Development of a rapid identification method for wild and domesticated populations of large yellow croaker based on four universal InDel loci

Abstract

The application belongs to the technical field of fish genetic identification, discloses a method for quickly identifying wild and domesticated populations of large yellow croaker based on four universal InDel sites, and specifically discloses a set of InDel molecular markers for identifying wild and domesticated populations of large yellow croaker, characterized in that the InDel molecular markers comprise InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774. The application provides a set of InDel molecular markers for identifying wild and domesticated populations of large yellow croaker, and the PCR product amplified by the InDel molecular marker detection primer can be detected for band polymorphism by using agarose gel, without additional restriction endonuclease digestion or complicated polyacrylamide gel electrophoresis operation, so that the identification of wild and domesticated populations of large yellow croaker can be quickly and accurately realized.

Description

Technical Field

[0001] This invention belongs to the field of fish genetic identification technology, specifically involving the construction of a rapid identification method for wild and domesticated large yellow croaker populations based on four universal InDel loci. Background Technology

[0002] Large yellow croaker (Larimichthys crocea) belongs to the order Perciformes, family Sciaenidae, and genus Larimichthys. It is one of the most important marine economic fish species in China. In recent years, due to the expansion of large yellow croaker farming and the increased exchange of fry between different geographical regions, the distribution of farmed populations has far exceeded that of wild populations. While release activities have improved the resource base of large yellow croaker, they have also led to problems such as mixed populations and low genetic diversity.

[0003] Resequencing is a bioinformatics method that involves obtaining the genome sequence information of an organism and comparing it with an existing genome to identify differences in sequence information. Genome resequencing can obtain a large number of single nucleotide polymorphism (SNP) sites, short in-deletion (SID) sites, structural variations (SV) sites, and copy number variations (CNV) sites. With the rise of next-generation sequencing platforms, their high-throughput and low-cost advantages have led to an increasing number of species being included in high-throughput sequencing. Detecting variations in individuals or populations of a species and constructing a genetic variation database for that species is of great significance for promoting germplasm resource preservation and gene bank management. Depending on the different needs for obtaining genomic genetic information, it can be divided into whole genome resequencing (WGS) and reduced-representation genome resequencing (RRGS). Whole genome resequencing refers to using high-throughput sequencing technology to completely sequence the genome of an organism and compare it with a reference genome. This technology can be used to analyze genetic differences between individuals, find disease-related genes or gene mutation sites, and reveal genome structure, among other things. With the continuous development of high-throughput sequencing technology, WGS technology has also been widely applied. Advances in sequencing technology have powerfully promoted the development of genomics, enabling the accurate sequencing and precise assembly of complex genome sequences. Whole-genome resequencing has gone through three stages with the development of sequencing technology: Sanger sequencing, NGS, and PacBio and Nanopore technologies. In recent years, whole-genome resequencing has been increasingly applied to various fish species, including carp (Cyprinus carpio), Atlantic salmon (Salmo salar), and goldfish (Carassius auratus). Currently, researchers can use whole-genome resequencing to analyze fish population structure and population history evolution, and to discover genetic differences between fish populations.

[0004] Accurately and rapidly identifying wild and domesticated large yellow croaker populations is crucial for the identification of large yellow croaker germplasm resources. In 2019, researchers assembled a large yellow croaker reference genome using third-generation PacBio single-molecule sequencing technology and high-throughput chromosome conformation capture technology. This highly accurate reference genome provides important genomic resources to support the identification and evaluation of large yellow croaker germplasm resources. Currently, the development of genetically specific molecular markers has been applied in large yellow croaker. In 2022, researchers developed sex-specific molecular markers for the large yellow croaker Daiqu population through the genome between dmrt1 and cfap157, providing a powerful tool for promoting sex-controlled breeding of the Daiqu population.

[0005] In 2023, based on genome resequencing and comparison of genetic marker data from large yellow croaker populations distributed in the coastal waters of eastern and southern China, climate-driven habitat change may have occurred between the *Large Yellow Croaker* populations of the Naozhou group and the *Large Yellow Croaker* populations of the Fujian and Guangdong groups. However, there is currently a lack of precise and rapid methods for identifying wild / domesticated large yellow croaker populations. Developing accurate and rapid methods for identifying wild / domesticated large yellow croaker populations using genetically specific markers can effectively promote research on the distribution of large yellow croaker populations in my country. InDel is a sequence insertion or deletion at a specific location in the genome and is a molecular genetic marker. Researchers use Fst scanning combined with InDel sites to screen for candidate genes associated with traits. Based on the InDel dataset obtained from whole-genome resequencing of large yellow croaker populations, agarose gel electrophoresis can be used to more visually demonstrate the genetic differences between different large yellow croaker populations, and this can be used as a genetic marker to construct a population identification system. Summary of the Invention

[0006] The first aspect of this invention aims to provide a set of InDel molecular markers for the identification of wild and domesticated populations of large yellow croaker.

[0007] A second aspect of the present invention aims to provide a primer set for amplifying the InDel molecular marker of the first aspect of the present invention.

[0008] A third aspect of the present invention is to provide a detection reagent, gene chip, or kit.

[0009] The fourth aspect of this invention aims to provide the application of the InDel molecular marker of the first aspect of this invention, the primer set of the second aspect of this invention, or the detection reagent, gene chip, or kit of the third aspect of this invention in the identification of wild and / or domesticated samples of large yellow croaker.

[0010] The fifth aspect of this invention aims to provide the application of the InDel molecular marker of the first aspect of this invention, the primer set of the second aspect of this invention, or the detection reagent, gene chip, or kit of the third aspect of this invention in the assisted breeding or identification of germplasm resources of large yellow croaker.

[0011] The sixth aspect of this invention aims to provide a method for identifying wild and / or domesticated populations of large yellow croaker.

[0012] The seventh aspect of this invention aims to provide the application of the method for identifying wild and / or domesticated samples of large yellow croaker, as described in the sixth aspect of this invention, in the identification and evaluation of large yellow croaker germplasm resources.

[0013] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0014] In a first aspect, the present invention provides a set of InDel molecular markers for the identification of wild and domesticated populations of large yellow croaker, the InDel molecular markers including InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774;

[0015] Among them, InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:1;

[0016] The InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:2;

[0017] The InDel1-35741636 is located at position 35741636 of chromosome 1 NC_040011.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:3;

[0018] The InDel3-21732774 is located at position 21732774 on chromosome 3 of the large yellow croaker, NC_040013.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:4.

[0019] In some embodiments of the present invention, the above four InDel molecular markers are obtained by the following steps:

[0020] S1. After whole-genome sequencing of 395 wild-domesticated large yellow croaker samples, population genetic selection signal analysis was used to screen for InDel loci with differences in wild-domesticated large yellow croaker.

[0021] S2. Based on the InDel dataset, allele frequencies were calculated and chi-square tests were performed to screen candidate genes with extremely significant differences in allele frequencies between wild and farmed large yellow croaker populations (P<0.001). Four large fragments (bp>40) of InDel were selected as candidate specific genetic difference sites and InDel amplification verification was performed based on agarose gel electrophoresis.

[0022] Based on the above screening, the four InDels are located on three different chromosomes of the large yellow croaker (chromosome 1 (NC_040011.1), chromosome 3 (NC_040013.1), and chromosome 21 (NC_040031.1)), with the following location information: InDel21-17662246, InDel1-35741636, InDel21-13979637, and InDel3-21732774. A set of agarose gel electrophoresis primers for the identification of wild-caught large yellow croaker samples was designed.

[0023] S3. Use the PCR reaction system to perform amplification experiments to verify whether the four labeling reaction systems can identify wild-domesticated large yellow croaker samples.

[0024] S4. The accuracy and detection rate of the agarose gel electrophoresis results were compared with those of known label detection to prove that the reaction system can identify wild-caught large yellow croaker samples.

[0025] A second aspect of the invention provides a primer set for amplifying a large yellow croaker genomic DNA fragment containing the InDel molecular marker of the first aspect of the invention.

[0026] In some embodiments of the present invention, the nucleotide sequences of the primer set are shown in SEQ ID NO:5 to SEQ ID NO:13.

[0027] A third aspect of the present invention provides a detection reagent, gene chip, or kit comprising the primer set of the second aspect of the present invention.

[0028] In some embodiments of the present invention, the kit further comprises one or more of dNTPs, polymerases (DNA polymerase and exonuclease), PCR reaction buffer, Taq, PCR stabilizer and enhancer.

[0029] A fourth aspect of the present invention provides the application of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention, or the detection reagent, gene chip, or kit of the third aspect of the present invention in the identification of wild and / or domesticated samples of large yellow croaker.

[0030] A fifth aspect of the present invention provides the application of the InDel molecular marker of the first aspect of the present invention, the primer set of the second aspect of the present invention, or the detection reagent, gene chip, or kit of the third aspect of the present invention in the assisted breeding or identification of germplasm resources of large yellow croaker.

[0031] A sixth aspect of the present invention provides a method for identifying wild and / or domesticated populations of large yellow croaker, comprising the step of detecting the InDel molecular marker of the first aspect of the present invention in a sample of large yellow croaker to be tested using the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention.

[0032] In some embodiments of the present invention, the identification method includes the following steps:

[0033] (1) Using the DNA of the large yellow croaker sample to be tested as a template, PCR amplification is performed using the primer set of the second aspect of the present invention or the detection reagent, gene chip or kit of the third aspect of the present invention to obtain PCR amplification products.

[0034] (2) Perform gel electrophoresis on the PCR amplification products and obtain the genotype of the InDel molecular marker of the first aspect of the present invention in the genome of the large yellow croaker to be tested based on the amplified fragments.

[0035] (3) Analyze the frequency of the InDel molecular marker genotypes, score them, construct ROC curves, and determine whether the large yellow croaker population to be tested is wild or domesticated.

[0036] In some embodiments of the present invention, the genotypes in step (2) are as follows:

[0037] The genotypes of InDel21-17662246 are as follows: a single band of 316bp indicates the I / I genotype, two bands of 316bp and 263bp indicate the I / D genotype, and a single band of 263bp indicates the D / D genotype.

[0038] The genotypes of InDel21-13979637 are as follows: a single band of 193bp indicates the I / I genotype, two bands of 193bp and 138bp indicate the I / D genotype, and a single band of 138bp indicates the D / D genotype.

[0039] The genotypes of InDel1-35741636 are as follows: a single band of 385bp indicates the I / I genotype, two bands of 385bp and 332bp indicate the I / D genotype, and a single band of 332bp indicates the D / D genotype.

[0040] The genotypes of InDel3-21732774 are as follows: a single band at 263bp indicates the I / I genotype; two bands at 263bp and 213bp indicate the I / D genotype; and a single band at 213bp indicates the D / D genotype.

[0041] In some embodiments of the present invention, the scoring rules in step (3) are as follows:

[0042] If the frequency of the I / I genotype of InDel21-17662246, InDel21-13979637, InDel1-35741636, or InDel3-21732774 is greater than that of the D / D genotype, then 1 point is awarded; otherwise, 0 points are awarded.

[0043] In some embodiments of the present invention, the cut-off value of the ROC curve (i.e., the maximum value of ROC curve sensitivity (sensitivity%) + specificity (specificity%)) is set as the discrimination threshold. When the total score of the large yellow croaker population to be tested is higher than the threshold, it is a wild large yellow croaker population; otherwise, it is a domesticated large yellow croaker population.

[0044] In some embodiments of the present invention, the PCR amplification in step (1) is multiplex PCR amplification.

[0045] In some embodiments of the present invention, the PCR amplification reaction program is as follows: pre-denaturation at 92-96°C for 3-6 min; denaturation at 92-96°C for 28-35 s, annealing at 58-60°C for 30-40 s, extension at 70-72°C for 40-50 s, 32-37 cycles; extension at 70-72°C for 3-6 min.

[0046] This invention utilizes a method based on four effective InDel sites, enabling rapid and simple identification of wild-caught and domesticated large yellow croaker samples with only two PCR reaction systems and instant agarose gel electrophoresis. This method employs simple reagents and analytical instruments, allowing for rapid and accurate identification of both wild and domesticated large yellow croaker samples. Compared to current methods for identifying large yellow croaker populations, this method is faster, has lower detection requirements, and offers high accuracy and extremely high detection efficiency.

[0047] The seventh aspect of the present invention provides the application of the method for identifying wild and / or domesticated samples of large yellow croaker, as described in the sixth aspect of the present invention, in the identification and evaluation of large yellow croaker germplasm resources.

[0048] The beneficial effects of this invention are:

[0049] This invention provides a set of InDel molecular markers for wild and domesticated populations of large yellow croaker. PCR products amplified using the InDel molecular markers of this invention can be detected using agarose gel electrophoresis to identify band polymorphisms, eliminating the need for additional restriction endonuclease digestion or complex polyacrylamide gel electrophoresis. This allows for rapid and accurate identification of wild and domesticated large yellow croaker populations. The InDel molecular markers are co-dominant markers, offering advantages such as stable amplification, high accuracy, convenient detection, and speed.

[0050] The identification method provided by this invention is a multi-site identification system for wild and domesticated large yellow croaker samples based on agarose gel electrophoresis. It was developed using multiple DNA fragment insertion / deletion (InDel) sites identified through whole genome resequencing and population genetic selection signal analysis of large yellow croaker. The method is designed and tested based on PCR amplification and agarose gel electrophoresis. The system integrates four candidate InDel markers into two PCR reactions, specifically amplifying and typing the four sites to determine their accuracy in both groups of samples. Agarose gel electrophoresis validation on 240 large yellow croaker samples with known genotypes demonstrates that the four InDel markers can successfully identify the wild / domestic classification of large yellow croaker in the vast majority of samples. Compared to current identification methods and markers, this method significantly improves the efficiency of identifying wild and domesticated large yellow croaker populations. It allows for rapid and accurate genotyping using simple instruments and equipment, facilitating convenient and efficient genotyping identification of large yellow croaker populations. It features high efficiency and applicability, such as simple operation, low cost and short time consumption, providing an efficient identification method for wild and domesticated large yellow croaker populations and providing favorable genetic resources for large yellow croaker breeding. Attached Figure Description

[0051] Figure 1 The image shows partial agarose gel electrophoresis images of the amplification at two sites (D1 and D2). D1: 316 / 263 bp, with one 316 bp band for the I / I genotype, two 316 bp / 263 bp bands for the I / D genotype, and one 263 bp band for the D / D genotype; D2: 193 / 138 bp, with one 193 bp band for the I / I genotype, two 193 bp / 138 bp bands for the I / D genotype, and one 138 bp band for the D / D genotype. In the image, C, B, and Y represent known domesticated large yellow croaker samples, X represents known wild large yellow croaker samples, and M represents the maker.

[0052] Figure 2 ROC curves for a rapid identification method of wild and domesticated large yellow croaker populations based on four universal InDel loci.

[0053] Figure 3 This is an agarose gel electrophoresis image of 30 large yellow croaker samples used in Example 4 for verification. Detailed Implementation

[0054] The present invention will be further described in detail below through specific embodiments.

[0055] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0056] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0057] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0058] Example 1

[0059] Four universal InDel loci are used to enable rapid identification of wild and domesticated populations of large yellow croaker. These InDel loci are located on three different chromosomes of large yellow croaker (chromosome 1 (NC_040011.1), chromosome 3 (NC_040013.1), and chromosome 21 (NC_040031.1)), with the following location information: InDel21-17662246 (denoted as D1), InDel21-13979637 (denoted as D2), InDel1-35741636 (denoted as D3), and InDel3-21732774 (denoted as D4).

[0060] The above four indels were obtained through whole-genome resequencing and population genetic selection signal analysis, using the following methods:

[0061] A total of 576.43 G of raw whole-genome resequencing data was generated from 395 large yellow croaker individuals, with an average of 13405.42 M of raw data per sample. Based on this, a total of 574.60 G of filtered data was generated, with an average of 13362.97 M of data per sample. 99.48% of reads were located to the large yellow croaker reference genome. Allele frequencies were calculated and chi-square tests were performed on the InDel dataset (P < 0.05). Four InDel loci with the highest allele frequencies between wild and domesticated large yellow croaker populations and passing the chi-square test were selected as candidate specific genetic difference loci. InDel amplification validation was then performed using agarose gel electrophoresis.

[0062] The specific genotypes of the four InDel types are shown in Table 1.

[0063] Table 1. Specific genotypes of the four InDel types

[0064]

[0065] For InDel, In represents a large fragment insertion, and Del represents a large fragment deletion. The mutation information for each large fragment at each point is as follows:

[0066] D1: GTTACATAACAACATGACATGAAGTATTTATAGTGATCATTTTAAACAGTTGT→G, that is, there is a deletion or insertion of GTTACATAACAACATGACATGAAGTATTTATAGTGATCATTTTAAACAGTTGT (SEQ ID NO:1) at position 17662246 on chromosome 21 (NC_040031.1);

[0067] D2: TTTTCTTACCTCCTTTTGTCTTTTTTTTATTATTATTTTAGTCAAAAAGGACAAA→T, meaning there is a deletion or insertion of TTTTCTTACCTCCTTTTGTCTTTTTTTTATTATTATTTTAGTCAAAAAGGACAAA (SEQ ID NO:2) at position 13979637 on chromosome 21 (NC_040031.1);

[0068] D3: AGCTTGCAGGCCATCCTGCTTTTTTATGGCAACAATATCCAACGCGAAAAAAT→A, meaning there is a deletion or insertion of AGCTTGCAGGCCATCCTGCTTTTTTATGGCAACAATATCCAACGCGAAAAAAT (SEQ ID NO:3) at position 35741636 on chromosome 1 (NC_040011.1);

[0069] D4: ACATGTGTAACCGCACGAGGAAAAGTCACCAATTCAGGCATGTGTGGCCT→A, meaning there is a deletion or insertion of ACATGTGTAACCGCACGAGGAAAAGTCACCAATTCAGGCATGTGTGGCCT (SEQ ID NO:4) at position 21732774 on chromosome 3 (NC_040013.1).

[0070] For each of the four InDels mentioned above, corresponding amplification primer sequences were designed, and the primer sequences are shown in Table 2.

[0071] Table 2. Amplification primer sequences corresponding to the four InDels

[0072]

[0073] Note: D2-R*: Matches the deletion mutation sequence in the D2 primer region and must be added to the amplification system together with D2-R. The primer regions at the other three sites do not have deletion mutation sequences. K is a degenerate base of G / T.

[0074] Example 2

[0075] A rapid identification method for wild and domesticated populations of large yellow croaker based on four universal InDel loci includes the following steps:

[0076] S1: Genomic DNA was extracted from the fin tissue of the large yellow croaker population using the phenol-chloroform extraction method;

[0077] S2: Construct PCR reaction system for typing experiment. Divide the 4 InDel into two reaction systems (D1 and D2 in one reaction system, and D3 and D4 in one reaction system). The PCR reaction system is shown in Table 3, and the reaction procedure is shown in Table 4.

[0078] Table 3 PCR reaction system

[0079]

[0080] In Table 3, primer 1mix and primer 2mix refer to the upstream and downstream primers of D1 and D2, respectively; or the upstream and downstream primers of D3 and D4.

[0081] Table 4 PCR reaction procedures

[0082]

[0083] S3: Detection using agarose gel electrophoresis

[0084] 1) Prepare a 3% agarose gel;

[0085] 2) Add 3 μL of product or DNA marker to the gel wells; electrophoresis at 100V for 30 min;

[0086] 3) Electrophoresis patterns were captured using a gel imaging system.

[0087] S4: Data Analysis

[0088] The electrophoresis patterns were compiled into an Excel spreadsheet, where "I" represents insertion and "D" represents deletion. Genotypes showing only the upper band (i.e., 316bp, 193bp, 385bp, and 263bp respectively in D1–D4) were homozygous for insertion and marked as "I / I" genotype; genotypes showing two bands were heterozygous and marked as "I / D" genotype; and genotypes showing only the lower band (263bp, 138bp, 332bp, and 213bp) were homozygous for deletion and marked as "D / D" genotype.

[0089] That is, D1: 316 / 263bp, I / I genotype has one band of 316bp, I / D genotype has two bands of 316bp / 263bp, and D / D genotype has one band of 263bp; D2: 193 / 138bp, I / I genotype has one band of 193bp, I / D genotype has two bands of 193bp / 138bp, and D / D genotype has one band of 138bp; D3: 385 / 332bp, I / I genotype has one band of 385bp, I / D genotype has two bands of 385bp / 332bp, and D / D genotype has one band of 332bp; D4: 263 / 213bp, I / I genotype has one band of 263bp, I / D genotype has two bands of 263bp / 213bp, and D / D genotype has one band of 213bp.

[0090] S5: Combining the agarose gel electrophoresis verification results, the significant differences in allele frequencies at the above four loci between wild and domesticated large yellow croaker populations were analyzed (P<0.05). Since a single InDel locus is insufficient for effective genotyping of the large yellow croaker population, the verification results of all four InDel loci need to be combined for identification. Based on this, alleles with higher frequencies in the wild large yellow croaker population than in the domesticated population are scored as 1 point, and alleles with lower frequencies in the wild large yellow croaker population than in the domesticated population are scored as 0 points. A method for identifying wild / domesticated large yellow croaker samples based on the above four loci is constructed. Generally, if the method is constructed based on x loci (x≤10), the total score of the identification method is 2x (number of alleles * 2). Scoring is performed on all verification samples, and total score datasets for the wild and domesticated populations are constructed based on the scoring results. The datasets are then input into GraphPadPrism 8 to construct receiver operating characteristic (ROC) curves. The method is considered feasible if the area under the ROC curve (AUC) is greater than 0.9. The cut-off value is set as the discrimination threshold (the cut-off value is the maximum value of the sensitivity (sensitivity%) + specificity (specificity%) of the ROC curve). Samples with scores higher than the threshold are wild samples of large yellow croaker, and samples with scores lower than the threshold are domesticated samples of large yellow croaker.

[0091] Example 3

[0092] The rapid identification method of Example 2 was used to distinguish between known wild and domesticated large yellow croaker populations, with 120 wild and 120 domesticated large yellow croakers.

[0093] Electrophoresis images of PCR reaction products from some large yellow croaker samples are shown below. Figure 1 As shown. The detection results based on the identification method constructed using four InDels are as follows. Figure 2As shown, the area under the ROC curve (AUC) constructed by combining four InDels is 0.9608. The sensitivity of the optimal threshold is 90.8% (i.e., the probability of identifying a wild large yellow croaker using this method is 90.8%), and the specificity is 89.2% (i.e., the probability of excluding a domesticated large yellow croaker using this method is 89.2%). An AUC area greater than 0.9 indicates that the method is feasible. The threshold for the total score of the discrimination method constructed based on the above four InDels is 4 points. Based on this, samples with a score greater than 4 points are identified as wild large yellow croaker samples, and samples with a score less than or equal to 4 points are identified as domesticated large yellow croaker samples. Based on actual testing conditions, the large yellow croaker population can be genotyped by visually observing whether there are more than 4 In fragments in the 4 InDel segments of the agarose gel electrophoresis results (more than 4 In fragments indicate wild large yellow croaker samples, less than or equal to 4 In fragments indicate domesticated large yellow croaker samples; within the same locus, the larger band indicates the In fragment, and the smaller band indicates the Del fragment; the genotype with only a large band is counted as In / In, the genotype with only a small band is counted as Del / Del, and the genotype with one large band and one small band is counted as In / Del).

[0094] In summary, the identification method based on four InDels has a high discrimination rate and extremely fast discrimination efficiency, and can be applied to the rapid identification of wild large yellow croaker and domesticated large yellow croaker.

[0095] Example 4

[0096] To further verify the general applicability of the rapid identification method for wild and domesticated large yellow croaker populations based on four universal InDel loci in Example 2, an additional 30 known wild / domesticated large yellow croaker samples were collected for a second round of screening. The results of agarose gel electrophoresis of the 30 samples were then analyzed. Figure 3 The results showed that in a wild population of large yellow croaker (population size: 15 individuals), there were 15 wild large yellow croaker samples and 0 domesticated large yellow croaker samples; in a domesticated population of large yellow croaker (population size: 15 individuals), there were 12 domesticated large yellow croaker samples and 3 wild large yellow croaker samples. This indicates that the rapid identification method for wild and domesticated large yellow croaker populations based on four universal InDel loci described in Example 2 is universally applicable to indicating wild / domesticated large yellow croaker samples and has a high genotyping accuracy.

[0097] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. The application of a set of InDel molecular markers in the identification of wild and / or domesticated populations of large yellow croaker, characterized in that, The InDel molecular markers include InDel21-17662246, InDel21-13979637, InDel1-35741636 and InDel3-21732774; Among them, InDel21-17662246 is located at position 17662246 of chromosome 21 NC_040031.1 of large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:1; The InDel21-13979637 is located at position InDel21-13979637 of chromosome 21 NC_040031.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:2; The InDel1-35741636 is located at position 35741636 of chromosome 1 NC_040011.1 of the large yellow croaker, and there is an insertion / deletion of the sequence fragment as shown in SEQ ID NO:3; The InDel3-21732774 is located at position 21732774 on chromosome 3 of the large yellow croaker, NC_040013.1, and contains an insertion / deletion of the sequence fragment shown in SEQ ID NO:

4.

2. A primer set for amplifying a large yellow croaker genomic DNA fragment containing the InDel molecular marker as described in claim 1, wherein the nucleotide sequence of the primer set is shown in SEQ ID NO:5 to SEQ ID NO:

13.

3. A detection reagent comprising the primer set as described in claim 2.

4. A kit comprising the primer set of claim 2.

5. The application of the primer set of claim 2, the detection reagent of claim 3, or the kit of claim 4 in the identification of wild and / or domesticated populations of large yellow croaker.

6. A method for identifying wild and / or domesticated populations of large yellow croaker, comprising the step of detecting the InDel molecular marker of claim 1 in a large yellow croaker sample using the primer set of claim 2, the detection reagent of claim 3, or the kit of claim 4.

Images