A molecular genetic marker affecting sexual maturation in swine and uses thereof

By detecting SNP sites in the promoter region of the porcine RBP1 gene and regulating ferroptosis in ovarian granulosa cells, the problem of low sexual maturity rate in gilts was solved, enabling precise assessment of sexual maturity and efficient breeding, thus improving reproductive performance.

CN119753156BActive Publication Date: 2026-01-13SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411502458.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-10-25
Publication Date
2026-01-13
Estimated Expiration
2044-10-25

AI Technical Summary

Technical Problem

In existing technologies, the sexual maturity rate of replacement gilts is low, leading to losses in pig farm production efficiency, and existing methods are difficult to effectively assess and improve the sexual maturity time and reproductive performance of pigs.

Method used

By detecting specific SNP sites in the promoter region of the retinol-binding protein 1 (RBP1) gene on chromosome 13 of the pig reference genome Sscrofa11.1, the age of puberty and the onset of puberty in pigs were assessed using SNP molecular markers, high-yielding breeding pigs were selected, primers were designed for gene detection, and ferroptosis in ovarian granulosa cells was regulated by overexpression or knockdown of the RBP1 gene.

Benefits of technology

It enables precise assessment of sexual maturity and early onset of puberty in pigs, improves reproductive performance, provides efficient molecular genetic markers for breeding, and significantly affects puberty and gonadal development in pigs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119753156B_ABST
    Figure CN119753156B_ABST
Patent Text Reader

Abstract

The application discloses a molecular genetic marker affecting pig sexual maturity and application thereof. The application takes RBP1 as a research object, and adopts molecular and cell biology methods to study the correlation between RBP1 and the initial estrus period. It is found that six SNP sites in the RBP1 promoter region are related to the initial estrus period. Further research shows that the promoter activity of the CC genotype of the g.80408109T>C site is significantly higher than that of the TT genotype, the promoter activity of the AA genotype of the g.80409632A>G site is significantly higher than that of the GG genotype, and it is confirmed that RBP1 can inhibit the ferroptosis of granulosa cells. It can be seen that the mutation in the RBP1 promoter region can affect the expression of RBP1, and RBP1 can accelerate the initial estrus start by inhibiting the ferroptosis of pig ovarian granulosa cells. The application has good application value for the research on ovarian follicle development and initial estrus start.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of cell engineering and genetic engineering technology, specifically relating to a molecular genetic marker that affects sexual maturation in pigs and its application. Background Technology

[0002] Pig farming, as an important component of my country's animal husbandry, plays a vital role in ensuring pork supply and rural economic development. In actual production, the incidence of gilts producing only one litter is relatively high. However, for pig farms, if gilts cannot produce three litters consecutively, it will cause significant losses in production efficiency. Therefore, selecting and breeding gilts with high reproductive performance is crucial to improving the productivity of pig farms.

[0003] Sexual maturity refers to the physiological state in which an animal reaches the point where it can reproduce sexually. This is typically manifested by the maturation of the gonads, elevated sex hormone levels, and the appearance of sexual behavior. Puberty is one of the most obvious signs of sexual maturity, indicating the time when an animal first exhibits estrus or ovulation. Studies have found that earlier sexual maturity increases the likelihood of multiple births and a longer productive lifespan for sows.

[0004] Retinol-binding protein 1 (RBP1) belongs to the RBP family and binds with high affinity to retinol and retinal, promoting the biosynthesis of retinoic acid. Previous studies have found that RBP1 can drive granulosa cell differentiation and accumulate in a ATP-dependent regulatory pathway. Research has shown that RBP1 protein expression is significantly higher in large bovine follicles than in small follicles, and that RBP1 protein levels, E2 concentration, and retinoic acid concentration in follicular fluid are positively correlated. In buffalo, RBP1 protein expression in the ovaries during puberty is significantly higher than before puberty. This suggests that RBP1 plays an important role in sexual maturation.

[0005] Promoters are an important component of gene expression regulation, recruiting transcription complexes to the transcription initiation site of a gene and initiating the transcription process. Single nucleotide polymorphisms (SNPs) in promoter regions may affect the expression levels of related genes, thereby influencing sexual maturation.

[0006] Ferroptosis is a non-apoptotic regulated cell death process dependent on iron and oxidative stress. Studies have found that iron accumulation in granulosa cells (GCs) can trigger ferroptosis, inhibiting follicle development. Inhibiting the ferroptosis pathway can reduce excessive granulosa cell death, thereby improving follicle growth and maturation, and influencing sexual maturation. Summary of the Invention

[0007] In order to overcome the shortcomings and deficiencies of the prior art, one of the objectives of this invention is to provide a molecular genetic marker that affects sexual maturity in pigs.

[0008] The second objective of this invention is to provide the application of the aforementioned molecular genetic markers that affect sexual maturity in pigs.

[0009] The objective of this invention is achieved through the following technical solution:

[0010] A molecular genetic marker that influences sexual maturation in pigs includes at least one of the following SNP molecular markers:

[0011] (1) The SNP site corresponding to the T>C mutation at the g.80408109 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -782bp);

[0012] (2) SNP sites corresponding to the T>C mutation at the g.80408854 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -1527bp);

[0013] (3) SNP sites corresponding to the g.80408992 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -1665bp) with G>A mutation;

[0014] (4) SNP sites corresponding to the g.80409145 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -1818bp) with C>T mutation;

[0015] (5) SNP sites corresponding to the A>G mutation at the g.80409353 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -2026bp);

[0016] (6) SNP sites corresponding to the A>G mutation at site g.80409632 on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -2305bp);

[0017] (7) The SNP site corresponding to the A>G mutation at the g.80409169 site on chromosome 13 of the pig reference genome Sscrofa11.1 (i.e., the promoter region of the retinol-binding protein 1 (RBP1) gene -1842bp).

[0018] Furthermore, the molecular genetic markers that influence the sexual maturity of pigs are preferably at least one of SNP molecular markers (1) and SNP molecular markers (6).

[0019] The applications of the aforementioned molecular genetic markers affecting sexual maturity in pigs include at least one of the following applications:

[0020] A. Application in assessing the age of puberty in pigs;

[0021] B. Application in determining the onset of estrus in pigs;

[0022] C. Application in the selection and breeding of high-yielding pig breeds.

[0023] Furthermore, in application A, the genotype at locus g.80408109 is detected, and individuals with genotype CC have a shorter age at puberty than TC and TT individuals; and / or, the genotype at locus g.80408854 is detected, and individuals with genotype CC have a shorter age at puberty than TC and TT individuals; and / or, the genotype at locus g.80408992 is detected, and individuals with genotype AA have a shorter age at puberty than GA and GG individuals; and / or, the genotype at locus g.80409145 is detected. The genotype of individuals with the TT genotype indicates that their age at puberty is shorter than that of individuals with the CT and CC genotypes; and / or, the genotype of individuals with the GG genotype at the g.80409353 locus indicates that their age at puberty is shorter than that of individuals with the AG and AA genotypes; and / or, the genotype of individuals with the AA genotype at the g.80409632 locus indicates that their age at puberty is shorter than that of individuals with the GA and GG genotypes; and / or, the genotype of individuals with the GG genotype at the g.80409169 locus indicates that their age at puberty is shorter than that of individuals with the AG and AA genotypes.

[0024] Furthermore, in application B, the genotype at locus g.80408109 is detected, and individuals with genotype CC initiate puberty faster than TC and TT individuals; and / or, the genotype at locus g.80408854 is detected, and individuals with genotype CC initiate puberty faster than TC and TT individuals; and / or, the genotype at locus g.80408992 is detected, and individuals with genotype AA initiate puberty faster than GA and GG individuals; and / or, the genotype at locus g.80409145 is detected. The genotypes were analyzed, and individuals with the TT genotype started experiencing puberty faster than those with the CT and CC genotypes; and / or, the genotype at the g.80409353 locus was analyzed, and individuals with the GG genotype started experiencing puberty faster than those with the AG and AA genotypes; and / or, the genotype at the g.80409632 locus was analyzed, and individuals with the AA genotype started experiencing puberty faster than those with the GA and GG genotypes; and / or, the genotype at the g.80409169 locus was analyzed, and individuals with the GG genotype started experiencing puberty faster than those with the AG and AA genotypes.

[0025] Further, in application C, the genotype at locus g.30088284 is detected, and individuals with genotypes GA and AA are selected as breeding pigs; and / or, the genotype at locus g.30088004 is detected, and individuals with genotype TT are selected as breeding pigs; the genotype at locus g.80408109 is detected, and individuals with genotype CC are selected as breeding pigs; and / or, the genotype at locus g.80408854 is detected, and individuals with genotype CC are selected as breeding pigs; and / or, the genotype at locus g.8040899 is detected. For each of the following genotypes: g.80409145, individuals with the genotype AA are selected as breeding pigs; and / or, for each of the following genotypes: g.80409353, individuals with the genotype GG are selected as breeding pigs; and / or, for each of the following genotypes: g.80409632, individuals with the genotype AA are selected as breeding pigs; and / or, for each of the following genotypes: g.80409169, individuals with the genotype GG are selected as breeding pigs.

[0026] Furthermore, the pigs mentioned include any one of Duroc and its synthetic lines.

[0027] The above applications are for non-diagnostic purposes.

[0028] A primer for identifying the aforementioned molecular genetic markers affecting sexual maturation in pigs, comprising:

[0029] F: 5′-ACACAGATCCCCTCTCTC-3′;

[0030] R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′.

[0031] Application of RBP1 gene in regulating ferroptosis in porcine ovarian granulosa cells, wherein the application is any one or more of the following:

[0032] I. Application of RBP1 gene overexpression in inhibiting ferroptosis in ovarian granulosa cells in vitro;

[0033] II. Application of knocking down the RBP1 gene to promote ferroptosis in ovarian granulosa cells in vitro.

[0034] Furthermore, the overexpression of the RBP1 gene is achieved by the following method: ligating the nucleic acid molecule encoding the porcine RBP1 gene to the pcDNA3.1 plasmid to construct an overexpression vector; then transfecting the overexpression vector containing the RBP1 gene into porcine ovarian granulosa cells cultured in vitro.

[0035] Furthermore, the knockdown of the RBP1 gene is achieved by transfecting siRNA, the siRNA sequence of which is as follows: RBP1-siRNA: 5′-GCAAACAGGACATCGTCTT-3′.

[0036] The promotion or inhibition of ferroptosis is determined by measuring the total iron and malondialdehyde (MDA) content and comparing the mRNA and protein expression levels of pathway marker genes.

[0037] The verification results of this invention are as follows:

[0038] 1. The RBP1 promoter region with a length of 2071bp was cloned.

[0039] 2. Fourteen SNP sites were found in the promoter region of the RBP1 gene, namely g.80407902A>G, g.80408010G>T, g.80408050C>G, g.80408083C>T, g.80408109T>C, g.80408237C>A, g.80408481G>A, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G.

[0040] 3. It was found that the following six loci have two genotypes: g.80407902A>G, g.80408010G>T, g.80408050C>G, g.80408083C>T, g.80408237C>A, and g.80408481G>A. The following eight loci have three genotypes: g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G.

[0041] 4. The dominant genotypes were found to be: AA at the A>G locus (g.80407902), GG at the G>T locus (g.80408010), CC at the C>G locus (g.80408050), CC at the C>T locus (g.80408083), CC at the T>C locus (g.80408109), CC and TC at the T>C locus (g.80408237), CC at the C>A locus (g.80408481), and GG at the G>A locus (g.80408481). Genotypes: g.80408854T>C locus CC is the dominant genotype; g.80408992G>A locus AA is the dominant genotype; g.80409145C>T locus TT is the dominant genotype; g.80409169A>G locus GG is the dominant genotype; g.80409353A>G locus GG is the dominant genotype; g.80409546A>C locus AA is the dominant genotype; g.80409632A>G locus AG is the dominant genotype.

[0042] 5. At the site g.80407902A>G, heterozygosity was 0.04136, effective allele count was 1.043, polymorphism information content was 0.04051, and the p-value for Hardy-Weinberg equilibrium was 0. At the site g.80408010G>T, heterozygosity was 0.13695, effective allele count was 1.159, polymorphism information content was 0.12757, and the p-value for Hardy-Weinberg equilibrium was 1.751e-30. At the site g.80408050C>G, heterozygosity was 0.13695, effective allele count was 1.159, polymorphism information content was 0.12757, and the p-value for Hardy-Weinberg equilibrium was 1.751e-30. The heterozygosity of g.80408083T>C locus is 0.15473, the effective number of alleles is 1.183, the polymorphism information content is 0.14276, and the p-value for Hardy-Weinberg equilibrium is 1.424e-22. The heterozygosity of g.80408109T>C locus is 0.48324, the effective number of alleles is 1.935, the polymorphism information content is 0.36648, and the p-value for Hardy-Weinberg equilibrium is 5.643e-01. The heterozygosity of g.80408237C>A locus is 0.14293, the effective number of alleles is 1.167, the polymorphism information content is 0.13271, and the p-value for Hardy-Weinberg equilibrium is 1.829e-27. The heterozygosity of g.80408481G>A locus is 0.12485, the effective number of alleles is 1.143, the polymorphism information content is 0.11706, and the p-value for Hardy-Weinberg equilibrium is 4.236e-38. The heterozygosity of g.80408854T>C locus is 0.49446, the effective number of alleles is 1.978, the polymorphism information content is 0.37221, and the p-value for Hardy-Weinberg equilibrium is 3.157e-01. The heterozygosity of g.80408992G>A locus is 0.49688, the effective number of alleles is 1.988, the polymorphism information content is 0.37344, and the p-value for Hardy-Weinberg equilibrium is 2.831e-01. The heterozygosity of the g.80409145C>T locus is 0.49688, the effective number of alleles is 1.988, the polymorphism information content is 0.37344, and the p-value for Hardy-Weinberg equilibrium is 2.831e-01. The heterozygosity of the g.80409169A>G locus is 0.46182, the effective number of alleles is 1.858, the polymorphism information content is 0.35518, and the p-value for Hardy-Weinberg equilibrium is 1.580e-01. The heterozygosity of the g.80409353A>G locus is 0.48303, the effective number of alleles is 1.934, the polymorphism information content is 0.36637, and the p-value for Hardy-Weinberg equilibrium is 2.792e-01.At the g.80409546A>C locus, heterozygosity was 0.21875, effective allele count was 1.280, polymorphism information content was 0.19482, and the p-value for Hardy-Weinberg equilibrium was 1.210e-11. At the g.80409632A>G locus, heterozygosity was 0.49008, effective allele count was 1.961, polymorphism information content was 0.36999, and the p-value for Hardy-Weinberg equilibrium was 6.343e-01.

[0043] 6. The RBP1 promoter regions g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, and g.80409632A>G were highly significantly associated with puberty (P<0.01), and g.80409169A>G was significantly associated with puberty (P<0.05).

[0044] 7. The promoter activity of the CC genotype at the 80408109T>C site was significantly higher than that of the TT genotype. The promoter activity of the AA genotype at the 80409632A>G site was significantly higher than that of the GG genotype.

[0045] 8. OE-NC and OE-RBP1 at concentrations of 0.25 ng / μL, and siRNA-NC (hereinafter referred to as KD-NC) and siRNA-RBP1 (hereinafter referred to as KD-RBP1) at concentrations of 100 nM were transfected into GCs. qPCR results showed that, compared with the OE-NC group, OE-RBP1 treatment significantly upregulated RBP1 mRNA expression (P<0.01). Compared with the KD-NC group, the KD-RBP1 group downregulated RBP1 expression by 86%, demonstrating a significant knockdown effect (P<0.05). Therefore, a plasmid concentration of 0.25 ng / μL and siRNA of 100 nM were selected for subsequent experiments. Western blot was used to detect changes in intracellular RBP1 protein expression after treatment with OE-NC, OE-RBP1, KD-NC and KD-RBP1. The results showed that compared with the OE-NC group, the RBP1 protein expression level in the OE-RBP1 group increased, and compared with the KD-NC group, the RBP1 protein expression level in the KD-RBP1 group decreased.

[0046] 9. Volcano plot analysis revealed that compared to the OE-NC group, the OE-RBP1 group had 976 differentially upregulated genes and 1643 differentially downregulated genes. Based on the significantly differentially expressed genes between the two groups, GO enrichment analysis was performed on the differentially expressed genes, and the results showed that the differentially expressed genes are mainly involved in biological processes such as cell death and glutathione metabolism.

[0047] 10. Compared with the OE-NC group, the intracellular Fe content in the OE-RBP1 group was significantly decreased (P<0.01), while compared with the KD-NC group, the intracellular Fe content in the KD-RBP1 group was significantly increased (P<0.05).

[0048] 11. Compared with the OE-NC group, the concentration of MDA in the OE-RBP1 group was significantly lower (P<0.05). Compared with the KD-NC1 group, the concentration of MDA in the KD-RBP1 group was significantly higher (P<0.05).

[0049] 12. Compared with the control group, overexpression of RBP1 significantly upregulated the mRNA levels of GPX4, SLC7A11, FTH1, and CBS (P<0.05), significantly downregulated the mRNA levels of P53, NOX1, NOX2, LPCAT3, and ACSL4 (P<0.05), and extremely significantly downregulated the mRNA levels of TFRC and COX2 (P<0.01). Simultaneously, it upregulated the protein expression levels of GPX4 and FTH1 and downregulated the protein expression level of P53. Knockdown of RBP1 significantly downregulated the mRNA levels of GPX4 and FTH1 (P<0.05), extremely significantly downregulated the mRNA levels of SLC7A11 and CBS (P<0.01), significantly upregulated the mRNA level of COX2 (P<0.05), and extremely significantly upregulated the mRNA levels of TFRC, P53, NOX1, NOX2, LPCAT3, and ACSL4 (P<0.01). Simultaneously, the protein expression levels of GPX4 and FTH1 were downregulated while the protein expression level of P53 was upregulated.

[0050] The present invention has the following advantages and effects compared with the prior art:

[0051] 1. This invention uses a binary hybrid population of Duroc and local black pigs as the research object. Ear samples of Duroc and local black pigs were collected, and the nucleotide sequence of the RBP1 promoter region of each pig was cloned by PCR technology and Sanger sequencing of individual samples was performed, and a total of 14 SNPs were found.

[0052] 2. Genotyping of SNP loci was successfully performed using SnapGene 4.2.4 software.

[0053] 3. Genotype frequencies and gene frequencies of 14 SNP loci, as well as population genetic structure, were obtained, and loci affecting sow sexual maturity were identified, providing molecular genetic markers for breeding.

[0054] 4. This invention uses porcine ovarian granulosa cells as experimental material and employs RNA-seq sequencing technology to study the biological processes of ovarian granulosa cells regulated by RBP1.

[0055] 5. In summary, this invention uses RBP1 as the research object and employs molecular and cell biological methods to study its correlation with puberty: the RBP1 promoter regions g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, and g.80409632A>G were highly significantly correlated with puberty (P<0.01), and g.80409169A>G was significantly correlated with puberty (P<0.05). Further studies showed that the promoter activity of the CC genotype at the g.80408109T>C site was significantly higher than that of the TT genotype, and the promoter activity of the AA genotype at the g.80409632A>G site was significantly higher than that of the GG genotype. It was also confirmed that RBP1 can inhibit ferroptosis in granulosa cells. It is evident that mutations in the RBP1 promoter region affect RBP1 expression, and RBP1 accelerates the onset of puberty by inhibiting ferroptosis in porcine ovarian granulosa cells. This invention has significant application value for studying ovarian follicular development and the onset of puberty.

[0056] 6. The technical solution of this invention is detailed and the results are reliable. Attached Figure Description

[0057] Figure 1 This is an image showing the electrophoresis results of the PCR amplification products from the RBP1 promoter region.

[0058] Figure 2 This is a genotyping diagram of 14 SNP loci.

[0059] Figure 3 This is a promoter activity diagram of different genotypes at the g.80408109 and g.80409632 loci.

[0060] Figure 4 This is a graph showing the efficiency of RBP1 overexpression or interference; Note: A. RBP1 mRNA level overexpression efficiency; B. RBP1 protein level overexpression efficiency; C. RBP1 mRNA level knockdown efficiency; D. RBP1 protein level knockdown efficiency. * indicates P<0.05, ** indicates P<0.01.

[0061] Figure 5 This is a transcriptome diagram of the effect of RBP1 on porcine ovarian granulosa cells; Note: A. Statistical diagram of differentially expressed genes in the OE-NC group and the OE-RBP1 group; B. Volcano plot of differentially expressed genes; C. GO enrichment classification bar chart of differentially expressed genes.

[0062] Figure 6 This is a graph showing the effect of RBP1 on the intracellular Fe content of porcine ovarian granulosa cells.

[0063] Figure 7This is a graph showing the effect of RBP1 on the level of MDA in porcine ovarian granulosa cells.

[0064] Figure 8 This is a graph showing the effect of RBP1 on the expression levels of ferroptosis-related genes in porcine ovarian granulosa cells; Note: A. Effect of RBP1 overexpression on the mRNA level of ferroptosis-related genes; B. Effect of RBP1 overexpression on the protein level of ferroptosis-related genes; C. Effect of RBP1 knockdown on the mRNA level of ferroptosis-related genes; D. Effect of RBP1 knockdown on the protein level of ferroptosis-related genes. Detailed Implementation

[0065] The present invention will be further described in detail below with reference to embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto. Experimental methods in the following embodiments that do not specify specific conditions are generally performed under conventional conditions. Unless otherwise stated, the reagents and raw materials used in the present invention are commercially available.

[0066] In this invention, statistical methods are applied to analyze the results of three independent experiments in each embodiment, and the "mean ± standard deviation" is calculated respectively. One-way ANOVA is used to analyze the significance of differences (in the figure, "*" indicates P<0.05, and "**" indicates P<0.01).

[0067] The test samples collected in the following examples were ear samples from Duroc and local black pigs (referred to as Duroc-Black pigs). The sampling location was at the Niujiaowan R&D Farm of Guangdong Yihao Food Co., Ltd., and all pigs were fed and managed according to the same standards.

[0068] Example 1: DNA extraction from pig ear samples

[0069] (1) Cut 30 mg of pig ear sample into a 1.5 mL centrifuge tube and then cut it into small pieces with scissors. Add 200 mL of TL Buffer and 25 μL of OB Protease Solution to each centrifuge tube, vortex to mix the sample and solution thoroughly, and then incubate in a 55 °C water bath for 12 h.

[0070] (2) Centrifuge the centrifuge tube at 13000×g for 5 min. Transfer the supernatant to a new 1.5 mL centrifuge tube. If there is sediment floating, centrifuge again and then transfer the supernatant to the centrifuge tube.

[0071] (3) Add 220 μL of BL Buffer, vortex thoroughly, and incubate in a 70°C water bath for 10 min. Add 220 μL of anhydrous ethanol and vortex thoroughly.

[0072] (4) Place the pillar ( Place the DNA Mini Column into a 2 mL collection tube. Transfer all the sample from the centrifuge tube to the column, centrifuge at 13000×g for 1 min, and discard the filtrate.

[0073] (5) Add 500 μL of HBC Buffer diluted with isopropanol to the column, centrifuge at 13000×g for 1 min, and discard the filtrate and collection tube.

[0074] (6) Place the column into a new 2 mL collection tube, add 700 μL of DNA Wash Buffer diluted with anhydrous ethanol, centrifuge at 13000 × g for 1 min, and discard the filtrate. Repeat once to wash the DNA again.

[0075] (7) Centrifuge the empty column at 13000×g for 2 min and dry for 3 min. Transfer the column to a 1.5 mL centrifuge tube containing no nucleic acid. Add 100 μL of Elution Buffer preheated to 70 °C to the column. Let stand at room temperature for 2 min, then centrifuge at 13000×g for 1 min to elute the DNA.

[0076] (8) The purity and integrity of the DNA were detected by ultraviolet spectrophotometer, and the high-quality DNA obtained was stored at -20℃ for later use.

[0077] Example 2: Primer design for the RBP1 promoter region

[0078] The nucleotide sequence of porcine RBP1 (NC_010455.5, ID:100156666) was found using NCBI online data, and primers were designed using the Pick Primers module for the upstream 3000bp and downstream 500bp of the 5'UTR end. The designed primers were then synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0079] F: 5′-ACACAGATCCCCTCTCTC-3′;

[0080] R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′.

[0081] Example 3: Cloning of the RBP1 promoter region

[0082] Using extracted Dubai pig ear-like gDNA as a template, the RBP1 and PLPP3 promoter regions were amplified using Taq polymerase. The reaction system and reaction procedure are shown below (Table 1 and Table 2).

[0083] Table 1. PCR reaction system

[0084]

[0085] Table 2. PCR reaction procedure

[0086]

[0087] Example 4: Identification of RBP1 promoter region

[0088] Weigh 0.6g of agarose and add it to a 40mL Erlenmeyer flask containing 1×TAE. Microwave for 1 minute. Observe that the agarose is completely dissolved, then place the Erlenmeyer flask in cold water. When it cools to room temperature, add 2μL of nucleic acid dye, gently shake well, pour into a gel bath, and insert a comb. Let it stand at room temperature for 30 minutes until the liquid solidifies. Remove it and place it in an electrophoresis apparatus for sample loading. Select a DNA marker with a length of 10000bp according to the size of the target fragment. Set the voltage to 150V and the timer for 20-25 minutes. After electrophoresis, observe the band positions using a fully automated chemiluminescence imaging analysis system. If the bands match the expected product size, send the amplified product to Sanger sequencing at Sangon Biotech (Shanghai) Co., Ltd.

[0089] Example 5: The sequencing results were assembled and the SNP loci genotypes were analyzed using SnapGene 4.2.4 software. Excel was used to statistically analyze the genotype frequency, heterozygosity, effective allele count, polymorphism information content, and whether the locus was in Hardy-Weinberg equilibrium for each locus.

[0090] Example 6: Association Analysis

[0091] The genetic association between SNPs and puberty was analyzed using R language (v4.03) and a generalized linear model (GLM). The model is as follows:

[0092] Yij=L+Gj

[0093] Where Yij is the observed age of puberty in the i-th animal, L is the mean age of puberty, and Gj represents the genotype effect. For different genotypes, they are encoded as dummy variables through categorical variable encoding. Statistical data are expressed as mean ± standard deviation.

[0094] Example 7: Isolation and culture of porcine ovarian granulosa cells

[0095] Ovaries from commercial sows collected from Kongwangji slaughterhouse were washed twice with phosphate-buffered saline (PBS) containing 1% penicillin-streptomycin and then immersed in PBS to maintain a low-temperature environment before being transported back to the laboratory. In the laboratory, the ovaries were placed in cleaned beakers and washed with PBS containing 1% penicillin-streptomycin until no blood remained. Then, 75% alcohol was added and soaked for 30 seconds, after which the alcohol was discarded. The ovaries were then washed several times with PBS containing 1% penicillin-streptomycin before being sealed and placed in the cell transfer window of the cell culture room.

[0096] Using a 1mL disposable sterile syringe, aspirate 1-2mL of follicular fluid from follicles approximately 3-5mm in diameter and transfer it to a 15mL centrifuge tube containing 4mL of complete culture medium. Centrifuge at 1000rpm for 5min at room temperature. Discard the supernatant, add 3mL of PBS containing 1% penicillin-streptomycin, gently pipette to resuspend the cells, centrifuge, discard the supernatant, and repeat once. Add 3mL of complete culture medium to resuspend the cells, then seed the cells into cell culture flasks, gently shake in a cross-hatching pattern to mix, and incubate statically at 37℃ with 5% CO2. After 48h, change the medium and observe cell adhesion and growth status, then continue culturing.

[0097] Example 8: Isolation, culture and transfection of porcine ovarian granulosa cells

[0098] When the confluence of porcine GCs reaches approximately 80%, discard the culture medium in the flask and wash twice with PBS containing 1% penicillin-streptomycin, then discard the PBS. Add 3 mL of trypsin to the flask, place it in a cell culture incubator for 5 minutes of digestion, and observe cell adhesion under a microscope. When most cells appear round and float with the liquid, digestion is complete. Add 4 mL of complete culture medium to stop digestion. After agitating the culture flask wall with a pipette tip, transfer the mixture in the flask to a 15 mL centrifuge tube and centrifuge at 1000 rpm for 5 minutes at room temperature. Discard the supernatant, wash twice with PBS containing 1% penicillin-streptomycin, then discard the supernatant. Add 3 mL of complete culture medium to resuspend the cells and seed them into cell culture plates. Gently shake in a cross pattern to mix, then incubate statically in a 37°C, 5% CO2 incubator. After 24 hours, observe cell adhesion and growth. When the confluence of GCs reaches 70-80%, discard the complete culture medium, wash twice with PBS, and add incomplete culture medium.

[0099] Preparation of solution A: Opti-MEM and Lipofectamine TM Mix thoroughly with P3000. Prepare solution B: Mix Opti-MEM, overexpression plasmid, and P3000, or Opti-MEM and small RNA fragment, and gently mix. Add solution A to solution B, gently pipette to mix, and incubate at room temperature in the dark for 15 min. The construction of the overexpression plasmid is as follows:

[0100] Basic plasmid: pcDNA3.1 plasmid

[0101] Insertion sites: BamHI and EcoRI

[0102] The sequence of the inserted target fragment: ATGCCGGTCGACTTTACCGGGTACTGGAAGATGCTGGCCAACGAGAATTTCGAGGAGTATCTGCGTGCGCTGGATGTCAATGTGGCCTTGCGCAAAATTGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGCAACCACATGATCATCCGCACGCTGAGCACTTTTAGGAACTACATCATGGACTTCGAGG TTGGAAAGGAGGTTTGAGGAGGATCTGACCGGCATAGACGACCGCAAGTGCATGACCACAGTGAGCTGGGATGGGGACAAGCTCGAGTGTGTGCAGAAGGGTGAGAAGGAGGGACGTGGCTGGACCCAGTGGATTGAAGGTGACGAGCTGCACCTGGAGATGAGAGTGCAGGGCGTGGCCTGCAAGCAAGTGTTCAAAAAGGTGAACTGA.

[0103] The siRNA sequence of the small RNA fragment is as follows: 5'-AGGTTGGAAAGGAGTTTGA-3'.

[0104] Add the AB solution mixture to the cell culture plate, gently shake in a cross shape to thoroughly mix the mixture with the culture medium, and then place the culture plate in a 5% CO2 incubator for 24 hours of transfection. Conduct subsequent experiments according to the experimental design.

[0105] Example 9: RNA sampling and quality control

[0106] (1) Total RNA from cells was extracted according to the instructions of the RNAfast200 Total RNA Extraction Kit.

[0107] ① Discard the cell culture medium, wash the cells twice with PBS, and digest them with trypsin at 37°C for 5 min. Terminate the digestion with complete culture medium, transfer the cells to a centrifuge tube, centrifuge at 10,000 rpm for 5 min, collect the cells, wash them twice with PBS, and centrifuge to collect the cell pellet.

[0108] ② Add 100 μL of PBS to the cell pellet, resuspend the cells, and transfer them to a 1.5 mL centrifuge tube;

[0109] ③ Add 500 μL of RA2, invert 5-10 times until the lysate is clear, and let stand for 1 min;

[0110] ④ Transfer all the lysate to a column fitted inside the collection tube and centrifuge at 12,000 rpm for 1 min;

[0111] ⑤ Discard the liquid in the collection tube and add 500 μL of washing solution diluted with anhydrous ethanol to the column. Centrifuge for 1 min, discard the filtrate, and repeat this step once.

[0112] ⑥ Centrifuge for 1 minute without adding washing solution;

[0113] ⑦ Transfer the column to a new 1.5 mL centrifuge tube and add 30 μL of elution buffer to the center of the membrane;

[0114] ⑧ After standing at room temperature for 1 minute, centrifuge for 1 minute to obtain total RNA.

[0115] (2) The purity and integrity of total RNA were detected by ultraviolet spectrophotometer, and the obtained high-quality RNA was stored in a -80℃ refrigerator for later use.

[0116] Example 10: RNA Reverse Transcription

[0117] Reaction system: 2 μL of 5×PrimeScript RT premix, total RNA ≤500 ng, adjust the system to 10 μL with RNase-free H2O.

[0118] Reaction procedure: 37℃ for 15 min, 85℃ for 5 s.

[0119] The cDNA obtained by reverse transcription was stored in a -20°C freezer.

[0120] Example 11: qPCR detection of gene mRNA expression levels

[0121] The target gene's CDS region sequence was located in the NCBI database, and quantitative primers were designed using the Primer Blast module within the NCBI database. Table 3 lists all the primers used for qPCR.

[0122] use The relative mRNA levels of the gene were quantified using qPCR SYBR Green Master Mix (2×) and the CFX96 Touch Real-Time PCR system. GAPDH was selected as an endogenous control, and the 2-ΔΔct method was used for analysis. The total reaction volume for each sample was 20 μL, including 10 μL of SYBR Green Master Mix, 0.3 μL of forward primer, 0.3 μL of reverse primer, 1 μL of diluted cDNA template, and 7.8 μL of RNA-free water. The cycling conditions were as follows: 95℃ pre-denaturation for 10 min, 1 cycle; 95℃ denaturation for 15 s, 40 cycles; 60℃ annealing / extension for 1 min, 40 cycles.

[0123] Table 3. List of qPCR primers

[0124]

[0125]

[0126] The above-mentioned primer species are all pigs.

[0127] Example 12: Protein extraction, concentration determination and denaturation

[0128] (1) Protein extraction: 24 h after cell transfection, the culture medium in the six-well plate was discarded and the cells were washed twice with 1×PBS. 100 μL of RIPA lysis buffer containing 1% protease inhibitor was added to each well, and the cells were incubated on ice for 15 min. The cells were repeatedly pipetted into the wells to ensure complete lysis. The cells were then transferred to 2 mL centrifuge tubes and centrifuged at 12,000 rpm at 4 °C for 10 min. The supernatant was collected.

[0129] (2) Protein concentration determination: Follow the instructions of the BCA protein detection kit for operation steps, plot the standard curve based on the results, and calculate the corresponding protein sample concentration.

[0130] (3) Protein denaturation: Add 5× protein loading buffer (containing DTT) and ddH2O to quantify the protein concentration to 1000 ng / μL, denature at 99℃ for 10 min, and store at -20℃ for later use.

[0131] Example 13: Western Blot

[0132] (1) Load 12 μL of protein sample onto a 10% protein prepreg gel and electrophoresis at 130V for 50 min.

[0133] (2) Accurately and quickly cut the strip containing the target protein according to the protein Maker and transfer it to the polyvinylidene fluoride (PVDF) membrane, taking care to ensure that there are no air bubbles between the strip and the PVDF membrane.

[0134] (3) Using eBlot TM The L1 membrane converter transfers the proteins from the gel strip to the PVDF membrane. After the transfer is complete, the PVDF membrane is washed three times with TBST for 5-10 minutes each time.

[0135] (4) Place the PVDF membrane in 5% skim milk powder and seal it at room temperature and low speed for 2 hours.

[0136] (5) Discard the milk powder and wash the membrane with TBST 3 times, 5-10 minutes each time.

[0137] (6) Place the membrane in the primary antibody dilution solution and incubate overnight at 4°C.

[0138] (7) Wash the membrane with TBST 3 times, each time for 5-10 minutes.

[0139] (8) Place the PVDF membrane in the secondary antibody dilution solution and incubate it on a shaker at room temperature for 1.5-2 hours.

[0140] (9) Wash the membrane with TBST 3 times, each time for 5-10 minutes.

[0141] (10) Add ECL developer and use a fully automated chemiluminescence image analysis system for development.

[0142] Example 14: Determination of total iron content

[0143] The total iron content in the cells was extracted according to the instructions of the total iron colorimetric assay kit.

[0144] (1) Sample preparation

[0145] ① Discard the cell culture medium, wash the cells twice with PBS, and collect the cells in a 1.5 mL centrifuge tube using trypsin digestion.

[0146] ② Add 200 μL of reagent one to each tube, mix well by pipetting, and place on ice for lysis for 10 min.

[0147] ③ Centrifuge at 15000×g for 10 min at room temperature, transfer the supernatant to a new 1.5mL centrifuge tube, and store in a 4℃ refrigerator for later use.

[0148] (2) Operation steps

[0149] ① Prepare iron standards of different concentrations according to the instructions (prepare fresh for each use).

[0150] ② Add 80 μL of different concentrations of standard to the corresponding wells of the ELISA plate as standard wells, and add 80 μL of the sample to be tested as assay wells.

[0151] ③ Add 80 μL of reagent 2 to the standard well and the test well.

[0152] ④ Gently shake the microplate to mix the solution thoroughly, and incubate at 37°C for 40 minutes.

[0153] ⑤ Use an ELISA reader to measure the OD value of each well at 593 nm.

[0154] (3) Calculation results

[0155] Fitting curve for standard sample: y = ax + b

[0156] Cell samples:

[0157] Note: y: OD value of standard - OD value of blank (OD value when the concentration of standard is 0); x: concentration of standard; a: slope of standard curve; b: intercept of standard curve; ΔA: absolute OD value of sample (OD value of assay well - OD value of blank well); N: number of cell samples used for lysis / 10⁶; V: amount of reagent added during cell sample processing (mL); f: dilution factor of sample before being added to the detection system.

[0158] Example 15: Determination of Malondialdehyde (MDA) Content

[0159] Malondialdehyde (MDA) content in cells was extracted according to the instructions of the MDA colorimetric assay kit.

[0160] (1) Sample preparation

[0161] Discard the cell culture medium, wash the cells twice with PBS, scrape the cells off with a cell scraper, transfer the cells to a centrifuge tube with a pipette, add 500 μL of reagent five extraction buffer, place on a vertical mixer and shake for 2 min to fully mix the extraction buffer with the cells, then use an ultrasonic cell disruptor to disrupt the cells and prepare a suspension, store in a 4℃ refrigerator for later use.

[0162] (2) Operation steps

[0163] ① Prepare several 1.5mL centrifuge tubes. Divide them into 3 groups, including the following parts:

[0164] Blank tube: Add 100 μL of anhydrous ethanol.

[0165] Standard tube: Add 100 μL of 10 nmol / mL standard.

[0166] Sample tube: Add 100 μL of the sample to be tested.

[0167] ② Add 1 mL of working solution to each tube.

[0168] ③ Invert the centrifuge tube to mix the solution thoroughly, cover the cap of the centrifuge tube with plastic wrap, make a small hole in the plastic wrap, and place it in a water bath at 100°C for 40 minutes.

[0169] ④ Cool it to room temperature with running water and centrifuge at 1078×g for 10 min.

[0170] ⑤ Carefully aspirate 250 μL of the supernatant into a 96-well microplate.

[0171] ⑥ Use an enzyme-linked immunosorbent assay (ELISA) reader to measure the OD value of each well at 532 nm.

[0172] (3) Calculation results

[0173] Formula for calculating malondialdehyde (MDA) content in cells:

[0174] Note: ΔA1: OD value of test tube - OD value of blank tube; ΔA2: OD value of standard tube - OD value of blank tube; C: concentration of standard (10 nmol / mL); f: dilution factor of sample before addition to the detection system; Cpr: protein concentration of the sample to be tested (mgprot / mL).

[0175] Example 16: Transfection of recombinant plasmids and detection of dual fluorescence activity

[0176] (1) Transfection

[0177] ① When the GCs in the cell culture plate reach 70-80% fusion, discard the complete culture medium, wash twice with PBS, and then add the incomplete culture medium.

[0178] ② Prepare the transfection mixture. Prepare solution A: Opti-MEM and Lipofectamine TM Mix thoroughly with P3000. Prepare solution B: Gently mix Opti-MEM, recombinant pGL-3 plasmid, pGL-TK plasmid, and P3000. Add solution A to solution B, gently pipette to mix, incubate at room temperature in the dark for 15 min, and then transfer to cell culture plates. Note that the mass ratio of recombinant pGL-3 plasmid to pGL-TK plasmid is 19:1.

[0179] The pRL-TK plasmid was a commercially available plasmid obtained from the Guangdong Provincial Key Laboratory of Agricultural Animal Genomics and Molecular Breeding. The recombinant plasmids included wild-type and mutant vectors at the g.80408109T>C site, named WT-8109 and Mut-8109; and wild-type and mutant vectors at the g.80409632A>G site, named WT-9632 and Mut-9632. All were synthesized by Wuhan Jinkairui Biotechnology Co., Ltd., using the pGL3-basic base plasmid and KpnI and XhoI cloning sites. The target sequences are as follows:

[0180] WT-8109 target sequence (g.80408109T): CTCGAGCTTCTCACTGCTTGGAGTGTCCCCGCTTTACAGATGTGGCAACTGAGGCACAGAAGGGAGGAGCCACTTAACCGAGACCACTCAGCTACACAGTGACATGACCAGCTTCAAACCTTACCCTCTGCCTCTCGAGCCTGTCCTCACAACCAACCCCCAGCTACCCAGAATAGCACAGCCAACAGGGTCTGCCCTTGGGAGGGTACC

[0181] Mut-8109 target sequence (g.80408109C): CTCGAGCTTCTCACTGCTTGGAGTGTCCCCGCTTTACAGATGTGGCAACTGAGGCACAGAAGGGAGGAGCCACTTAACCGAGACCACTCAGCTACACAGTGACACGACCAGCTTCAAACCTTACCCTCTGCCTCTCGAGCCTGTCCTCACAACCAACCCCCAGCTACCCAGAATAGCACAGCCAACAGGGTCTGCCCTTGGGAGGGTACC

[0182] WT-9632 target sequence (g.80409632G): CTCGAGCCCGCCAGGTGGGAAATGAGATGTGCTCCAAGGTCTTCACTGCGGTACTGTTTCTAACAGTCAAAGATCGGAAACGACATCAATGTCCATCAGGGGCCAGGCTGGATAGACAATGGAATATCCTGCAAAAGAATGAGGGTGCTTTCTATGTATGGGTATGGAAAGGGCTCCAGAAGAGAGTAAGTGGAAAAAGAAAATGGTACC

[0183] Mut-9632 target sequence (g.80409632A): CTCGAGCCCGCCAGGTGGGAAATGAGATGTGCTCCAAGGTCTTCACTGCGGTACTGTTTCTAACAGTCAAAGATCGGAAACGACATCAATGT CCATCAGGGGCCAAGCTGGATAGACAATGGAATATCCTGCAAAAGAATGAGGGTGCTTTCTATGTATGGGTATGGAAAGGGCTCCAGAAGAGAGTAAGTGGAAAAAGAAAATGGTACC.

[0184] (2) Dual fluorescence activity detection

[0185] Refer to the instructions for the Dual Luciferase Reporter Gene Detection Kit for promoter region activity assay.

[0186] ① Discard the culture medium, add cell culture lysis buffer, and gently rotate the culture plate to completely cover the cells with the lysis buffer.

[0187] ②Incubate on ice for 5 minutes to fully lyse the cells.

[0188] ③ Centrifuge at 10000-16000 rpm for 1 min and collect the supernatant.

[0189] ④ Take 20 μL of lysis buffer and add it to a 96-well culture plate, with 3 replicates per group. Add 100 μL of firefly luciferase reaction solution and detect the luminescence value of firefly luciferase; add 100 μL of kidney luciferase reaction solution and detect the activity of kidney luciferase.

[0190] ⑤ Calculation: Relative activity = Luminescence value of firefly luciferase / Luminescence value of Renilla luciferase

[0191] Example 17: RNA-Seq

[0192] (1) Sample processing: There were 4 treatment groups, with 3 replicates in each group. pcDNA3.1, pcDNA3.1-RBP1, siRNA-NC, and siRNA-RBP1 were transfected into GCs, treated for 24 h, digested and collected, washed twice with PBS, and Trizol was added. The cells were named according to the treatment and RNA-Seq was performed by BGI Genomics.

[0193] (2) Data Analysis: After correcting for sequencing depth and gene or transcript length, the FPKM values ​​of the genes were obtained, followed by subsequent analysis. Using the FPKM values ​​of each gene, significantly differentially expressed genes between the comparison groups were detected, and volcano plot analysis was performed. Differentially expressed genes were mapped to various terms in the GO database, and the number of differentially expressed genes in each term was calculated, thus obtaining a list of differentially expressed genes with specific GO functions and their statistical counts. The hypergeometric test was then used to compare with background genes to identify GO entries that were significantly enriched in the differentially expressed genes.

[0194] Results analysis:

[0195] 1. Cloning the RBP1 starter region

[0196] Using primers for the RBP1 promoter and Duchenne hog DNA as a template, the RBP1 promoter region was amplified by PCR. The PCR products were then subjected to agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, a specific band of the expected size was obtained. After extensive PCR amplification, the PCR product was sent to Sanger sequencing.

[0197] 2. SNP mutations in the RBP1 promoter region

[0198] The sequencing peak diagram was viewed using Snapgene 4.2.4 software and compared with the pig RBP1 gene sequence in NCBI to screen SNP sites and perform genotyping. There are 14 SNP sites in the RBP1 promoter region (…). Figure 2 The genotypes are g.80407902A>G, g.80408010G>T, g.80408050C>G, g.80408083T>C, g.80408109T>C, g.80408237C>A, g.80408481G>A, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G, g.80409546A>C, and g.80409632A>G. Among these, six loci have two genotypes, and eight loci have three genotypes.

[0199] 3. Genotype and allele frequencies of SNPs in the RBP1 promoter region

[0200] Based on the peak plot, the genotype results were statistically analyzed, and the genotype frequencies and allele frequencies of SNPs were calculated. Table 4 shows that AA is the dominant genotype at the g.80407902A>G site, GG is the dominant genotype at the g.80408010G>T site, CC is the dominant genotype at the g.80408050C>G site, CC is the dominant genotype at the g.80408083C>T site, and CC and TC have the same genotype frequency at the g.80408109T>C site, both being dominant genotypes. The dominant genotypes are: g.80408237C>A (CC), g.80408481G>A (GG), g.80408854T>C (CC), g.80408992G>A (AA), g.80409145C>T (TT), g.80409169A>G (GG), g.80409353A>G (GG), g.80409546A>C (AA), and g.80409632A>G (GA).

[0201] 4. Population genetic structure analysis of SNPs in the RBP1 promoter region

[0202] The population genetic structure analysis results of SNPs in the promoter region of the RBP1 gene are shown in Table 5. The chi-square test showed that the sites g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409169A>G, g.80409353A>G and g.80409632A>G in this population were in Hardy-Weinberg equilibrium (P>0.05).

[0203] 5. Association analysis of RBP1 promoter region SNPs with puberty

[0204] One-way ANOVA was used to perform association analysis on different individual genotypes and puberty stages. Table 6 shows that the following RBP1 promoter regions were highly significantly associated with puberty (P<0.01): g.80408109T>C, g.80408854T>C, g.80408992G>A, g.80409145C>T, g.80409353A>G, and g.80409632A>G; and significantly associated with puberty (P<0.05): g.80409169A>G.

[0205] 6. Effects of different genotypes at polymorphic sites in the porcine RBP1 promoter region on transcriptional activity

[0206] The promoter activity of the CC genotype at the g.80408109T>C site was significantly higher than that of the TT genotype, indicating that the CC genotype may promote RBP1 expression. Similarly, the promoter activity of the AA genotype at the g.80409632A>G site was significantly higher than that of the GG genotype, suggesting that the AA genotype may promote RBP1 expression.

[0207] 7. Detection of RBP1 overexpression or knockdown efficiency

[0208] After transfection with 0.25 ng / μL of the empty vector and overexpression plasmid, qPCR and Western blotting showed increased RBP1 mRNA and protein expression levels, indicating good overexpression efficiency. Transfection with 100 nM siRNA showed decreased RBP1 mRNA and protein expression levels, indicating good knockdown efficiency. The concentrations of the overexpression plasmid and siRNA can be used for subsequent experiments. Figure 4 ).

[0209] 8. Effects of RBP1 on the transcriptome of porcine ovarian granulosa cells

[0210] After overexpression and knockdown of RBP1 in cells, RNA-seq analysis revealed that differentially expressed genes caused by changes in RBP1 expression levels were mainly involved in biological processes such as cell death and glutathione metabolism, indicating that RBP1 can regulate the ferroptosis pathway in porcine granulosa cells. Figure 5 ).

[0211] 9. Effects of RBP1 on ferroptosis in porcine ovarian granulosa cells

[0212] Overexpression of RBP1 downregulates intracellular Fe levels, inhibits lipid peroxide formation, and suppresses ferroptosis by upregulating GPX4 and FTH1 and downregulating p53 mRNA and protein expression. Knockdown of RBP1 upregulates intracellular Fe levels, promotes lipid peroxide formation, and promotes ferroptosis by downregulating GPX4 and FTH1 and upregulating p53 mRNA and protein expression. Figure 6 , Figure 7 , Figure 8 ).

[0213] Table 4. Statistical results of SNP locus genotyping

[0214]

[0215]

[0216] Table 5. Analysis of population genetic structure indicators

[0217]

[0218] Table 6. Effects of gene polymorphism sites on the age of sexual maturity in Duhei pigs.

[0219]

[0220]

[0221] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a reagent for detecting molecular genetic markers of sexual maturity in pigs, characterized in that: The molecular genetic marker described corresponds to the SNP site with the T>C mutation at locus g.80409547 on chromosome 13 of the pig reference genome Sscrofa11.1; The application includes at least one of the following: A. Application in assessing the age of puberty in pigs; B. Application in determining the onset of estrus in pigs; The pigs mentioned are a crossbreed of Duroc and country black pigs.

2. The application of the reagent for detecting molecular genetic markers of sexual maturity in pigs according to claim 1, characterized in that: In application A, the genotype at the g.80409547 locus was detected, and individuals with the CC genotype had a shorter age of puberty than those with the TC and TT genotypes.

3. The application of the reagent for detecting molecular genetic markers of sexual maturity in pigs according to claim 1, characterized in that: In application B, the genotype at the g. 80409547 locus was detected, and individuals with the CC genotype started puberty faster than those with the TC and TT genotypes.

4. An application of a primer, characterized in that: The primers include: F: 5′-ACACAGATCCCCTCTCTC-3′; R: 5′-GAAATTCTCGTTGGCCAGCATCT-3′; The primers described above are used to identify molecular genetic markers affecting sexual maturation in pigs; these molecular genetic markers correspond to the SNP site with a T>C mutation at locus g.80409547 on chromosome 13 of the pig reference genome Sscrofa11.

1. The application includes at least one of the following: A. Application in assessing the age of puberty in pigs; B. Application in determining the onset of estrus in pigs; The pigs mentioned are a crossbreed of Duroc and country black pigs.

Citation Information

Patent Citations

  • SNP (Single Nucleotide Polymorphism) molecular marker related to age of pig in early estrus and application of SNP molecular marker

    CN119020499A