Rabies mRNA vaccine and application thereof

Abstract

The invention discloses a rabies mRNA vaccine and application thereof. The rabies mRNA vaccine takes mRNA of G protein of rabies virus as an active ingredient. The mRNA comprises a coding sequence of a G protein of the rabies virus, and the coding sequence is selected from any one of the following sequences: (1) the G protein comprises an amino acid sequence as shown in SEQ ID NO: 1, and the coding sequence comprises a nucleic acid sequence as shown in any one of SEQ ID NO: 10-14 and 17; and (2) the G protein comprises an amino acid sequence as shown in SEQ ID NO: 8. Compared with the traditional inactivated vaccine, the vaccine provided by the invention has stronger immunogenicity, can stimulate stronger humoral immune response, and has better protection effect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a rabies mRNA vaccine and application thereof. Background Art

[0002] Rabies is a zoonotic disease caused by the rabies virus (RABV). It is widely distributed in all continents except Antarctica. Neurotropism is the main characteristic of rabies virus infection. The rabies virus replicates in neurons and enters the tissues and organs distributed by nerves through peripheral nerves. The clinical manifestations are often specific fear of wind, fear of water, pharyngeal muscle spasm and progressive paralysis. Once clinical symptoms of rabies virus infection appear, it is almost 100% fatal. There is no targeted treatment. It is estimated that about 60,000 people die from rabies every year, and the vast majority of cases are infected through bites of domestic dogs. Therefore, prevention of rabies, especially post-exposure prophylaxis (PEP), is crucial to avoid damage to people's lives and property caused by rabies.

[0003] The natural host of rabies virus is mainly bats, which can infect almost all terrestrial mammals. Except for bats, almost all hosts will suffer from rabies until they become ill and die. Rabies is mainly transmitted by the saliva of sick animals. In addition to cats and dogs, domestic animals such as pigs, cattle, sheep, and horses, as well as wild animals such as bats, raccoons, skunks, wolves, and foxes may carry and be infected with rabies virus and spread it to humans through scratches or bites. Due to the neurotropism of rabies virus, the virus mainly proliferates in nerve cells. After the virus invades the host through the wound, it first invades the spinal cord and central nervous system along the neurons, destroying the central nervous system to produce clinical symptoms, and then descends through the nervous system to enter other non-neural tissues, mainly affecting the salivary gland acinar cells, and is discharged into the saliva through the salivary glands, and then spreads to the next victim through the bite wound or the mucous membrane contaminated by the poisonous saliva.

[0004] Rabies virus belongs to the genus Lyssavirus of the family Rhabdoviridae. Its molecular structure consists of two parts: the envelope and the capsid. The envelope is composed of a phospholipid bilayer embedded with G (glycoprotein) protein and the inner matrix protein M (Matrix protein); the core is composed of a nucleocapsid composed of nucleoprotein N (nucleoprotein) and the genome and phosphorylated protein P (phosphoprotein) and RNA polymerase L (RNA-directed RNApolymerase) it encapsulates. The genome of rabies virus is a single-stranded RNA containing five genes, namely, encoding the five proteins N, P, M, G, and L mentioned above. Among them, the G protein embedded in the outer membrane is the main mediator of the virus's invasion into cells. That is, the mechanism of action of rabies vaccine is mainly to stimulate the immune system to produce antibodies against G protein, thereby blocking rabies virus from infecting cells and clearing rabies virus, protecting those exposed to rabies virus from rabies.

[0005] The rabies virus G protein is the only protein exposed on the viral envelope and is the key protein that mediates the virus to infect target cells. Therefore, the subunit vaccines or other viral vector vaccines for rabies currently use G protein as the only immunogen. Antibodies produced by stimulating the immune system with G protein as an antigen can effectively block rabies virus from infecting cells. Other studies have also shown that antibodies against other proteins of rabies virus do not have the ability to block viral infection. At the same time, G protein is relatively conservative. The G protein homology of various vaccine strains used in the current rabies inactivated vaccine is very high. Various vaccine strains have good cross-protection against different rabies virus strains, that is, the neutralizing antibodies produced by immunization with G proteins of different strains have a wide range of protection against rabies virus.

[0006] There are three main types of rabies vaccines: the first type is inactivated vaccines; the second type is subunit vaccines with G protein as antigen; and the third type is viral vector vaccines with G protein as antigen. Currently, all rabies vaccines for human use are inactivated vaccines, and all rabies vaccines for human or animal use on the market in China are inactivated vaccines.

[0007] As the oldest form of vaccine, inactivated vaccines have the best safety from the perspective of pathogens because the virus has been fully inactivated. However, during the purification process of the virus, it is inevitable that there will be residues of the culture matrix. These impurities are one of the main causes of adverse reactions to rabies vaccines. Therefore, the development and improvement of inactivated rabies vaccines mainly lies in the culture matrix of rabies virus, which has gone through nerve tissue (sheep brain and mouse brain, etc.), duck embryos, primary cells (chicken embryo primary cells), human diploid cells and Vero cells, etc. The improvement of virus culture matrix from tissues and embryos to primary cell lines and diploid cell lines is mainly to reduce the complexity of the virus culture system and simplify the culture system, which can better exclude other impurities that may be mixed in the inactivated vaccine, reduce unnecessary immune responses, and reduce the side effects of the vaccine. For human rabies vaccines, vaccines produced using human diploid cells can produce faster and better immune responses.

[0008] However, inactivated vaccines have two disadvantages. First, the virus culture cost is high and the purification process is complicated. Second, the process of inactivating the virus will greatly reduce the immunogenicity. The inactivation process of the virus will destroy the natural structure of the virus and viral proteins, resulting in the lowest proportion of antigens in the inactivated vaccine that can stimulate the immune system to produce effective neutralizing antibodies compared to other vaccine forms. This is also the reason why the injection procedure of the inactivated rabies vaccine is complicated and generally requires 4 to 5 injections.

[0009] In view of the main shortcomings of the current inactivated rabies vaccine, there is an urgent need to design and develop a rabies vaccine with high immunogenicity, the production of high-quality neutralizing antibodies and a simple injection procedure. Summary of the invention

[0010] In order to solve the problems that the inactivated rabies vaccine in the prior art has high virus culture cost, complex purification process, and the process of inactivating the virus will greatly reduce the immunogenicity and cause the injection procedure to be complicated, the present invention provides a rabies mRNA vaccine and its application. The mRNA vaccine provided by the present invention has many advantages over the inactivated vaccine. First, the mechanism by which the mRNA vaccine works is that the mRNA encoding the G protein is delivered to the cytoplasm of the recipient cell by liposomes, and then translated into the rabies G protein and located on the cell membrane. This process is consistent with the process of expressing the G protein after the rabies virus infects the cell, so the G protein expressed by the mRNA delivery all has a natural active conformation, which can better stimulate the immune system to produce antibodies with neutralizing efficacy. Second, the production process of the mRNA vaccine is completely independent of cells. Compared with inactivated vaccines or subunit vaccines, the production process is more convenient, the impurities in the final product can be less, and the probability of adverse reactions caused by impurities is lower. The mRNA vaccine provided by the present invention can produce a higher level of neutralizing antibodies in the subject, and achieves a faster and more significant immune response compared with the inactivated vaccine.

[0011] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0012] According to the structure of rabies virus and its molecular mechanism of infecting cells, the present invention uses rabies virus G protein as an immunogen to design an mRNA molecule that can efficiently express rabies virus G protein in mammalian cells. The mRNA molecule includes the following components from the 5' end to the 3' end: a 5' end cap, a 5' end UTR, a coding sequence encoding the G protein, a stop codon, a 3' end UTR and a polyadenylic acid sequence. The isolated mRNA provided by the present invention is prepared into lipid nanoparticles coated with cationic lipids, which are the main components of rabies vaccine. Specifically:

[0013] The first aspect of the present invention provides an isolated mRNA, wherein the mRNA comprises a coding sequence for the G protein of rabies virus, wherein the coding sequence is selected from any one of the following:

[0014] (1) The G protein comprises the amino acid sequence shown in SEQ ID NO: 1; the coding sequence comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 10-14 and 17;

[0015] (2) The G protein comprises the amino acid sequence shown in SEQ ID NO:8.

[0016] In some embodiments of the present invention, in (2), the coding sequence of the G protein comprises the nucleic acid sequence shown in SEQ ID NO:15.

[0017] In some embodiments of the present invention, the mRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR and poly(A).

[0018] In some preferred embodiments of the present invention, the poly (A) comprises 80-120 adenylic acid residues, for example, 80, 85, 90, 95, 100, 105, 110 or 120 adenylic acid residues.

[0019] In some preferred embodiments of the present invention, the 5'UTR comprises the nucleotide sequence as shown in SEQ ID NO:31.

[0020] In some preferred embodiments of the present invention, the 3'UTR comprises the nucleotide sequence as shown in SEQ ID NO:32.

[0021] In some embodiments of the present invention, the mRNA further comprises a polynucleotide modification.

[0022] In some preferred embodiments of the present invention, the polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification and 5-methylcytidine modification.

[0023] In some specific embodiments of the present invention, the polynucleotide modification is pseudouridine modification or N1-methyl-pseudouridine modification.

[0024] The second aspect of the present invention provides an isolated DNA, wherein the DNA encodes the G protein of rabies virus, and the DNA satisfies any of the following conditions:

[0025] (1) The DNA is a single-stranded DNA, and the DNA is a template strand for transcribing the mRNA as described in the first aspect; or the DNA is a coding strand that is reverse complementary to the template strand for transcribing the mRNA as described in the first aspect;

[0026] (2) The DNA is a double-stranded DNA, which comprises the template strand and the coding strand described in (1), and the template strand is reverse complementary to the coding strand.

[0027] In some embodiments of the present invention, the sequence of the coding strand comprises any one of the sequences shown in SEQ ID NO: 21-26 or 28.

[0028] In some embodiments of the present invention, the DNA further comprises a 5'UTR and / or a 3'UTR.

[0029] In some optional embodiments of the present invention, the DNA further comprises a protein encoding tag.

[0030] In some specific embodiments of the present invention, the protein tag is, for example, an HA tag and / or a HiBiT tag.

[0031] A third aspect of the present invention provides a rabies virus G protein, wherein the G protein comprises the sequence shown in SEQ ID NO:8.

[0032] The fourth aspect of the present invention provides a recombinant expression vector, which comprises the mRNA as described in the first aspect or the DNA as described in the second aspect.

[0033] In some embodiments of the present invention, the backbone vector of the recombinant expression vector is pcDNA3.1.

[0034] In some embodiments of the present invention, the promoter of the recombinant expression vector is a T7 promoter.

[0035] The fifth aspect of the present invention provides a transformant, which comprises the mRNA as described in the first aspect, the DNA as described in the second aspect, or the recombinant expression vector as described in the fourth aspect.

[0036] In some embodiments of the present invention, the host cell of the transformant is a eukaryotic cell.

[0037] In some preferred embodiments of the present invention, the host cell is selected from yeast cells or mammalian cells.

[0038] In some specific embodiments of the present invention, the mammalian cells are 293T cells.

[0039] The sixth aspect of the present invention provides a method for preparing the G protein of rabies virus, the method comprising the step of culturing the transformant as described in the fifth aspect under conditions suitable for the expression of the G protein.

[0040] The seventh aspect of the present invention provides a composition comprising (1) the mRNA as described in the first aspect, and (2) a delivery vector.

[0041] In some embodiments of the present invention, the delivery vehicle is a lipid nanoparticle.

[0042] In some preferred embodiments of the present invention, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids and lipid conjugates.

[0043] In some preferred embodiments of the present invention, the N / P ratio of the ionizable lipid of the lipid nanoparticle to the mRNA is (2-20):1.

[0044] In some preferred embodiments of the present invention, the N / P ratio of the ionizable lipid of the lipid nanoparticle to the mRNA is (3-15):1, for example, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1, 10:1, 11:1, 12:1, 13:1, 14:1 or 15:1.

[0045] In some more preferred embodiments of the present invention, the lipid nanoparticles are composed of compound 6, cholesterol, DSPC and DMG-PEG2000, and the molar ratio of compound 6: cholesterol: DSPC: DMG-PEG2000 is (45-50): (38.5-40): (10-12): (1.5-4), and the structural formula of compound 6 is as follows:

[0046]

[0047] In some specific embodiments of the present invention, the molar ratio of compound 6: cholesterol: DSPC: DMG-PEG2000 is 50:38.5:10:1.5.

[0048] The eighth aspect of the present invention provides a pharmaceutical composition, which comprises the mRNA as described in the first aspect, or the composition as described in the seventh aspect, and a pharmaceutically acceptable carrier and / or excipient.

[0049] The ninth aspect of the present invention provides a vaccine, which comprises the mRNA described in the first aspect, the composition described in the seventh aspect or the pharmaceutical composition described in the eighth aspect, and an adjuvant.

[0050] The tenth aspect of the present invention provides a method for preparing a composition for alleviating, preventing and / or treating diseases caused by rabies virus, the method comprising the step of mixing an aqueous phase containing mRNA with a lipid phase containing a delivery vector, wherein the mRNA and the delivery vector are as defined in the composition described in the seventh aspect.

[0051] In some embodiments of the present invention, the method uses microfluidics technology.

[0052] In some preferred embodiments of the present invention, the total flow rate of the microfluidic synthesis is 11-13 mL / min; and / or the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1.

[0053] In some specific embodiments of the present invention, the total flow rate of the microfluidic synthesis is 12 mL / min; and / or the flow rate ratio of the aqueous phase to the lipid phase is 3:1.

[0054] The eleventh aspect of the present invention provides a use of the mRNA as described in the first aspect, the DNA as described in the second aspect, the rabies virus G protein as described in the third aspect, the recombinant expression vector as described in the fourth aspect, or the transformant as described in the fifth aspect in the preparation of a drug for alleviating, preventing and / or treating diseases caused by rabies virus.

[0055] In some embodiments of the present invention, the disease is rabies; and / or the drug is a vaccine.

[0056] The twelfth aspect of the present invention provides a method for alleviating, preventing and / or treating diseases caused by rabies virus, the method comprising administering to a subject the mRNA as described in the first aspect, the composition as described in the seventh aspect, the pharmaceutical composition as described in the eighth aspect and / or the vaccine as described in the ninth aspect.

[0057] In some embodiments of the present invention, the method satisfies at least one of the following conditions:

[0058] (1) The disease is rabies;

[0059] (2) the mRNA, the composition, the pharmaceutical composition or the vaccine is administered twice, with an interval of one week between the two administrations; and / or,

[0060] (3) The mRNA, the composition, the pharmaceutical composition or the vaccine is administered at a dose of 20-150 μg / time, for example, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140 or 150 μg / time;

[0061] (4) The mRNA, the composition, the pharmaceutical composition or the vaccine is administered by subcutaneous injection.

[0062] The present invention also provides a method for preparing the mRNA as described in the first aspect, the preparation method comprising the following steps:

[0063] First, the part of the mRNA sequence except for polyadenylic acid is synthesized; then, a double-stranded DNA containing the entire sequence of the target mRNA is obtained by PCR reaction using this as a template and a primer containing the polyadenylic acid sequence; then, this double-stranded DNA is used as a template in a reaction system containing a 5' cap and converting uracil nucleotide (uridine, U) into pseudouridine (Ψ) to obtain a complete mRNA molecule with intracellular expression activity of G protein through in vitro transcription reaction.

[0064] The intact mRNA molecule is ionized (cationic) at low pH, and is coated into nanoparticles by two auxiliary lipids DSPC (distearoylphosphatidylcholine) and cholesterol, as well as cationic lipid compound 6 and pegylated lipid (DMG-PEG2000), to obtain lipid nanoparticles (mRNA-LNP) containing mRNA. The lipid nanoparticles are dialyzed, concentrated, filtered and stored to obtain a vaccine containing the target antigen.

[0065] The present invention also provides an exemplary immunization program for the vaccine as described in the ninth aspect: the first dose is administered as soon as possible after exposure to rabies virus, with an intramuscular injection of 30 μg; the second dose is administered one week later, with an intramuscular injection of 30 μg.

[0066] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0067] The reagents and raw materials used in the present invention are commercially available.

[0068] The positive and progressive effects of the present invention are: the production process of the rabies mRNA vaccine of the present invention does not rely on cells, and is prepared by in vitro reaction. Compared with traditional inactivated vaccines or subunit vaccines, the production process is more concise and controllable, avoiding the possible biological impurity contamination in the production process, and reducing the probability of adverse immune reactions. The immunogenicity of the vaccine provided by the present invention is stronger than that of traditional inactivated vaccines, and it can stimulate a stronger humoral immune response and have a better protective effect. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 This is the sequence alignment result of the G protein of rabies virus strains.

[0070] Figure 2 This is the alignment result of 5 mRNA sequences (C1-C5) obtained by codon optimization of the G protein coding sequence of the CTN-1 strain of rabies virus.

[0071] Figure 3 The protein levels of C1-C6 sequences introduced into Pseudo-U or N1-U are shown in the Western Blot test results. NC is empty LNP, and the theoretical size of G protein is 53.6 kDa.

[0072] Figure 4 The protein levels of mRNA sequences introduced into Pseudo-U or N1-U are the results of in vitro cell flow cytometry. NC is empty LNP.

[0073] Figure 5 The results of in vitro cell flow cytometry after the introduction of Pseudo-U or N1-U, where NC is empty LNP.

[0074] Figure 6 These are the results of the detection of G protein-specific binding antibody levels in mouse serum at different time points.

[0075] Figure 7 The results show the level of neutralizing antibodies in mouse serum at different time points.

[0076] Figure 8 To compare the immune effects of vaccines.

[0077] Fig. 9 This is the flow cytometry result of antigen molecule conformation.

[0078] Fig.10 This is the result of fluorescent staining detection of the antigen protein molecules translated and expressed after C2Ψ enters the cell. DETAILED DESCRIPTION

[0079] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0080] the term

[0081] The term "nucleic acid" used in the present invention refers to a nucleotide chain of any length, and includes DNA and RNA. The term "nucleotide sequence", "nucleic acid" or "polynucleotide" includes oligonucleotides (i.e., short polynucleotides). It also refers to synthetic and / or non-natural nucleic acid molecules (e.g., including nucleotide analogs or modified backbone residues or bonds). The term also refers to deoxyribonucleotides or ribonucleotide oligonucleotides in single-strand or double-stranded form, modified nucleotides or bases, and / or their analogs, or any substrate that can be incorporated into a chain by DNA or RNA polymerase. The term encompasses nucleic acids containing natural nucleotide analogs. The term also encompasses nucleic acid-like structures with synthetic backbones. Unless otherwise indicated, specific polynucleotide sequences also implicitly encompass conservatively modified variants thereof (e.g., degenerate codon substitutions), alleles, orthologs, SNPs and complementary sequences, and sequences clearly indicated. Specifically, degenerate codon substitutions can be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (see Batzer et al., Nucleic Acids Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); and Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)).

[0082] The term "polynucleotide modification" as used in the present invention refers to the process of adding auxiliary chemical groups or functional groups to single nucleotide molecules in DNA and RNA. These modifications can change the function of nucleotides, such as regulating gene expression, repairing DNA damage, participating in protein synthesis and other biological processes. For example, the present invention includes replacing natural UDP (uridine diphosphate) with Pseudo-U (pseudouridine, Ψ), or replacing natural UDP with pseudouridine methylated at the N1 position.

[0083] The term "UTR" used in the present invention refers to the untranslated region (UTR), which is located at the 5' and 3' ends of the mature mRNA (the 5' untranslated region (5'UTR) is upstream of the translation start codon, and the 3' untranslated region (3'UTR) is downstream of the translation stop codon). It does not encode protein, but has translation regulatory function and is involved in regulating the stability and intracellular localization of mRNA.

[0084] The term "mRNA vaccine" used in the present invention is the third generation vaccine after inactivated vaccines, live attenuated vaccines, subunit vaccines and viral vector vaccines. mRNA vaccines are to introduce mRNA containing coding antigen proteins into subjects, directly translate them, form corresponding antigen proteins, thereby inducing the body to produce specific immune responses, and achieve the effect of immune prevention or treatment. mRNA vaccines use the gene sequence of the virus rather than the virus itself. Therefore, mRNA vaccines have no viral components and no risk of infection. In vitro transcribed (IVT) mRNA simulates the structure of endogenous mRNA and has five parts, from 5' to 3' including: 5' cap structure, 5'UTR, open reading frame encoding antigen, 3'UTR and PolyA tail. mRNA vaccines usually contain modified nucleosides, such as pseudouridine, N1-methyl pseudouridine or other nucleoside analogs. The use of modified nucleosides, especially modified uridine, prevents the recognition of pattern recognition receptors and ensures that the translation process produces sufficient levels of protein.

[0085] The term "lipid nanoparticle" (lipid nanoparticle, LNP) used in the present invention is one of the important technologies in the lipid carrier drug delivery system and has become an important progress based on oligonucleotide therapeutic drugs. LNP preparations are composed of four types of lipids: ionizable cationic lipids, phospholipids, cholesterol or cholesterol derivatives, and polyethylene glycol (PEG)-lipids. Oligonucleotides (such as mRNA) encapsulated in lipid nanoparticles are protected from enzymatic degradation during delivery and effectively delivered to cells, where the contents (such as mRNA) in the lipid nanoparticles are released and translated into therapeutic proteins. Those skilled in the art can prepare lipid nanoparticles by conventional methods of the prior art, such as using Moderna's formula, combined with the synthesis process of microfluidics (Microfluidic, MF). "N / P ratio" or "nitrogen-phosphorus ratio" refers to the ionizable lipid amine / oligonucleotide phosphate (N / P) molar ratio of LNP, which represents the charge balance between the ionizable cationic lipid cationic tertiary amine and the oligonucleotide backbone anionic phosphate group.

[0086] The term "recombinant expression vector" as used in the present invention may be any suitable recombinant expression vector that can be used for transformation or transfection to deliver one or more target genes or sequences into any suitable host cell and preferably express the gene or sequence in the host cell. Suitable vectors include those designed for expansion and amplification or for expression or both, examples of which include but are not limited to viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids or phage vectors, DNA or RNA expression vectors associated with cationic coagulants, DNA or RNA expression vectors encapsulated in liposomes, and certain eukaryotic or prokaryotic cells, such as production cells.

[0087] The term "transformant" as used in the present invention refers to transfection or introduction of a recombinant expression vector or nucleic acid for expression into a suitable host cell to obtain a transformant. A variety of techniques can be used to achieve this purpose, for example, protoplast fusion, calcium phosphate precipitation, electroporation, retroviral transduction, viral transfection, gene gun, lipid-based transfection or other conventional techniques. In this application, the term "host cell" refers to any type of cell that can contain a nucleic acid or vector described herein. In exemplary aspects, the host cell is a eukaryotic cell, such as a plant, animal, fungus or algae; or it can be a prokaryotic cell, such as a bacterium or a protozoan.

[0088] The term "pharmaceutical composition" used in the present invention includes suitable pharmaceutically acceptable carriers such as pharmaceutical excipients, such as pharmaceutical carriers and pharmaceutical excipients known in the art, including buffers."Pharmaceutically acceptable carriers" include any and all solvents, dispersion media, isotonic agents and absorption delay agents that are physiologically compatible. When the pharmaceutical composition is administered intravenously, water is a preferred carrier. Saline solutions and aqueous dextrose and glycerol solutions can also be used as liquid carriers, particularly for injectable solutions. The pharmaceutical composition described in the present application can be prepared by mixing the mRNA and DNA of the present application with the required purity with one or more optional pharmaceutical excipients (Remington's Pharmaceutical Sciences, 16th edition, Osol, A. ed. (1980)), preferably in the form of a lyophilized preparation or an aqueous solution. The pharmaceutical composition of the present application can also include more than one active ingredient, which is required for the specific indication to be treated, preferably those active ingredients with complementary activities that do not adversely affect each other. For example, it is desirable to also provide other active ingredients, such as anti-rabies virus antibodies, anti-rabies virus active agents, small molecule drugs or immunomodulators, etc. The active ingredients are suitably combined in amounts effective for the intended use.Sustained-release preparations can be prepared, suitable examples of which include semipermeable matrices of solid hydrophobic polymers containing the mRNA or DNA of the present application, which matrices are in the form of shaped articles, such as films or microcapsules.

[0089] Example 1 Experimental method

[0090] 1. In vitro transcription and mRNA transfection

[0091] 1. PCR to obtain linearized target fragment

[0092] According to the needs of PCR reaction, add 8.7 μL of ddHO into a 1.5 mL centrifuge tube. 2 O, 0.5 μL template DNA (source: synthesized by GenScript, the template DNA is a plasmid based on pCDNA3.1, containing T7 promoter, 5'UTR (actcttctggtccccacagactcagagagaacccgccacc, SEQ ID NO: 31), target protein coding sequence, 3'UTR (gctggagcctcggtggccatgcttcttgccccttgggcctccccccagcccctcctccccttcctgcacccgtacccccgtggtctttgaataaagtctgagtgggcggca, SEQ ID NO: 32) and polyadenine sequence (100 adenylate residues), 0.4 μL forward primer sequences and 0.4 μL reverse primer sequences are Primer F: CTAGAGAACCCACTGCTT A (SEQ ID NO: 29) and Primer R: TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT TCTAGATGCCGCCCACTCAGAC (SEQ ID NO: 30; source: GenScript synthesis) and 10 μL of PrimerSTAR MAX polymerase (source: TAKARA, catalog number: R450A) were mixed evenly.

[0093] The PCR reaction system is shown in Table 1.

[0094] Table 1 PCR reaction system

[0095] Components volume Plasmid (pcDNA3.1(+)) 0.5μL Primer F:T7-mRNA-pCDNA-F 0.4μL Primer R:Human-HBA-UTR-100T-R 0.4μL <![CDATA[H 2 The]]> 8.7μL PrimerSTAR Max 10μL Total 20μL

[0096] The final PCR reaction conditions are shown in Table 2 below:

[0097] Table 2 PCR reaction conditions

[0098]

[0099] After the PCR reaction is completed, the PCR product is obtained and verified by gel electrophoresis. If the nucleic acid bands are uniform, the next IVT reaction can be carried out. If not, it needs to be repeated.

[0100] 2. In vitro transcription (IVT)

[0101] A small amount of IVT testing was performed according to the following ratio in Table 3 (20 μL system):

[0102] Table 3 IVT system

[0103]

[0104]

[0105] After the preparation is completed, the entire reaction system is placed in a 37°C water bath and incubated for 2 hours. After the reaction is completed, the DNA template is digested. At this time, 1 μL DNase I (source: Vazyme, catalog number: EN401-01) (35 μL for 1mL IVT reaction) is added and digested at 37°C for 15 minutes before IVT recovery. The recovery steps are as follows:

[0106] I. Add 80 μL ddHO to 20 μL of digestion product 2 O, make up to 100 μL.

[0107] II. Add 350 μL Solution D and 250 μL anhydrous ethanol (source: Shanghai Test, catalog number: 801769722), mix thoroughly, transfer to a nucleic acid purification column (source: Solarbio, catalog number: N1012), and centrifuge at 10,000 × g for 1 min.

[0108] III. Add 500 μL of 70% ethanol and centrifuge at 10,000×g for 1 min. Repeat once and then centrifuge at 10,000×g for 2 min.

[0109] IV. Add 70 μL of sodium citrate (source: Sigma, catalog number: C8532) to the purification column, place at room temperature for 1 minute, centrifuge at 10,000×g for 2 minutes, and collect the flow-through, which is the target RNA.

[0110] According to the above ratio, 1% agarose gel was prepared for RNA electrophoresis at 160V for 20min. After the electrophoresis, the gel was observed on a gel imaging system (source: Tianneng, item number: Tanon 4600SF). If the band was single, the concentration could be determined. In the present invention, the introduction and replacement of Pseudo-U or N1-U modified nucleotides was 100%.

[0111] 3. Cell Transfection

[0112] In this experiment,

[0113] 1 μg of mRNA sample and 3 μL of lipofectamine 2000 were diluted in 50 μL of serum-free medium, mixed and incubated at room temperature for 20 min, and then the mixed sample was added to 1e6 293T cells at 37°C and 5% CO 2 After incubation for 18-20 h, the cells were harvested.

[0114] 2. Western blot detection of expression levels

[0115] 1. Wash the transfected cells once with 1×PBS (source: Bio-Industry, catalog number: B548117-0500), then add 50 μL 1× cell lysis buffer (20 mM Tris-HCl (pH = 7.4), 150 mM NaCl, 3 mM KCl 2 , 0.1% Triton-X) for lysis.

[0116] 2. After the cell lysate was prepared as immunoblotting electrophoresis sample, SDS-PAGE gel electrophoresis was performed and the sample was electrotransferred to cellulose acetate (NC) membrane.

[0117] 3. After blocking the NC membrane with TBST buffer containing 5% skim milk powder, incubate with the corresponding antibodies to detect the protein expression level. Glycoprotein Polyclonal Antibody (manufacturer MYBIOSOURCE, catalog number MBS1491332) was used as the primary antibody.

[0118] 3. In vitro flow cytometry

[0119] 1. Wash the transfected cells three times with 1×PBS, then add 500 μL 1×PBS for resuspending.

[0120] 2. Take 2 equal portions of 100 μL from the single-cell suspension of each sample and add them into 1.5 mL EP tubes, and mark them as control group and test group respectively.

[0121] 3. This experiment uses two antibodies for detection: 523-11 (source: BioLegend, 20221219A015), which recognizes the rabies G protein before and after fusion, and the corresponding secondary antibody is APC anti-mouse IgG1 (source: BioLegend, 406610); RVC20 (source: BioLegend, batch number: M-202405250772), which only recognizes the rabies G protein before fusion, and the corresponding secondary antibody is PE anti-human Fc (source: BioLegend, 410708).

[0122] 4. Sample preparation: Add 50 μL of control flow buffer to the control group in step 2, and add 50 μL of flow buffer containing 523-11 and RVC20 to the experimental group. Incubate at 4°C for 1 hour, centrifuge at 4°C, 500×g for 4 minutes, discard the supernatant, wash 3 times with 150 μL 1×PBS, and resuspend in 75 μL 1×PBS. Then add flow buffer containing APCanti-mouse IgG1 and PE anti-human Fc to the control group and the experimental group, incubate at 4°C for 1 hour, centrifuge at 4°C, 500×g for 4 minutes, discard the supernatant, wash 3 times with 150 μL 1×PBS, and resuspend in 75 μL 1×PBS.

[0123] 5. Perform flow cytometry detection on a flow cytometer (source: Cytek, catalog number: NL-CLC V16 B14 R8).

[0124] 4. Preparation of lipid nanoparticles

[0125] Preparation of cationic lipid compound 6

[0126] Step 1: Preparation of 6-1

[0127] Reaction:

[0128]

[0129] Table 4 Material ratio

[0130] Material Name Molecular weight Feed ratio Feeding amount mmol 1,2-Epoxydodecane 184 1eq 5g 27 6-Bromohexanoic acid 209 1.1eq 5.85g 30 Ferric chloride 162 0.025 eq 220mg 1.35 Pyridine 79 0.0125eq 53mg 0.68

[0131] Operation process:

[0132] In a 250 mL reaction bottle, add 6-bromohexanoic acid, 1,2-epoxydodecane, ferric chloride and pyridine according to Table 4, and stir at room temperature for 16 hours. TLC (PE:EA=4:1) shows that the reaction is complete (the product rf value is 0.5). After column chromatography purification, 6.8 g of colorless oil is obtained.

[0133] Step 2: Preparation of 6-2

[0134] Reaction:

[0135]

[0136] Table 5 Material ratio

[0137] Material Name Molecular weight Feed ratio Feeding amount mmol 6-1 379.38 1eq 6.6g 17.5 bitter 144 1.1 eq 2.8g 19.2 EDCI 192 2 eq 6.7g 35 DMAP 122 0.2 eq 420mg 3.5 Dichloromethane - - 80mL -

[0138] Operation process:

[0139] Add 6-1, octanoic acid, EDCI, DMAP and dichloromethane to the reaction flask according to Table 5, and stir the reaction at room temperature for 16 hours. TLC (PE:EA=20:1) shows that the reaction is complete (the product rf value is 0.6). The reaction solution is washed twice with 100 mL of water, and the organic phase is dried over anhydrous sodium sulfate, filtered and concentrated, and purified by column chromatography to obtain 6.5 g of colorless oil.

[0140] Step 3: Preparation of compound 6

[0141] Reaction:

[0142]

[0143] Table 6 Material Proportion

[0144] Material Name Molecular weight Feed ratio Feeding amount mmol 6-2 505.58 2.2eq 4.3g 8.55 Ethanolamine 61 1 eq 230mg 3.9 K2CO3 138 2 eq 1.1g 7.8 KI 166 2 eq 1.3g 7.8 Acetonitrile - - 40mL -

[0145] Operation process:

[0146] Add 6-2, ethanolamine, and K into the reaction flask according to Table 6. 2 CO 3 , KI and acetonitrile, heated to 65°C and stirred for 16 hours. TLC (DCM:MeOH=10:1) showed that the reaction was complete (the product rf value was 0.5). The reaction solution was filtered and concentrated, and 2.8 g of colorless oil was obtained after column chromatography purification.

[0147] 1 H NMR(600MHz,Chloroform-d)δ5.10–5.05(m,2H),4.22(dd,J=11.8,3.3Hz,2H),4.01(dd,J=11.8,6.8Hz,2H),3.61(d,J= 5.1Hz,2H),2.73–2.49(m,6H),2.30(td,J=7.5,5.1Hz,8H),1.65–1.50(m,16H),1.33–1.23(m,52H),0.91–0.85(m,12H).

[0148] MS (ES+) m / z): 910.7 (M+H) + .

[0149] The target sequence mRNA obtained by screening was ionized (cationic) at low pH, and coated into nanoparticles by two auxiliary lipids DSPC (distearylphosphatidylcholine, item number: B90536, manufacturer: Nippon Seika Co., Ltd.) and cholesterol (item number: C00373, manufacturer: Nippon Seika Co., Ltd.), as well as cationic lipid compound 6, polyethylene glycol lipid (DMG-PEG2000, item number: M-DMG-2000, purchased from: JenKem). The mRNA aqueous solution was prepared by mixing the mRNA dissolved in ultrapure water with a 100mM (millimoles per liter, or mmol / L) citrate buffer at a volume ratio of 1:1. The ratio of the four lipid components was adjusted (molar ratio, for example, cationic lipid: cholesterol: DSPC: DMG-PEG2000 = 50:38.5:10:1.5), and dissolved in 99.5% ethanol to form a lipid solution. The mRNA and lipid solution were mixed in a NanoAssemblr (manufacturer: Precision Nanosystems) microfluidic mixing system with H 2 O: EtOH = 3: 1 volume mixing ratio and a constant total flow rate of 12 mL / min, and the lipid nanoparticles are prepared according to the nitrogen-phosphorus ratio of ionizable lipids to mRNA of (3-15): 1. In this embodiment, the nitrogen-phosphorus ratio is 6: 1. Obtain lipid nanoparticles (mRNA-LNP) containing mRNA. The lipid nanoparticles are dialyzed, concentrated, filtered and stored to obtain a vaccine containing the target antigen.

[0150] 5. Animal Vaccination and Serum Collection

[0151] BALB / c mice: For mouse vaccination, 5- to 7-week-old female BALB / c mice (purchased from: Sibeifu (Suzhou) Biotechnology Co., Ltd.) were intramuscularly immunized (hereinafter referred to as "immunization") with a vaccine containing the target antigen, with a total of 2 doses, 3 weeks apart, and the dosage of each dose is shown in the table above. Use a sterile insulin syringe of appropriate specifications to accurately draw 400 μL of the test sample (slowly invert 5-10 times up and down to mix before drawing the test sample), select the right lower limb of the animal for intramuscular injection, and inject 100 μL at a single point. Collect the above-mentioned immunized mouse sera at different time points according to the immunization plan and inactivate them at 56°C for 0.5 hours to detect rabies G protein-specific binding antibodies and neutralizing antibodies.

[0152] 6. Binding antibody level detection

[0153] 1. Antigen coating: dilute rabies virus G protein antigen (source: ACRO, RAG-V55H5) to 1 ng / μL, and pipette 100 μL into a 96-well ELISA coated plate (source: Nest, catalog number: 514201), and incubate overnight in a 4°C refrigerator away from light. Block the plate with 1×PBST solution containing 3% bovine serum albumin for 2 hours at room temperature.

[0154] 2. Sample dilution: Dilute the immune mouse serum 500 times as the initial concentration, and then perform 2-fold serial dilutions in PBS buffer, with a total of 10 dilution gradients.

[0155] 3. Detection: Transfer the diluted sample to the coated plate washed with 1×PBST and incubate at 37°C for 1 hour. After washing the plate with PBST, incubate the plate with goat anti-mouse IgG HRP (source: BioTek, C030205) at 37°C for 1 hour. After washing the plate with PBST, use the substrate tetramethylbenzidine (TMB) solution (source: Invitrogen, catalog number: 00-4201-56) for color development, terminate the color development reaction with 1M sulfuric acid, and measure the absorbance at a wavelength of 450nm using a microplate reader (microplate reader, model: Synergy H1, purchased from BioTek).

[0156] VII. Neutralizing Antibody Level Detection

[0157] Serum samples collected from immunized animals were serially diluted with cell culture medium. The diluted serum was mixed with pseudovirus suspension in a 96-well plate at a ratio of 1:1, and then 293T cells were added to the serum and pseudovirus mixture in the 96-well plate, and the plate was incubated at 37°C in an environment containing 5% CO. 2 incubator (i.e., an incubator containing 5% CO 2 and 9% air). After 48 hours, the cells were lysed and luciferase substrate was added to detect the luminescence level of luciferin, which is the degree of pseudovirus infection of target cells. NT50 is defined as the dilution factor, which inhibits pseudovirus infection by more than 50% compared with the control group.

[0158] 8. Fluorescence staining detection of antigen protein

[0159] 1. Wash the transfected cells three times with 1×PBS, then add 4% paraformaldehyde solution and fix at room temperature for 5 minutes.

[0160] 2. The fixed cells were washed three times with 1×PBS and then blocked with 1×PBS containing 1% goat serum at room temperature for 1 hour.

[0161] 3. This experiment uses two antibodies for detection: 523-11 (source: Apexbio, 20221219A015), which recognizes rabies G protein before and after fusion, and the corresponding secondary antibody is FITC Goat Anti-Mouse IgG (source: Apexbio, K1201); RVC20 (source: Apexbio, batch number: M-202405250772), which only recognizes rabies G protein before fusion, and the corresponding secondary antibody is Cy3 Goat Anti-Human IgG (source: Apexbio, K1208).

[0162] 4. Sample preparation: Add 50 μL of PBS buffer (containing 1% BSA) containing 523-11 and RVC20 to the cells in step 2, incubate at room temperature for 1 hour, and wash three times with 1×PBS. Then add staining buffer containing FITC Goat Anti-Mouse IgG and Cy3 Goat Anti-Human IgG to the cells, incubate at room temperature for 1 hour, and wash three times with 1×PBS. Add DAPI to stain the cell nucleus, wash three times with 1×PBS, and observe and photograph under a fluorescence microscope.

[0163] Example 2 Selection of vaccine antigens

[0164] According to the distribution of rabies virus in China, the G protein of the most widely distributed CTN-1 strain was selected as the target antigen. The amino acid sequence of the protein is as follows:

[0165] >ACR39382.1 glycoprotein[Lyssavirus rabies]

[0166] (SEQ ID NO:1)

[0167] The strains used in the current rabies inactivated vaccine mainly include aG, Flury, PM, CVS, PV, SAD, etc. The G protein of the CTN-1 strain (amino acid sequence as shown in SEQ ID NO: 1) and the G proteins of the other vaccine strains listed (amino acid sequences as shown in SEQ ID NO: 2-SEQ ID NO: 7) have a homology of more than 99%, and the completely identical amino acid sequences exceed 80%. The G protein sequences of the strains are shown in Table 7, and the sequence alignment is shown in Figure 1 shown.

[0168] Therefore, it can be inferred that the vaccine using CTN-1 strain G protein as the immunogen should have good broad-spectrum protective efficacy against different rabies virus strains.

[0169] Table 7G protein sequence

[0170]

[0171]

[0172] Example 3 Screening of candidate antigen sequences

[0173] For mRNA vaccines, once the target antigen of the vaccine is determined, the next step is to design the mRNA coding sequence based on the protein sequence of the antigen to ensure that the designed mRNA molecule can efficiently express the target antigen protein in vivo. For the G protein sequence of CTN-1 strain rabies virus, five mRNA sequences (C1-C5) were designed according to the codon preference of mammals / humans. The target protein sequences encoded by these five sequences are consistent, the GC content is 56%, and the nucleotide sequence similarity exceeds 85% (sequence C1, C2 similarity 87.1501%; sequence C1, C3 similarity 85.8779%; sequence C1, C4 similarity 88.2952%; sequence C1, C5 similarity 86.4504%; sequence C2, C3 similarity 85.4326%; sequence C2, C4 similarity 86.9593%; sequence C2, C5 similarity 85.5598%; sequence C3, C4 similarity 88.3588%; sequence C3, C5 similarity 85.5598%; sequence C4, C5 similarity 85.687%, CLUSTALW), sequence alignment is as follows Figure 2 shown.

[0174] There are two natural conformations of the rabies virus G protein, namely the pre-fusion conformation and the post-fusion conformation. Before the rabies virus invades the target cell, the G protein is in the pre-fusion conformation. In the process of G protein-mediated virus invasion of the target cell, the conformation changes and transforms into the post-fusion conformation. Only the G protein in the pre-fusion conformation can stimulate the immune system to produce neutralizing antibodies with protective efficacy, while the G protein in the post-fusion conformation cannot stimulate the immune system to produce neutralizing antibodies with protective efficacy. It is generally believed that the stability of the pre-fusion conformation is not as good as the post-fusion conformation, that is, the pre-fusion conformation will spontaneously transform into the post-fusion conformation, while the post-fusion conformation generally cannot transform into the pre-fusion conformation. Therefore, in the design of traditional subunit vaccines, certain amino acid sites of the natural antigen molecule are generally changed, and the antigen protein is stabilized in the pre-fusion conformation through modification to improve the protective efficacy of the vaccine. For the rabies virus G protein, changing the 270th amino acid of the mature G protein from histidine to proline (H270P) can block the G protein from transforming from the pre-fusion conformation to the post-fusion conformation. For this reason, C6 was designed based on C1. Compared with C1, only the amino acid at position 270 of the mature G protein (the N-terminal signal peptide was cut off during the protein maturation process, and the actual encoding position 289 in the CDS) was changed from histidine to proline (H270P, a866c). The amino acid sequence homology of the G proteins of the main rabies virus strains was analyzed above, but there is a lack of detection antibodies for the G protein of the CTN-1 strain on the market. In order to ensure that the antigen protein designed based on the G protein of the CTN-1 strain can be effectively detected, C7 was also designed. Two protein detection tags, HA and HiBiT, were added to the C-terminus of the G protein of the CTN-1 strain. The sequences were YPYDVPDYA (SEQ ID NO: 18) and VSGWRLFKKISA (SEQ ID NO: 19), respectively. The two tags were connected by a linker (GSSG; SEQ ID NO: 20).

[0175] The sequences of C1-C7 are shown in Table 11. The designed mRNAs were prepared by IVT under the conditions of pseudo-U or N1-U replacing natural uridine (U) (replacement rate was 100%). The protein expression levels of each mRNA were detected by immunoblotting WB and cell flow cytometry.

[0176] The results of cell flow cytometry are shown in Table 8. Figure 4 and Figure 5 As shown, each mRNA can be expressed as a protein. Among them, Table 8 is the flow cytometry results (only the area under the curve of the positive area on the right), and according to the cell flow cytometry results ( Figure 5 ) to obtain the relative expression level (Table 9) and make a bar graph ( Figure 4 ).

[0177] Table 8 Cell flow cytometry expression detection results

[0178] Experimental group (using Pseudo-U instead of natural UDP) The ratio of labeled cells to total cells C1 (replacing natural UDP with Pseudo-U) 79.18％ C2 (replacing natural UDP with Pseudo-U) 87.88％ C3 (replacing natural UDP with Pseudo-U) 65.60％ C4 (replacing natural UDP with Pseudo-U) 86.00％ C5 (replacing natural UDP with Pseudo-U) 70.61％ C6 (replacing natural UDP with Pseudo-U) 82.00％ C1 (replaces native UDP with N1-U) 88.94％ C2 (replacing natural UDP with N1-U) 73.60％ C3 (replacing natural UDP with N1-U) 57.73％ C4 (replaces natural UDP with N1-U) 85.14％ C5 (replaces natural UDP with N1-U) 80.79％ C6 (replaces natural UDP with N1-U) 83.93％ C7 (replaces natural UDP with N1-U) 55.82％ NC 5.35％

[0179] Table 9 Relative expression levels

[0180]

[0181] NC relative expression level: 0.0117.

[0182] Western blot (WB) Figure 3 ) and the results of cell flow cytometry expression detection were consistent. Each mRNA could be expressed as protein, and the C2 sequence transcribed in vitro with pseudo-U replacing natural UTP had the highest expression level. Although the expression level of sequence C6 was slightly lower than that of C2, C6 had a mutation of H270P in the amino acid design of the antigen. Subsequent experiments mainly considered the comparison between sequences C2 and C6 in the preparation of vaccines under pseudo-U conditions (C2Ψ and C6Ψ).

[0183] Example 4 BALB / c mouse immunization

[0184] BALB / c mice: For mouse vaccination, cationic lipid mRNA vaccines corresponding to C2Ψ and C6Ψ were prepared, and 5- to 7-week-old female BALB / c mice (purchased from: Sibeifu (Suzhou) Biotechnology Co., Ltd.) were intramuscularly immunized (hereinafter referred to as "immunization"), and the number of BALB / c mice in each group was 6 (n=6). At the same time, the inactivated rabies virus vaccine (lyophilized human rabies vaccine (Vero cells, Liaoning Chengda)) that has been marketed was selected as a control. The immunization method is shown in Table 10 below.

[0185] Table 10 BALB / c mouse immunization schedule

[0186]

[0187] Use a sterile insulin syringe of appropriate specifications to accurately draw out 400 μL of the test sample (slowly invert the syringe 5-10 times to mix before drawing out the test sample), select the right lower limb of the animal for intramuscular injection, and inject 100 μL at a single point.

[0188] At different planned time points, the sera of the immunized mice were collected and inactivated at 56°C for 0.5 h to detect rabies virus G protein-specific IgG and neutralizing antibodies. The results are as follows: Figure 6 and Figure 7 shown.

[0189] The results showed that the vaccine prepared with C2Ψ had the best immune effect when administered twice with a dose of 5 μg at an interval of 7 days.

[0190] First of all, both vaccines C2Ψ and C6Ψ showed a good dose effect. At the same time, compared with the inactivated vaccines with the same immunization schedule (0, 7 days), both mRNA vaccines showed great advantages, faster and stronger immune responses.

[0191] Compared with the inactivated vaccine with the standard 5-dose (0, 3, 7, 21, 28 days) immunization schedule, both mRNA vaccines showed a stronger immune response starting 14 days after the first immunization ( Figure 8 ). Although the binding antibody and neutralizing antibody of the inactivated vaccine increased to a certain extent after injection on the 21st and 28th days, they were still lower than those of the mRNA vaccine. In addition, the neutralizing antibody of the 5-shot inactivated vaccine began to decline in the eighth week after the first injection, and the persistence of the immune response was also lower than that of the mRNA vaccine.

[0192] Comparing the immune effects of vaccines C2Ψ and C6Ψ, the binding antibodies and neutralizing antibodies of the two sequences of mRNA vaccines reached their peak in the sixth week after the first vaccination, and the levels were comparable. However, in the second week after the first vaccination, the binding antibodies and neutralizing antibodies produced by vaccine C2Ψ were significantly higher than those of vaccine C6Ψ.

[0193] Example 5 Study on Antigenic Molecules of Vaccines C2Ψ and C6Ψ

[0194] After RNA molecules C2Ψ and C6Ψ were transfected into 293T cells, the antigen protein molecules translated and expressed after mRNA entered the cells were detected by cell flow cytometry. The results are as follows: Fig. 9 shown.

[0195] The horizontal axis of the results indicates the detection signal of antibody 523-11, which represents the total G protein expression level, and the vertical axis indicates the detection signal of antibody RVC20, which represents the G protein expression level of the pre-fusion conformation. The results showed that the antigen molecule containing the H270P mutation could not significantly increase the proportion of the pre-fusion conformation of the wild-type CTN-1 strain G protein, which is consistent with the fact that the immune effect of vaccine C6Ψ is inferior to that of vaccine C2Ψ.

[0196] After RNA molecule C2Ψ was transfected into 293T cells, the antigen protein molecules translated and expressed after C2Ψ entered the cells were further detected by fluorescence staining. Fig.10 shown.

[0197] The results showed that after the RNA molecule C2Ψ was transfected into 293T cells, it could be correctly located on the cell membrane surface, and most of the antigen molecules were in the pre-fusion conformation. This result was consistent with the previous flow cytometry detection results.

[0198] Table 11 Experimental group sequences

[0199]

[0200]

[0201]

[0202]

[0203] Although the specific embodiments of the present invention are described above, it should be understood by those skilled in the art that these are only examples, and various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.

Claims

1. An isolated mRNA comprising a coding sequence for the G protein of rabies virus, characterized in that: The coding sequence is selected from any one of the following: (1) the G protein comprises the amino acid sequence shown in SEQ ID NO: 1, and the coding sequence comprises a nucleic acid sequence selected from any one of SEQ ID NOs: 10-14 and 17; (2) The G protein comprises the amino acid sequence shown in SEQ ID NO:

8.

2. The mRNA according to claim 1, characterized in that (2), the coding sequence of the G protein comprises the nucleic acid sequence shown in SEQ ID NO: 15; and / or, The mRNA further comprises one or more of a 5'-cap structure, a 5'UTR, a 3'UTR and poly(A); and / or, The mRNA further comprises a polynucleotide modification; Preferably, the mRNA further satisfies at least one of the following conditions: (i) the poly(A) comprises 80-120 adenylate residues; (ii) the 5'UTR comprises the nucleotide sequence as described in SEQ ID NO:31; (iii) the 3'UTR comprises the nucleotide sequence as described in SEQ ID NO:32; (iv) the polynucleotide modification is selected from one or more of the following: pseudouridine modification, N1-methyl-pseudouridine modification, 5-methoxyuridine modification, N1-methyladenosine modification, N6-methyladenosine modification and 5-methylcytidine modification; the polynucleotide modification is preferably pseudouridine modification or N1-methyl-pseudouridine modification.

3. An isolated DNA encoding the G protein of rabies virus, characterized in that: The DNA satisfies any of the following: (1) The DNA is a single-stranded DNA, and the DNA is a template strand for transcription to obtain the mRNA as claimed in claim 1 or 2; or, the DNA is a coding strand that is reverse complementary to the template strand for transcription to obtain the mRNA as claimed in claim 1 or 2; (2) The DNA is a double-stranded DNA, which comprises the template strand and the coding strand described in (1), and the template strand is reverse complementary to the coding strand; Optionally, the DNA further comprises a coding protein tag; the protein tag is, for example, an HA tag and / or a HiBiT tag.

4. A rabies virus G protein, characterized in that The G protein comprises the sequence shown in SEQ ID NO:

8.

5. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the mRNA according to claim 1 or 2 or the DNA according to claim 3; Preferably, the backbone vector of the recombinant expression vector is pcDNA3.1; and / or, the promoter of the recombinant expression vector is T7 promoter.

6. A transformant, characterized in that The transformant comprises the mRNA according to claim 1 or 2, the DNA according to claim 3, or the recombinant expression vector according to claim 5; Preferably, the host cell of the transformant is a eukaryotic cell; More preferably, the host cell is selected from yeast cells or mammalian cells, and the mammalian cells are, for example, 293T cells.

7. A method for preparing rabies virus G protein, characterized in that: The method comprises the step of culturing the transformant according to claim 6 under conditions suitable for the expression of the G protein.

8. A composition, characterized in that The composition comprises (1) the mRNA of claim 1 or 2, and (2) a delivery vector; Preferably, the delivery vehicle is a lipid nanoparticle; More preferably, the lipid nanoparticles are composed of cationic lipids, cholesterol, phospholipids and lipid conjugates; and / or, The N / P ratio of the ionizable lipid of the lipid nanoparticle to the mRNA is (2-20):1, preferably (3-15):1; More preferably, the lipid nanoparticles are composed of compound 6, cholesterol, DSPC and DMG-PEG2000, the molar ratio of compound 6: cholesterol: DSPC: DMG-PEG2000 is (45-50): (38.5-40): (10-12): (1.5-4), and the structural formula of compound 6 is as follows:

9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the mRNA according to claim 1 or 2, or the composition according to claim 8, and a pharmaceutically acceptable carrier and / or excipient.

10. A vaccine, characterized in that The vaccine comprises the mRNA of claim 1 or 2, the composition of claim 8 or the pharmaceutical composition of claim 9, and an adjuvant.

11. A method for preparing a composition for alleviating, preventing and / or treating a disease caused by rabies virus, characterized in that: The method comprises the steps of mixing an aqueous phase comprising mRNA with a lipid phase comprising a delivery vehicle, the mRNA and the delivery vehicle being as defined in the composition of claim 8; Preferably, the method adopts a microfluidic process; More preferably, the total flow rate of the microfluidic synthesis is 11-13 mL / min, preferably 12 mL / min; and / or the flow rate ratio of the aqueous phase to the lipid phase is 2:1-4:1, preferably 3:

1.

12. Use of the mRNA according to claim 1 or 2, the DNA according to claim 3, the rabies virus G protein according to claim 4, the recombinant expression vector according to claim 5 or the transformant according to claim 6 in the preparation of a drug for alleviating, preventing and / or treating a disease caused by rabies virus; Preferably, the disease is rabies; and / or the drug is a vaccine.

13. A method for alleviating, preventing and / or treating a disease caused by rabies virus, characterized in that: The method comprises administering to a subject the mRNA of claim 1 or 2, the composition of claim 8, the pharmaceutical composition of claim 9, and / or the vaccine of claim 10; Preferably, the disease is rabies.

Images