A gender-specific molecular marker of hypophthalmichthys nobilis and primer and application thereof

By designing sex-specific molecular markers and primers for silver carp and utilizing PCR amplification technology, the problems of accuracy and speed in silver carp sex identification have been solved, achieving efficient sex identification applicable to silver carp of different sizes and varieties, and meeting the needs of aquaculture and resource management.

CN121006398BActive Publication Date: 2026-03-31YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2026-03-31

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately, quickly, and harmlessly identify the sex of silver carp at various developmental stages. Traditional methods are prone to misjudgment and are complex to operate, failing to meet the needs of aquaculture and resource management.

Method used

A sex-specific molecular marker and its primers for silver carp were designed. Using PCR amplification technology, the genomic DNA of silver carp was identified by nucleotide sequence-specific primers, and a male-specific 412bp band was amplified to distinguish the sex.

Benefits of technology

It enables accurate and rapid sex identification of silver carp with an accuracy rate of 100%. It is applicable to silver carp of different sizes and varieties, avoiding the misjudgment of traditional methods. It is suitable for the identification of silver carp germplasm resources, population genetic structure analysis and breeding management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121006398B_ABST
    Figure CN121006398B_ABST
Patent Text Reader

Abstract

The present application relates to the field of biotechnology, and more particularly to a mylopharyngodon piceus gender-specific molecular marker, primer and application thereof, wherein the primer designed for the molecular marker is used for PCR amplification, and the genetic sex of the mylopharyngodon piceus can be accurately and rapidly identified. The molecular marker presents stable difference between male and female individuals, and the identification accuracy is 100%. In addition, the molecular marker can be stably applied to mylopharyngodon piceus of different specifications and different breeding strains, and shows good universality and reliability. The present application provides important technical support for the unisexual breeding, germplasm resource management and population structure monitoring of mylopharyngodon piceus, and has wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and more particularly to a silver carp sex-specific molecular marker, its primers, and its applications. Background Technology

[0002] Silver carp (Hypophthalmichthys molitrix), also known as white carp, is one of my country's "four major freshwater fish" and one of the world's most productive filter-feeding fish in freshwater fisheries, with an annual production exceeding 3 million tons, playing a vital role in my country's aquaculture industry. Studies have shown that female silver carp typically grow faster than males after reaching sexual maturity. Therefore, accurate sex identification and population sex ratio control are of significant industrial importance for improving aquaculture efficiency and economic benefits, as well as for conducting single-sex breeding. Furthermore, silver carp are an important species for stock enhancement in rivers and lakes, and their sex ratio directly affects the effectiveness of stock enhancement, population genetic diversity, and even the stability of aquatic ecosystems. Therefore, developing efficient sex identification techniques is also a key requirement for the scientific management and resource protection of wild silver carp populations.

[0003] However, genetic sex determination in silver carp has long relied on anatomical or laparoscopic examinations. This requires surgical or anatomical observation of gonadal tissue for accurate sex determination, which is not only cumbersome and demands high skill levels from the operator, but also causes irreversible damage to the fish, even leading to death. This approach is completely unsuitable for applications involving rare parent fish, conserved populations, or scenarios requiring live animal studies. Furthermore, morphological methods relying on external secondary sexual characteristics have limited applicability and poor accuracy. While research has found that the presence of "rough ridges" on the dorsal side of the pectoral fin in male silver carp can identify sex, this method has a high accuracy rate for individuals within a specific length range (300mm-800mm). However, for juveniles or immature individuals less than 300mm in length, and for large individuals greater than 800mm, the accuracy rate drops significantly (as low as 53.7%). This is mainly because silver carp have a long sexual maturity cycle of 3-4 years, and there are almost no visible morphological differences between males and females during the juvenile and child stages. Additionally, silver carp lack heteromorphic sex chromosomes, making sex determination extremely difficult.

[0004] Therefore, the aquaculture and fishery resource management sectors urgently need a sex identification method that is applicable to silver carp at all developmental stages and of different sizes, and that is accurate, rapid, and harmless to the fish, in order to overcome the technical bottlenecks in silver carp parthenogenesis and wild population sex ratio monitoring. Summary of the Invention

[0005] In view of this, the present invention proposes a silver carp sex-specific molecular marker, its primers, and its applications.

[0006] The technical solution of this invention is implemented as follows:

[0007] In a first aspect, the present invention provides a silver carp sex-specific molecular marker, the molecular marker being located in the male genome, and the nucleotide sequence of the molecular marker being shown in SEQ ID NO:1.

[0008] Secondly, the present invention provides the application of the silver carp sex-specific molecular marker in the genetic sex identification of silver carp.

[0009] Thirdly, the present invention provides a primer for identifying the genetic sex of silver carp, comprising an upstream primer with a nucleotide sequence as shown in SEQ ID NO:2, and a downstream primer with a nucleotide sequence as shown in SEQ ID NO:3.

[0010] Fourthly, the present invention provides a reagent or kit containing the primers for identifying the genetic sex of silver carp. Further, the reagent or kit also contains PCR Master Mix and ddH2O.

[0011] Fifthly, the present invention provides a method for identifying the genetic sex of silver carp, comprising the following steps:

[0012] (1) Extract the genomic DNA of the silver carp to be tested as a template, and perform PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO:2-3;

[0013] (2) Detect the PCR amplification product. When the amplification product shows a 412bp band, the silver carp to be tested is male; when the amplification product does not show a 412bp band, the silver carp to be tested is female.

[0014] Further, in step (1), the total volume of the PCR amplification reaction system is 50 μL, including 25 μL of 2×PCRMaster Mix, 1.5 μL each of upstream and downstream primers, 2 μL of DNA template and 20 μL of ddH2O.

[0015] Further, in step (1), the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 58℃ annealing for 30 s, 72℃ extension for 45 s, 34 cycles; 72℃ extension for 10 min; cooling to 4℃.

[0016] Furthermore, in step (2), the PCR amplification products are detected by agarose gel electrophoresis with a mass percentage of 1.2%.

[0017] Furthermore, in step (2), if the amplified specific band is one, the silver carp to be tested is female; if the specific band is two, the silver carp to be tested is male.

[0018] The beneficial effects of the present invention include at least the following:

[0019] The silver carp sex-specific molecular marker provided by this invention was obtained through high-throughput sequencing and comparative genomics analysis, revealing inherent and stable differences between male and female silver carp. PCR amplification using primers designed for this molecular marker enables accurate and rapid identification of the genetic sex of silver carp, achieving an accuracy rate of up to 100%. This effectively avoids misjudgments that may occur due to individual developmental stage or environmental factors associated with traditional morphological observation or anatomical methods. This molecular marker can be stably applied in different sizes and varieties of silver carp (such as Xiangjiang silver carp, Yangtze River silver carp, Changfeng silver carp, and the new silver carp strain Changfeng Silver Carp No. 2), demonstrating good universality. This lays a solid foundation for its large-scale application in the identification of germplasm resources, analysis of population genetic structure, breeding, and artificial propagation of silver carp. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 The results are based on BLAST alignment of the silver carp Hm00006 gene from the Dryad database with the male T2T reference genome constructed in this application, using TBtools software.

[0022] Figure 2 The electrophoretic detection results of sex identification of Xiangjiang silver carp using the molecular markers provided by this invention are shown. Lanes 1-12 are female samples, and lanes 13-24 are male samples. The results show that the specific band (412bp) was amplified in all male samples, while no such band was found in any female samples.

[0023] Figure 3 The results of electrophoretic detection for sex identification of different silver carp populations using the molecular markers provided by this invention are shown. Lanes 1-12 are all female samples, and lanes 13-24 are all male samples. The results show that the specific band (412bp) was amplified in male samples from different silver carp populations, while no such band was found in female samples. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall be followed. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased commercially.

[0025] Table 1 Sequence Information Table

[0026] name SEQ ID NO Sequence (5'-3') Length (bp) Molecular markers 1 AATCCGAGCAGGTTTGAGCGATCTCTCTGTCTCCTATACTGTTATCCTTTCAGCCAGAGCAACAGAGGTCATAAGAGAAAAACAGTTATGAGTTATGAGTTATACCGGAGTGTCTGAGTGTGACAGATATACGGATGCATTAGTCCGATATTAACAAAGGCACAGGGAAGAGACTGATAAAACATTTAACCAAATAAATACACAA TTATAATCATATATGGTCTTGCTTACAGCTCCGTGCTTTGCTCTATTGCTTTCATATTTAATCTCCTAATTTTAACTACAGCAAATCAGCACAGTGTTCAAATGACAAATCTTGGCACCAACAAACTTTTTAACTGGAAGTTTACTAGAAAAAAGGGGAATTTTTATCTGACCAGCCTCCCACTGACAGCAGCCATCAGCTTACAT 412 upstream primer 2 AATCCGAGCAGGTTTGAGCG 20 Downstream primer 3 ATGTAAGCTGATGGCTGCTGT 21

[0027] Example 1: Development of molecular markers for identifying the sex of silver carp

[0028] 1. Molecular marker development

[0029] Three-year-old sexually mature Xiangjiang silver carp were collected and bred at the Shishou Laohe Yangtze River "Four Major Domesticated Fish" Breeding Farm (national level) in Hubei Province. Sexing was determined by gonadal tissue sections. From these fish, 30 males and 30 females were randomly selected (average weight: female 3078.47g, male 2690.50g), and fin rays were harvested to extract genomic DNA. A second-generation resequencing library was constructed from the extracted genomic DNA of 60 silver carp, and sequencing was performed using the BGI DNBSEQ-T7 platform at a sequencing depth of 30× to obtain whole-genome resequencing data for these individuals. Subsequently, all sequencing data were aligned to an established male T2T reference genome using BWA software. The sequencing of this reference genome was commissioned to Wuhan Huaming Biotechnology Co., Ltd. The published silver carp reference genome was downloaded from the Dryad database (https: / / doi.org / 10.5061 / dryad.4qrfj6qgm). Based on the genome annotation file information, the gene with ID Hm00006 on chromosome 1 was selected, and its DNA sequence was extracted and compared with the male T2T reference genome constructed in this application using BLAST. The results are as follows: Figure 1 As shown, the target gene sequence exhibits 99.88% similarity to the region 33073809-33075426 on chromosome 14 of this T2T reference genome, with an E value significantly lower than 1e-10. Furthermore, the aligned region highly matches the characteristics of the silver carp genome. This result indicates that the gene sequence is highly conserved, providing strong molecular evidence to confirm that the genome belongs to the silver carp. (Discrepancies in chromosome numbering between the target and reference genomes generally stem from differences in chromosome numbering between different genome assembly versions; further verification through collinearity analysis is possible.)

[0030] The coverage depth of each 1000bp non-overlapping sliding window sequence was calculated using SAMtools and Deeptools software. Based on the difference in coverage depth between sequencing fragments from male and female individuals, a region with high coverage depth in males and extremely low coverage depth in females was selected as a male-specific region. Primers were designed based on the DNA fragment in this region for amplification, ultimately obtaining a 412bp male-specific fragment of silver carp, as shown in SEQ ID NO:1, which can serve as a molecular marker for identifying the sex of silver carp.

[0031] AATCCGAGCAGGTTTGAGCGATCTCTCTGTCTCCTATACTGTTATCCTTTCAGCCAGAGCAACAGAGGTCATAAGAGAAAAACAGTTATGAGTTATGAGTTATACCGGAGTGTCTGAGTGTGACAGATATACGGATGCATTAGTCCGATATTAACAAAGGCACAGGGAAGAGACTGATAAAACATTTAACCAAATAAATACACAA TTATAATCATATATGGTCTTGCTTACAGCTCCGTGCTTTGCTCTATTGCTTTCATATTTAATCTCCTAATTTTAACTACAGCAAATCAGCACAGTGTTCAAATGACAAATCTTGGCACCAACAAACTTTTTAACTGGAAGTTTACTAGAAAAAAGGGGAATTTTTATCTGACCAGCCTCCCACTGACAGCAGCCATCAGCTTACAT (SEQ ID NO:1)

[0032] 2. Primer design

[0033] Primers designed based on molecular markers for identifying the sex of silver carp, as shown in SEQ ID NO:1, are as follows:

[0034] Upstream primer: AATCCGAGCAGGTTTGAGCG (SEQ ID NO:2)

[0035] Downstream primer: ATGTAAGCTGATGGCTGCTGT (SEQ ID NO:3)

[0036] 3. Identification methods

[0037] (1) Extraction of genomic DNA:

[0038] Genomic DNA was extracted from fin tissue using the Tiangen Animal Genomic DNA Extraction Kit (catalog number DP341-01). The integrity of the extracted DNA was then checked by 1% agarose gel electrophoresis, and its concentration was determined by UV spectrophotometer. Samples with poor extraction quality were extracted repeatedly until the DNA quality was acceptable.

[0039] (2) PCR amplification:

[0040] Using the extracted genomic DNA as a template, PCR amplification was performed using primers with nucleotide sequences as shown in SEQ ID NO:2-3.

[0041] The PCR reaction system was: 2×Hieff ® PCR Master Mix (With Dye), 25 μL; forward and reverse primers, 1.5 μL each; DNA template, 2 μL; ddH2O, 20 μL.

[0042] The PCR amplification program was as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s; 58℃ annealing for 30 s; 72℃ extension for 45 s, 34 cycles; 72℃ extension for 10 min; cooling to 4℃.

[0043] The PCR amplification products were detected by agarose gel electrophoresis with a mass percentage of 1.2%, and the sex of the silver carp to be tested was determined based on the electrophoretic bands.

[0044] (3) Result determination

[0045] If the amplification product contains two bands with lengths of 412bp and 100bp respectively, the genetic sex of the individual being tested is male; if the amplification product contains only one band with a length of 100bp, the genetic sex of the individual being tested is female.

[0046] Example 2: Application of molecular markers for identifying the sex of silver carp

[0047] 1. Application of this molecular marker in identifying the sex of Xiangjiang silver carp

[0048] Using 3-year-old Xiangjiang silver carp that were not selected in Example 1 as subjects, the sex was determined by dissecting and observing the gonads. Twelve male and 12 female fish were randomly selected (average weight: female 3070.5g, male 2829.75g). Genomic DNA was extracted, PCR amplification was performed, and the results were determined according to the identification method in Example 1.

[0049] Agarose gel electrophoresis results are as follows Figure 2As shown, all 12 males tested amplified two bands, 412bp and 100bp, while all 12 females amplified only one 100bp band, consistent with the results of gonadal phenotype identification, indicating that the molecular markers provided by this invention can be used to identify the sex of Xiangjiang silver carp.

[0050] 2. Application of this molecular marker in identifying the sex of Yangtze silver carp, Changfeng silver carp, and the new silver carp strain "Changfeng Silver Carp No. 2".

[0051] (1) Yangtze River silver carp were collected from the State-owned Bailuhu Farm Aquatic Seed Breeding Center in Hubei Province. The sex was determined by dissecting and observing the gonads. Twelve male and female fish were randomly selected (average weight: female 14.75g, male 15.64g). Genomic DNA was extracted, PCR amplification was performed, and the results were determined according to the identification method in Example 1.

[0052] (2) Collect Changfeng silver carp from the Hubei Provincial State-owned Bailuhu Farm Aquatic Seed Breeding Center, dissect and observe the gonads to determine the sex, and randomly select 12 male and 12 female fish (average weight: female 2.28g, male 2.04g) to extract genomic DNA, perform PCR amplification and determine the results according to the identification method in Example 1.

[0053] (3) The new silver carp strain “Changfeng Silver Carp No. 2” was collected from the Aquatic Breeding Center of Bailuhu State-owned Farm in Hubei Province. “Changfeng Silver Carp No. 2” is a new silver carp strain with rapid growth and low oxygen tolerance developed in recent years by the Yangtze River Fisheries Research Institute of the Chinese Academy of Fishery Sciences. The Aquatic Breeding Center of Bailuhu State-owned Farm in Hubei Province is one of the important seedling breeding bases of the institute. The sex of “Changfeng Silver Carp No. 2” was determined by dissecting and observing the gonads. Twelve male and 12 female fish were randomly selected (average weight: female 1.22g, male 1.07g). Genomic DNA was extracted, PCR amplification was performed, and the results were determined according to the identification method in Example 1.

[0054] Electrophoresis results of DNA amplification products from three silver carp populations are as follows: Figure 3 As shown in the electrophoresis results, in the three silver carp populations tested, male individuals amplified two bands (412 bp and 100 bp), while female individuals amplified only one 100 bp band. This demonstrates that, in addition to the Xiangjiang silver carp population used for marker development, the molecular markers of this invention can also be used for genetic sex identification in Yangtze River silver carp, Changfeng silver carp, and the new silver carp strain "Changfeng Silver Carp No. 2." This indicates that the molecular markers of this invention can be used for genetic sex identification of silver carp of different sizes and varieties.

[0055] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A Hypophthalmichthys molitrix gender-specific molecular marker, characterized in that, The molecular marker is located in the male genome, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO:

1.

2. A primer for identifying the genetic sex of Hypophthalmichthys molitrix, characterized in that, The upstream primer comprises a nucleotide sequence shown as SEQ ID NO: 2, and the downstream primer comprises a nucleotide sequence shown as SEQ ID NO:

3.

3. A reagent or kit containing the primer for identifying the genetic sex of the black carp according to claim 2.

4. The agent or kit of claim 3, wherein, The PCR Master Mix and ddH2O are further included.

5. A method for identifying the genetic sex of Hypophthalmichthys molitrix, characterized in that, The method comprises the following steps: (1) extracting the black carp genomic DNA to be tested as a template, and performing PCR amplification by using the primers with the nucleotide sequences shown as SEQ ID NO: 2-3; (2) detecting the PCR amplification product, and when the amplification product shows a 412bp band, the black carp to be tested is male; and when the amplification product does not show a 412bp band, the black carp to be tested is female.

6. The method for identifying the genetic sex of H. bulives according to claim 5, characterized in that, In the step (1), the total volume of the reaction system for PCR amplification is 50μL, including 2×PCR Master Mix 25μL, upstream and downstream primers each 1.5μL, DNA template 2μL and ddH2O 20μL.

7. The method for identifying the genetic sex of H. bulives according to claim 5, characterized in that, In the step (1), the reaction program for PCR amplification is: 94℃ pre-denaturation for 5min; 94℃ denaturation for 30s; 58℃ annealing for 30s, 72℃ extension for 45s, 34 cycles; 72℃ extension for 10min; cooling to 4℃.

8. The method for identifying the genetic sex of H. bulives according to claim 5, characterized in that, In the step (2), the number of bands of the PCR amplification product is detected by using 1.2% agarose gel electrophoresis.

Citation Information

Patent Citations

  • Molecular biology method for identifying gender of chub fry

    CN101613750A

  • Method adopting silver carp for detecting pollutants in aquatic water

    CN105002287A