In this embodiment, USO1 protein, IL-12p40 protein, KMT2C protein, LIFsR protein, and RRAGC protein are used to replace CD5 protein, respectively. The method of fixing CD5 protein to the SPR chip for testing is the same as that in Example 3. USO1 protein, IL-12p40 protein, KMT2C protein, LIFsR protein, and RRAGC protein are coupled to the second channel of five Channals on the surface of the CM5 chip, and the coupling amounts are 2600RU, 3500RU, 4000RU, 2750RU, and 3200RU, respectively. The diluted FF-01 nucleic acid aptamer is injected in sequence.

[0083] The affinity test data of nucleic acid aptamer FF-01 and USO1 protein, IL-12p40 protein, KMT2C protein, LIFsR protein, and RRAGC protein are shown in Figure 3 .Depend on Figure 2 and Figure 3 It can be seen that the nucleic acid aptamer FF-01 cannot bind to USO1 protein, IL-12p40 protein, KMT2C protein, LIFsR protein, and RRAGC protein, which shows that it has very good specificity.

[0084] Example 4: Detection of CD5 protein by dot blot hybridization assay based on nucleic acid aptamer FF-01

[0085] The dot hybridization experiment steps performed in this example are as follows:

[0086] 1. Take a 8cm×2cm nitrocellulose membrane (purchased from Millipore), dilute the CD5 protein with DPBS to 0.500mg / ml, 0.250mg / ml, 0.125mg / ml, 0.063mg / ml, and 0.032mg / ml, respectively, spot 2ul of each sample onto the nitrocellulose membrane, and air-dry naturally for 30 minutes.

[0087] 2. After drying, place the test strip in a homemade incubation box, add 3 mL of 5% BSA to soak it, and block it on a shaker at room temperature for 1 hour. After blocking, use DPBS-T (containing 5 mM Mg 2+ , 0.02% Tween20) for 15 min, repeat the washing three times, and then aspirate the washing solution on the membrane.

[0088] 3. The biotin-modified FF-01 nucleic acid aptamer was diluted to 500 nM using DPBS containing 5 mM Mg2+, and then the diluted nucleic acid aptamer and the protein on the nitrocellulose membrane were incubated on a shaker at room temperature for 30 minutes.

[0089] 5. After incubation, wash three times with DPBS-T containing 5 mM Mg2+, placing on a shaker for 5 minutes each time.

[0090] 6. Add 5 mM Mg 2+ HRP-Streptavidin (purchased from Beyotime, catalog number A0303) was diluted 1:2000 in DPBS and incubated on a shaker at room temperature for 30 minutes.

[0091] 7. Contains 5mM Mg 2+ Wash three times with DPBS-T, placing on a shaker for 2 minutes each time.

[0092] 8. Add color developing solution (BeyoECL Star ultra-sensitive ECL chemiluminescence kit, purchased from Beyotime, item number P0018A, solution A and solution B are the solutions provided by the kit) at a ratio of solution A: solution B = 1:1 (v / v), and develop the color for 5 minutes at room temperature in the dark.

[0093] 9. Imaging system observation and photography: The instrument used is ImageQuant from GE Healthcare Life Sciences TM LAS 4000 digital imaging system.

[0094] The results are as follows Figure 4 As shown, after the CD5 protein was diluted to 0.500 mg / ml, 0.250 mg / ml, 0.125 mg / ml, 0.063 mg / ml and 0.032 mg / ml respectively, the CD5 protein showed obvious color development, which indicated that the biotin-modified FF-01 could be used for the detection of CD5 protein by membrane hybridization.

[0095] It can also be demonstrated that FF-01 can be used to accurately detect 63ug / ml of CD5 protein.

[0096] The technical means disclosed in the scheme of the present invention are not limited to the technical means disclosed in the above-mentioned implementation mode, but also include technical schemes composed of any combination of the above-mentioned technical features. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications are also regarded as the protection scope of the present invention.

Claims

1. A nucleic acid aptamer that binds to CD5 protein, characterized in that: A nucleotide sequence having a nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.6; or a nucleotide sequence having at least 30% homology with any one of SEQ ID NO.1 to SEQ ID NO.6 and binding to CD5 protein; or an RNA sequence transcribed from the nucleotide sequence as shown in any one of SEQ ID NO.1 to SEQ ID NO.

6.

2. The nucleic acid aptamer binding to CD5 protein according to claim 1, characterized in that: The nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.2 is obtained by truncating the nucleotide sequence shown in SEQ ID NO.1; the nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.4 is obtained by truncating the nucleotide sequence shown in SEQ ID NO.3; the nucleic acid aptamer having the nucleotide sequence shown in SEQ ID NO.6 is obtained by truncating the nucleotide sequence shown in SEQ ID NO.

5.

3. The nucleic acid aptamer binding to CD5 protein according to claim 2, characterized in that: It has a nucleotide sequence as shown in any one of SEQ ID NO.2, SEQ ID NO.4, or SEQ ID NO.

6.

4. The nucleic acid aptamer binding to CD5 protein according to claim 1, characterized in that: The nucleotide sequence of the nucleic acid aptamer is modified, and the modification method includes one or more of phosphorylation, methylation, amination, sulfhydrylation, replacement of oxygen with sulfur, replacement of oxygen with selenium, and isotopization.

5. The nucleic acid aptamer binding to CD5 protein according to claim 1, characterized in that: The nucleic acid aptamer has a sequence obtained by modifying a nucleotide sequence that has at least 60% homology with any one of SEQ ID NO.1 to SEQ ID NO.6 and binds to the CD5 protein.

6. The nucleic acid aptamer binding to CD5 protein according to claim 1, characterized in that: The transformation includes at least one of the following transformation methods: (1) Connecting a fluorescent marker to the aptamer; (2) Connecting radioactive substances to the aptamer; (3) Connecting therapeutic substances to the aptamer; (4) connecting biotin to the aptamer; (5) connecting digoxigenin to the aptamer; (6) connecting a nanoluminescent material to the nucleic acid aptamer; (7) Connecting a small peptide to the aptamer; (8) Connecting siRNA to the nucleic acid aptamer.

7. A product for detecting CD5 protein, characterized in that: The product comprises the nucleic acid aptamer according to any one of claims 1 to 6, wherein the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.

8. A product for purifying CD5 protein, characterized in that: The invention comprises the nucleic acid aptamer according to any one of claims 1 to 6, or the conjugate or derivative of the nucleic acid aptamer according to claim 5; the product comprises any one or more of a kit, a detection chip, and a chromatography detection device.

9. Use of the nucleic acid aptamer according to any one of claims 1 to 6 for preparing a reagent for detecting or purifying CD5 protein.

10. Use of the nucleic acid aptamer according to any one of claims 1 to 6 for preparing a drug targeting CD5 protein.

Images