CRISPR (clustered regularly interspaced short palindromic repeats)-based apple necrosis mosaic virus detection kit and detection method and application thereof

Abstract

The invention discloses a CRISPR (clustered regularly interspaced short palindromic repeats)-based apple necrotic mosaic virus detection kit and a detection method and application thereof. The CRISPR-based apple necrotic mosaic virus detection kit comprises an RT-RAA primer pair and a CRISPR / Cas12a detection system, wherein the RT-RAA primer pair and the CRISPR / Cas12a detection system are suitable for detecting the apple necrotic mosaic virus; the CRISPR-based apple necrotic mosaic virus detection method comprises the following steps: extracting nucleic acid from a sample to be detected, and carrying out RT-RAA reverse transcription recombinase isothermal amplification; the application of the apple necrotic mosaic virus detection kit is that the CRISPR-based apple necrotic mosaic virus detection kit is used for identifying a biological material containing the apple necrotic mosaic virus. The kit and the method provided by the invention have the advantages of rapid detection, good specificity, high sensitivity, simplicity and convenience in operation and the like, and are particularly suitable for large-scale and rapid detection requirements.

Description

Technical Field

[0001] The present invention relates to the technical field of plant quarantine, and more particularly to a CRISPR-based apple necrotic mosaic virus detection kit and detection method and application thereof. Background Art

[0002] Apple Necrotic Mosaic Virus (ApNMV) belongs to the Bromoviridae family and the Ilarvirus genus. The virus is a tripartite virus with a genome consisting of three single-stranded RNAs, including RNA1, RNA2, and RNA3. RNA1 and RNA2 encode enzyme proteins related to viral replication, and RNA3 encodes movement protein (MP) and coat protein (CP). Apple Necrotic Mosaic Virus mainly infects apples. In addition, the virus has also been found in sand apples, red fruits, and hawthorns. Studies have shown that AMV can co-infect with a variety of viruses. Among them, three recessive viruses, apple stem grooving virus (ASGV), apple stem pitting virus (ASPV) and apple chlorotic leaf spot virus (ACLSV), do not show obvious symptoms after infecting apples alone. However, co-infection with AMV will reduce plant growth, cause a decline in quality and yield, and greatly reduce apples' resistance to pathogens.

[0003] Although there are many methods for detecting plant viruses, such as RT-PCR (Reverse Transcription-Polymerase Chain Reaction), Quantitative Real-Time PCR (qPCR), Enzyme-Linked Immunosorbent Assay (ELISA), and Reverse Transcription-Recombinase Aided Amplification (RT-RAA) technology, these methods have their own advantages and disadvantages. For example, although RT-PCR and RT-qPCR are accurate, they are time-consuming and have strict temperature requirements, and operators need to undergo professional training; ELISA is complex and time-consuming, and the detection sensitivity is limited. Therefore, it is necessary to develop an efficient, sensitive, rapid, and precision instrument-free detection method for apple necrotic mosaic virus. Summary of the invention

[0004] To this end, the technical problem to be solved by the present invention is to provide an apple necrotic mosaic virus detection kit and detection method based on CRISPR and their application. By using the kit or the detection method, rapid visual detection of apple necrotic mosaic virus can be achieved, and the detection sensitivity is high and the specificity is strong.

[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0006] The CRISPR-based apple necrotic mosaic virus detection kit includes an RT-RAA primer pair and a CRISPR / Cas12a detection system suitable for apple necrotic mosaic virus detection; wherein:

[0007] The sequence of one primer in the RT-RAA primer pair is shown as SEQ ID NO.1, and the sequence of the other primer is shown as SEQ ID NO.2; the RT-RAA primer pair is used to perform specific RT-RAA reverse transcription recombinase isothermal amplification on the gene encoding the coat protein of apple necrotic mosaic virus to obtain an amplification product containing a specific DNA fragment;

[0008] The CRISPR / Cas12a detection system includes: a crRNA probe that specifically targets the specific DNA fragment, an LbCas12a enzyme and a reporter molecule FB; the sequence of the crRNA probe is shown in SEQ ID NO.3; the reporter molecule FB is a ssDNA labeled with fluorescein FAM and biotin, the fluorescein FAM is connected to the 5' end of the ssDNA, and the biotin is connected to the 3' end of the ssDNA; the sequence of the reporter molecule FB is shown in SEQ ID NO.4.

[0009] The CRISPR-based method for detecting apple necrotic mosaic virus includes the following steps:

[0010] S1. Extracting nucleic acid from the sample to be tested, using the RT-RAA primer pair in the above-mentioned apple necrotic mosaic virus detection kit to perform RT-RAA reverse transcriptase recombinase isothermal amplification on the nucleic acid of the sample to be tested, to obtain an amplification product containing a specific DNA fragment;

[0011] S2, purify the amplified product obtained in S1, add the purified amplified product to the CRISPR reaction system containing the crRNA probe, LbCas12a enzyme and reporter molecule FB in the above-mentioned kit, and perform CRISPR detection;

[0012] S3. After the test, insert the lateral flow chromatography test strip into the CRISPR reaction system, perform chromatography, and interpret the results.

[0013] In the above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S1, when preparing a reaction system for RT-RAA reverse transcriptase recombinase isothermal amplification, a hydration buffer is used to dissolve the RAA reaction dry powder to obtain a solution, and then the nucleic acid of the sample to be tested, the RT-RAA primer pair and ddH2O are added to the solution, and finally a magnesium acetate solution is added; the conditions for the isothermal amplification of the RT-RAA reverse transcriptase recombinase are: incubation at 42°C for 20 minutes. When preparing the RT-RAA reaction system, the magnesium acetate solution is added last, which is beneficial to avoid the reaction being activated by magnesium ions too early, causing non-specific amplification.

[0014] In the above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S2, the method for purifying the amplified product is: after mixing equal volumes of DNA extraction phenol reagent and amplification product, centrifuge at 12000rpm for 5 minutes, and retain the supernatant; the DNA extraction phenol reagent is prepared by mixing Tris-saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25:24:1.

[0015] In the above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S2, the reaction temperature during CRISPR detection is 37° C. and the insulation time is 18 minutes.

[0016] In the above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S2, in the CRISPR reaction system, the ratio of the molar concentration of LbCas12a enzyme to crRNA probe is 1:5. In the CRISPR reaction system, the concentration ratio of LbCas12a enzyme to crRNA probe mainly determines the activity of the enzyme in the reaction system and the specificity of the probe in recognizing the DNA sequence. When the ratio of enzyme to probe does not meet this value, some enzymes may fail to bind to the probe, or excessive competition of the probe may lead to nonspecific binding, thereby affecting the accuracy and sensitivity of the detection.

[0017] In the above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S2, in the CRISPR reaction system, the molar concentration of the LbCas12a enzyme is 200nM, and the molar concentration of the crRNA probe is 1000nM.

[0018] The above-mentioned CRISPR-based apple necrotic mosaic virus detection method, in step S2, in the CRISPR reaction system, the substance concentration of the reporter molecule FB is 600nM. In general, the concentration ratio of LbCas12a enzyme to reporter molecule FB has a small effect on the sensitivity of detection. However, the absolute concentration of the reporter molecule FB in the CRISPR reaction system will have a more obvious effect on the sensitivity of detection. When the concentration of the reporter molecule FB in the CRISPR reaction system is too low, it is impossible to generate enough detection signals, and it is difficult for the lateral flow chromatography test strip to have a color reaction.

[0019] The above-mentioned CRISPR-based apple necrotic mosaic virus detection method has a detection limit of 500 fg / μL for apple necrotic mosaic virus nucleic acid.

[0020] The application of an apple necrotic mosaic virus detection kit is to use the above-mentioned CRISPR-based apple necrotic mosaic virus detection kit to identify biological materials containing apple necrotic mosaic virus, or to identify apple necrotic mosaic virus.

[0021] The technical solution of the present invention achieves the following beneficial technical effects:

[0022] 1. The present invention provides an apple necrotic mosaic virus detection method and kit based on RT-RAA amplification and CRISPR / Cas12a technology. The detection method provided by the present invention can detect the apple necrotic mosaic virus by detecting the nucleic acid of the apple necrotic mosaic virus in the sample to be tested. By designing a specific RT-RAA primer pair, the specific amplification of the gene encoding the coat protein of the apple necrotic mosaic virus is achieved, and by screening an efficient RT-RAA primer pair, the efficiency of the RT-RAA primer pair in amplifying the gene encoding the coat protein of the apple necrotic mosaic virus is improved while ensuring that the specificity of the amplification is not impaired, that is, the sensitivity of the RT-RAA reaction is improved, which provides a basis for CRISPR / Cas12a detection; further, according to the needs of lateral flow chromatography test strip detection, the content and content ratio of the components in the CRISPR / Cas12a detection system, as well as the CRISPR reaction conditions are optimized to ensure the sensitivity, accuracy and detection efficiency of the detection; and the visual display of the lateral flow chromatography test strip can intuitively display the test results, and the entire detection process does not require complex instruments, and the operation is simple and fast.

[0023] 2. The detection method of the present invention has high sensitivity and strong specificity. By using RT-RAA amplification technology, a large number of specific DNA fragments can be quickly obtained under constant temperature conditions, which greatly improves the sensitivity of the detection. At the same time, the CRISPR / Cas12a detection system has a high degree of specific recognition ability for target DNA fragments, and can accurately distinguish apple necrotic mosaic virus from other similar viruses or pathogens, avoiding the occurrence of false detection and missed detection. The experimental results show that the detection limit of the method of the present invention for apple necrotic mosaic virus nucleic acid is much lower than that of the conventional RT-PCR method, showing higher detection performance.

[0024] 3. The detection kit and detection method provided by the present invention are applicable to a variety of application scenarios and have good practicality and promotion value. The detection method does not require electrophoresis and DNA staining, which reduces the complexity of the operation and increases the safety of the operation. The relevant detection method can be mastered with simple training, which greatly reduces the detection cost and time cost, and provides strong technical support for the prevention and control of apple necrotic mosaic virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The effect of the concentration of the reporter molecule FB in the CRISPR reaction system on the visualization of the detection results in the CRISPR-based apple necrotic mosaic virus detection method of the present invention, in which the control group uses ddH2O instead of the RNA template in the RT-RAA reaction system, C represents the quality control line, and T represents the detection line;

[0026] Figure 2 The effect of different CRISPR / Cas12a reaction temperatures on the detection results in the CRISPR-based apple necrotic mosaic virus detection method of the present invention, in which ddH2O is used as the control group instead of the RNA template in the RT-RAA reaction system, C represents the quality control line, and T represents the detection line;

[0027] Figure 3 The effect of different CRISPR / Cas12a reaction times on the detection results in the CRISPR-based apple necrotic mosaic virus detection method of the present invention, in which the control group uses ddH2O instead of the RNA template in the RT-RAA reaction system, C represents the quality control line, and T represents the detection line;

[0028] Figure 4 The experimental results of the specificity test of the CRISPR-based apple necrotic mosaic virus detection method of the present invention show that the interfering pathogens are apple stem groove virus, apple stem pox virus, apple mosaic virus, potato spindle tuber viroid and plum necrotic ringspot virus, C represents the quality control line, and T represents the detection line;

[0029] Figure 5The sensitivity test results of the CRISPR-based apple necrotic mosaic virus detection method of the present invention, 1 to 9 in the figure represent templates diluted 10 -0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 times RNA, NC represents the template is water, C represents the quality control line, and T represents the test line;

[0030] Figure 6 The experimental results of the sensitivity of conventional RT-PCR for the detection of apple necrotic mosaic virus. In the figure, M is DL2000 marker, and 1 to 9 represent templates diluted 10 -0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 times RNA, NC represents the template is water;

[0031] Figure 7 Comparative results of the amplification efficiency of the four RT-RAA primer pairs in Comparative Example 1 of the present invention for the RNA of apple necrotic mosaic virus;

[0032] Figure 8 The specificity verification experimental results of the RT-RAA primer pair in comparative example 2 of the present invention for amplifying apple necrotic mosaic virus RNA. DETAILED DESCRIPTION

[0033] Example 1

[0034] The apple necrotic mosaic virus in this example was derived from apple samples submitted for inspection in Jingyuan, Gansu Province. The apple stem groove virus and apple stem pox virus were donated by Huazhong Agricultural University. The apple mosaic virus, potato spindle tuber viroid and plum necrotic ringspot virus were preserved by the Chinese Institute of Inspection and Quarantine. The public can obtain them from the Chinese Institute of Inspection and Quarantine for repeating relevant experiments.

[0035] First, the RT-RAA primer pair and crRNA probe were designed and synthesized. Referring to the gene sequence of apple necrotic mosaic virus (ApNMV) reported in existing literature and Genbank, RT-RAA primers were screened and designed, aiming to make the selected primers applicable to apple necrotic mosaic virus, specifically amplify the target fragment, and the target fragment can be recognized by the CRISPR / Cas system. The RT-RAA primer pair and crRNA probe that specifically amplify the gene encoding the coat protein of apple necrotic mosaic virus (the GenBank accession number of the gene is: KY808387) were designed and selected.

[0036] The sequences of the RT-RAA primer pair are:

[0037] ApNMV-RAA-F (SEQ ID NO.1):5'-GTTTCTACATGTGAACTTCAGCACGACTTTCC-3';

[0038] ApNMV-RAA-R (SEQ ID NO.2):5'-CCTGGACAAGGCACTCGGACCTCTGAGATGA-3';

[0039] The above-mentioned RT-RAA primer pair was used to perform RT-RAA amplification (reverse transcription recombinase constant temperature amplification) on the gene encoding the coat protein of apple necrotic mosaic virus. The RT-RAA reaction system is shown in Table 1. In the table, A buffer is a hydration buffer, Bbuffer is a magnesium acetate solution, and the RAA reaction powder is a mixture of recombinase, polymerase and buffer salt lyophilized powder. A buffer, B buffer and RAA reaction powder are all included in the RNA Constant Temperature Rapid Amplification Kit (Basic Type)-II (Cat. No. WLRB8207KIT) of Anpu Future Biotechnology Co., Ltd. When preparing the RT-RAA reaction system, first add A buffer to the centrifuge tube containing the RAA reaction powder to fully dissolve the RAA reaction powder to obtain a solution, and then add RNA template, 10μmol / L ApNMV-F, 10μmol / L ApNMV-R and ddH2O to the solution, and finally add B buffer and mix well.

[0040] Table 1 RT-RAA reaction system

[0041]

[0042]

[0043] After the RT-RAA reaction system is prepared, it is incubated at 42°C for 20 minutes to obtain an amplification product containing a specific DNA fragment.

[0044] The above RT-RAA primer pair can also be used to perform RT-RPA amplification (reverse transcription recombinase polymerase isothermal amplification) on RNA templates to obtain an amplification product containing a specific DNA fragment. During RT-RPA amplification, a commercially available RT-RPA amplification kit is used and the method in the kit manual can be referred to.

[0045] After amplifying the RNA template using the above RT-RAA primers, the specific DNA fragment (SEQ ID NO.5) obtained was sequenced as follows:

[0046] GTTTCTACATGTGAACTTCAGCACGACTTTCCCGCAACTATTAGGATTGAATCTTAGGATTCTCTCCGTGGTAGTTCGAGCCAGCTGCCTGGTATCCGCTGGGTGGGTGGGAATGTTGGAGGACTTTGATGAGAATCATCTCAGAGGTCCGAGTGCCTTGTCCAGG

[0047] The amplified product containing the specific DNA fragment is purified. The purification method is to add a DNA extraction phenol reagent to the amplified product containing the specific DNA fragment and mix it, then centrifuge it at 12000rpm for 5min, retain the supernatant, and obtain a purified amplified product, which contains a specific DNA fragment with a sequence as shown in SEQ ID NO.5. The ratio of the volume of the DNA extraction phenol reagent added during purification to the volume of the amplified product containing the specific DNA fragment is 1:1. The DNA extraction phenol reagent is a DNA extraction reagent, which is prepared by mixing Tris saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25:24:1, and is purchased from Beijing Solebow Technology Co., Ltd. (Article No. T0250).

[0048] Take 2 μL of the purified amplified product and add it to the CRISPR reaction system for CRISPR detection. After adding the purified amplified product, the components contained in the CRISPR reaction system are shown in Table 2. The ApNMV-crRNA in the table is the crRNA probe. The crRNA probe, LbCas12a enzyme and reporter molecule FB together constitute the CRISPR / Cas12a detection system.

[0049] Table 2

[0050] Components volume Purified amplification product (containing specific DNA fragments) 2μL 10×NEBuffer r2.1 (NEB buffer r2.1) 2μL 40U / μL RNAse inhibitor 0.5μL 0.1mmol / L DTT (dithiothreitol) 0.5μL 10μmol / L ApNMV-crRNA (crRNA probe) 2μL 10μmol / L LbCas12a (Cpf1) enzyme 0.4μL 10μmol / L reporter molecule FB 1.2μL <![CDATA[ddH2O]]> 11.4μL total 20μL

[0051] The addition of dithiothreitol to the reaction system helps the LbCas12a (Cpf1) enzyme maintain high activity during the reaction, but when dithiothreitol is added in excess, the enzyme may denature and inactivate.

[0052] The sequence of the crRNA probe is:

[0053] ApNMV-crRNA(SEQ ID NO.3):5'-UAAUUUCUACUAAGUGUAGAU CCGCAACUAUUAGGAUUGA AUCU -3'

[0054] Among them, the underlined sequence can specifically target a single strand of the DNA (i.e., a specific DNA fragment) shown in SEQ ID NO.5, and complementarily pair with a single strand of the specific DNA fragment. With the help of this specific targeting and complementary pairing, the crRNA probe is able to guide the LbCas12a (Cpf1) enzyme in the CRISPR reaction system to the amplified product containing the specific DNA fragment and activate the CRISPR reaction. When the CRISPR reaction is activated, the LbCas12a enzyme cuts the specific DNA fragment in the CRISPR reaction system, and also cuts other DNA molecules in the CRISPR reaction system indiscriminately, including the reporter molecule FB.

[0055] The reporter molecule FB is a single-stranded DNA (ssDNA) with a fluorescent FAM label and a biotin label, with a fluorescent FAM label at the 5' end and a biotin label at the 3' end. The sequence of the reporter molecule FB is shown in SEQ ID NO.4:

[0056] SEQ ID NO.4:5'-FAM-TTTTTTTTTTTTTTTTTTTT-Biotin-3'

[0057] The sequence of the reporter molecule FB is the result of repeated experiments and optimization. Changing the sequence of the reporter molecule FB may lead to problems such as false positives, false negatives or decreased detection sensitivity.

[0058] The 10×NEBuffer 2.1 in Table 2 contains 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 μg / mL BSA, pH 7.9, purchased from New England Biolabs, Inc. (Cat. No. B6002V). RNAse inhibitor is an RNase inhibitor purchased from Promega (Beijing) Biotechnology Co., Ltd. (Cat. No. N2615), and LbCas12a (Cpf1) is a recombinant CRISPR-Cas12a protein (Lb), purchased from Shanghai Huicheng Biotechnology Co., Ltd. (Cat. No. E-002).

[0059] The reaction conditions for CRISPR detection are: incubation at 37°C for 18 minutes. During the incubation, a CRISPR reaction occurs in the CRISPR reaction system, and the reporter molecule FB is cut off.

[0060] After the CRISPR test is completed, a lateral flow chromatography test strip is inserted into the centrifuge tube containing the CRISPR reaction system. In this embodiment, the lateral flow chromatography test strip used is a Cas12 / 13 special nucleic acid detection test strip produced by Tiosbio, with a product number of JY0301. In some other embodiments, other brands of lateral flow chromatography test strips suitable for CRISPR nucleic acid product detection can also be used.

[0061] After inserting the lateral flow chromatography test strip, let it stand for 2 minutes, and then observe whether the test line and the quality control line change from colorless to red. Under normal circumstances, after the lateral flow chromatography test strip is inserted into the centrifuge tube, the substances in the CRISPR reaction system move along the chromatography direction on the lateral flow chromatography test strip to the quality control line and the test line. If there is no nucleic acid of apple necrotic mosaic virus in the centrifuge tube, the quality control line (C line) turns red and the test line (T line) has no color, indicating that the test result is negative. If there is nucleic acid of apple necrotic mosaic virus in the centrifuge tube, red strips appear on the quality control line (C line) and the test line (T line), or the quality control line (C line) does not show color and the test line (T line) shows a red strip. Both situations indicate that the reporter molecule FB is effectively cut, indicating that the test result is positive. If both the quality control line (C line) and the test line (T line) do not show color, the test is unsuccessful and needs to be retested. In this detection method, the color of the T line is the key indicator for positive determination, because it directly reflects the presence of the target nucleic acid and the cutting function of CRISPR / Cas. The color of the C line is only an auxiliary confirmation of whether the entire test strip is working properly, and its lack of color does not affect the judgment of the T line. Therefore, when the C line is colorless but the T line is colored, the test result can still be judged as positive.

[0062] In this example, the RNA template during RT-RAA amplification is the RNA of apple necrotic mosaic virus, and the test line and the quality control line on the lateral flow chromatography test strip both turn red, indicating that the test is successful (see the test strip for a photo). Figure 1 The concentration of reporter molecule FB in the experimental group was 600 nM).

[0063] Experimental Example 1

[0064] When the concentration of the reporter molecule FB in the CRISPR reaction system is too low, the color development effect of the test line is poor, and when the concentration is too high, it will cause unnecessary waste. In this experimental example, the concentration of the reporter molecule FB in the CRISPR reaction system is changed, and the effect of the concentration of the reporter molecule FB on the color development effect of the test line on the lateral flow chromatography test strip is compared.

[0065] The experimental settings in this experimental example are as follows:

[0066] Experimental group: According to the method in Example 1, the RT-RAA reaction system and the CRISPR reaction system were prepared in sequence. When preparing the CRISPR reaction system, the concentrations of the reporter molecule FB in the CRISPR reaction system were set to 100nM, 200nM, 400nM, 600nM (i.e., the concentration of the reporter molecule FB in the CRISPR reaction system in Example 1), 800nM and 1000nM, respectively. The rest of the operations were the same as in Example 1. When preparing the RT-RAA reaction system, the nucleic acid of the apple necrotic mosaic virus was used as the RNA template in the experimental group.

[0067] Control group: According to the method in Example 1, the RT-RAA reaction system and the CRISPR reaction system were prepared in sequence. When preparing the RT-RAA reaction system, ddH2O was used instead of the RNA template; when preparing the CRISPR reaction system, the concentration of the reporter molecule FB in the CRISPR reaction system was set to 100nM, 200nM, 400nM, 600nM, 800nM and 1000nM respectively. The rest of the operations were the same as in Example 1.

[0068] like Figure 1 The color results on the lateral flow chromatography test strip are shown. Figure 1 It can be seen that when the concentration of the reporter molecule FB in the CRISPR reaction system reaches 600nM, even if the concentration of the reporter molecule FB in the CRISPR reaction system is further increased, the red color of the test line on the lateral flow chromatography test strip no longer deepens. This result shows that the concentration of the reporter molecule FB in the CRISPR reaction system is preferably 600nM.

[0069] Experimental Example 2

[0070] In this experimental example, the CRISPR reaction temperature (i.e., the insulation temperature of the CRISPR reaction system) was changed to compare the effect of the CRISPR reaction temperature on the color development effect of the detection line on the lateral flow chromatography test strip.

[0071] The experimental settings in this experimental example are as follows:

[0072] Experimental group: RT-RAA reaction was performed according to the method in Example 1 and 5 CRISPR reaction systems were prepared. The prepared CRISPR reaction systems were kept at 35°C, 37°C (the same as the insulation temperature in Example 1), 39°C, 41°C and 43°C for 20 minutes. The rest of the operations were the same as in Example 1. When preparing the RT-RAA reaction system, the nucleic acid of apple necrotic mosaic virus was used as the RNA template in the experimental group.

[0073] Control group: According to the method in Example 1, RT-RAA reaction system and CRISPR reaction system were prepared in sequence; when preparing the RT-RAA reaction system, ddH2O was used instead of RNA template; and then 5 CRISPR reaction systems were prepared, and the prepared CRISPR reaction systems were placed at 35°C, 37°C, 39°C, 41°C and 43°C for 20 minutes. The rest of the operations were the same as in Example 1.

[0074] like Figure 2 is the color development result on the lateral flow chromatography test strip. Figure 2 It can be seen that when the CRISPR reaction temperature is 37° C., the red color of the test strip detection line is the deepest. That is, the temperature condition of the CRISPR reaction in Example 1 is the most suitable temperature condition.

[0075] Experimental Example 3

[0076] In this experimental example, the CRISPR reaction time (i.e., the incubation time of the CRISPR reaction system) was changed to compare the effect of the CRISPR reaction time on the color development effect of the detection line on the lateral flow chromatography test strip.

[0077] The experimental settings in this experimental example are as follows:

[0078] Experimental group: RT-RAA reaction was performed according to the method in Example 1 and 6 CRISPR reaction systems were prepared. The prepared CRISPR reaction systems were kept at 37°C for 3 min, 6 min, 9 min, 15 min, 18 min (i.e., the same as the holding time of the CRISPR reaction system in Example 1) and 21 min. The rest of the operations were the same as in Example 1. When preparing the RT-RAA reaction system, the nucleic acid of apple necrotic mosaic virus was used as the RNA template in the experimental group.

[0079] Control group: According to the method in Example 1, RT-RAA reaction system and CRISPR reaction system were prepared in sequence; when preparing the RT-RAA reaction system, ddH2O was used instead of RNA template; then 6 CRISPR reaction systems were prepared, and the prepared CRISPR reaction systems were placed at 37°C for 3min, 6min, 9min, 15min, 18min and 21min respectively. The rest of the operations were the same as in Example 1.

[0080] like Figure 3 is the color development result on the lateral flow chromatography test strip. Figure 3It can be seen that when the CRISPR reaction time reaches 18 minutes, even if the reaction time is extended, the red color at the test line on the lateral flow chromatography test strip will no longer deepen. This result shows that the appropriate incubation time for the CRISPR reaction system is 18 minutes. If the time is too short, the reaction may not be sufficient, which will interfere with the color development of the test strip and the interpretation of the test results; although the incubation time of more than 18 minutes will not lead to inaccurate or difficult to interpret test results, it will cause a decrease in detection efficiency.

[0081] Experimental Example 4

[0082] In this experimental example, an experiment was designed to test the specificity of the CRISPR-based apple necrotic mosaic virus detection method in Example 1 to apple necrotic mosaic virus.

[0083] According to the method in Example 1, the RT-RAA reaction system and the CRISPR reaction system were prepared in sequence, and apple stem grooving virus (ASGV), apple stem pitting virus (ASPV), apple mosaic virus (ApMV), potato spindle tuber viroid (PSTVd) and prunus necrotic ringspot virus (PNRSV) were detected respectively. Specifically, when preparing the RT-RAA reaction system, according to the conventional RNA extraction method, the total RNA of the above viruses was extracted respectively, and the total RNA of the above viruses was used as RNA templates to replace the RNA template in the RT-RAA reaction system in Example 1 (the RNA template in Example 1 is the RNA of apple necrotic mosaic virus), and the RT-RAA reaction system was prepared. The remaining operations are the same as in Example 1.

[0084] In addition, a positive control group was set up, and the operation of the positive control group was exactly the same as that of Example 1.

[0085] like Figure 4 The experimental results of the specificity test of the CRISPR-based apple necrotic mosaic virus detection method in this experimental example. From left to right in the figure are the detection results of the positive control group (apple necrotic mosaic virus), apple stem groove virus, apple stem pox virus, apple mosaic virus, potato spindle tuber viroid and plum necrotic ringspot virus. NC in the figure is the negative control group, and the RNA template in the RT-RAA reaction system of the negative control group is water. It can be seen from the figure that the CRISPR-based apple necrotic mosaic virus detection method in Example 1 is highly specific for apple necrotic mosaic virus, and the method is not interfered by other viruses during detection.

[0086] Experimental Example 5

[0087] In this experimental example, an experiment was designed to test the sensitivity of the CRISPR-based apple necrotic mosaic virus detection method provided in Example 1.

[0088] According to the conventional method, the total RNA of apple leaves infected with apple necrotic mosaic virus was extracted, and the extracted total RNA (concentration of 50 ng / μL) was diluted in a ten-fold concentration gradient to prepare 9 different concentrations of RNA to be tested (the dilution multiples were 10 -0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 ). Then, 2 μL of each of the 9 different concentrations of the tested RNA was taken as an RNA template, and an RT-RAA reaction system was prepared to amplify the RNA template, and the amplified product was subjected to a CRISPR / Cas12a reaction (the operation method was the same as in Example 1).

[0089] As a control, conventional RT-PCR method was used, with the above 9 different concentrations of the tested RNA as PCR template, and RT-PCR reaction was performed using the Quanshijin Company RT-PCR kit (Cat. No. AE411). The reaction system is shown in Table 3.

[0090] Table 3 RT-PCR reaction system

[0091]

[0092] Reaction conditions: reverse transcription at 45°C for 30 min, annealing at 94°C for 5 min, amplification for 35 cycles (denaturation at 94°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 45 s), and extension at 72°C for another 10 min.

[0093] The primers used in RT-PCR were ApNMV-PCR-F (ATGGTGTGCAATCGCTGTCA) and ApNMV-PCR-R (CATCGACCATAAGGATATCA). The PCR products were subjected to agarose gel electrophoresis.

[0094] like Figure 5 The sensitivity test results of the CRISPR-based apple necrotic mosaic virus detection method (i.e., the detection method provided in Example 1) are shown in Figure 1. -0 , 10 -1 , 10-2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 , 10 -8 As shown in the figure, when using the RT-RAA-CRISPR / Cas12a detection method, the dilution factor of 10 -5 The test RNA (concentration of 500fg / μL) is effectively detected. The test RNA (the test RNA with a concentration of 500fg / μL) is a mixture of apple necrotic mosaic virus RNA and apple RNA, that is, in the test RNA, the concentration of apple necrotic mosaic virus RNA is less than or equal to 500fg / μL. Therefore, it can be considered that the detection limit of the method provided in Example 1 for apple necrotic mosaic virus nucleic acid is 500fg / μL. Figure 6 The electrophoresis results of RT-PCR products. In the figure, M is DL2000 marker, and 1 to 9 represent templates diluted by 10 times. -0 , 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 , 10 -7 and 10 -8 times of the RNA to be tested, NC represents the template is water. Figure 6 It can be seen that the conventional RT-PCR method can detect the dilution factor of 10 -4 The RNA to be tested was effectively detected when the dilution factor was increased to 10 -5 The above results show that the detection sensitivity of the CRISPR-based apple necrotic mosaic virus detection method (i.e., the detection method provided in Example 1) is 10 times that of the conventional RT-PCR method.

[0095] Experimental Example 6

[0096] In this experimental example, apple leaves collected from various places were used as sample materials, and their total RNA was extracted as templates to verify the feasibility of applying the above-mentioned CRISPR-based apple necrotic mosaic virus detection method (i.e., the detection method provided in Example 1) to biological materials. At the same time, the RT-PCR method provided in the above-mentioned Experimental Example 5 was used as a control.

[0097] When extracting total RNA from biological materials, use RNAprep Pure Polysaccharide and Polyphenol Plant Total RNA Extraction Kit, the specific operation steps are according to the kit instructions.

[0098] Table 4 shows the test samples and test results.

[0099] Table 4 Test samples and test results

[0100]

[0101]

[0102] It can be seen from the results in the table that for these 15 apple leaf samples, the detection results of the above-mentioned CRISPR-based apple necrotic mosaic virus detection method (i.e., the detection method provided in Example 1) and the RT-PCR method are consistent, indicating that the above-mentioned CRISPR-based apple necrotic mosaic virus detection method (i.e., the detection method provided in Example 1) has good feasibility when applied to detecting whether biological materials contain apple necrotic mosaic virus.

[0103] Comparative Example 1

[0104] In this comparative example, by comparing and analyzing the genome sequence of apple necrotic mosaic virus, four pairs of RT-RAA primer pairs were designed by selecting the sequence conserved region (Table 5). Using RNA samples containing apple necrotic mosaic virus RNA as templates, RT-RAA amplification was performed on the templates using the four pairs of primers in Table 5 (the reaction system and reaction procedure were the same as in Example 1), and the amplified products were analyzed by agarose gel electrophoresis. The results are shown in FIG. Figure 7 In the figure, M is DL2000 marker, and lanes 1 to 4 are ApNMV-RAA-1F / 1R, ApNMV-RAA-2F / 2R, ApNMV-RAA-3F / 3R and ApNMV-RAA-4F / 4R, respectively. The electrophoresis results show that the band in lane ApNMV-RAA-3F / 3R is the brightest, indicating that the primer has the highest amplification efficiency for the target gene. Therefore, the ApNMV-RAA-3F / 3R sequence was selected as the primer pair used for amplification of RT-RAA of apple necrotic mosaic virus.

[0105] Table 5ApNMV primer sequences

[0106]

[0107]

[0108] Comparative Example 2

[0109] In order to test the specificity of RT-RAA primer pair in amplifying apple necrotic mosaic virus, total RNA extracted from plants carrying apple stem groove virus (ASGV), apple stem pox virus (ASPV), apple mosaic virus (ApMV), potato spindle tuber viroid (PSTVd), plum necrotic ringspot virus (PNRSV) and apple necrotic mosaic virus (ApNMV) was used as template for RT-RAA amplification, and the amplified products were analyzed by agarose gel electrophoresis. The results are as follows: Figure 8 In the figure, M is DL2000 marker, lanes 1 to 5 are the amplification results of templates containing RNA of apple groove virus, apple pox virus, apple mosaic virus, potato spindle tuber viroid and plum necrotic ringspot virus, lane 6 is the amplification result of template containing RNA of apple necrotic mosaic virus, and NC represents that the template for RT-RAA amplification is water. From the results in the figure, it can be seen that only DNA bands appear in lane 6, which shows that the RT-RAA primer has good specificity.

[0110] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the claims of this patent application.

Claims

1. A CRISPR-based apple necrotic mosaic virus detection kit, characterized in that: The invention comprises an RT-RAA primer pair and a CRISPR / Cas12a detection system suitable for detecting apple necrotic mosaic virus; wherein: The sequence of one primer in the RT-RAA primer pair is shown as SEQ ID NO.1, and the sequence of the other primer is shown as SEQ ID NO.2; the RT-RAA primer pair is used to perform specific RT-RAA reverse transcription recombinase isothermal amplification on the gene encoding the coat protein of apple necrotic mosaic virus to obtain an amplification product containing a specific DNA fragment; The CRISPR / Cas12a detection system includes: a crRNA probe that specifically targets the specific DNA fragment, an LbCas12a enzyme and a reporter molecule FB; the sequence of the crRNA probe is shown in SEQ ID NO.3; the reporter molecule FB is a ssDNA labeled with fluorescein FAM and biotin, the fluorescein FAM is connected to the 5' end of the ssDNA, and the biotin is connected to the 3' end of the ssDNA; the sequence of the reporter molecule FB is shown in SEQ ID NO.

4.

2. A CRISPR-based method for detecting apple necrotic mosaic virus, characterized in that: The following steps are involved: S1. Extracting nucleic acid from the sample to be tested, using the RT-RAA primer pair in the apple necrotic mosaic virus detection kit as claimed in claim 1, performing RT-RAA reverse transcriptase recombinase isothermal amplification on the nucleic acid of the sample to be tested to obtain an amplification product containing a specific DNA fragment; S2. Purify the amplified product obtained in S1, add the purified amplified product to the CRISPR reaction system containing the crRNA probe, LbCas12a enzyme and reporter molecule FB in the kit according to claim 1, and perform CRISPR detection; S3. After the test, insert the lateral flow chromatography test strip into the CRISPR reaction system, perform chromatography, and interpret the results.

3. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 2, characterized in that: In step S1, when preparing the reaction system for isothermal amplification of RT-RAA reverse transcriptase recombinase, a hydration buffer is used to dissolve the RAA reaction dry powder to obtain a solution, and then the nucleic acid of the sample to be tested, the RT-RAA primer pair and ddH2O are added to the solution, and finally a magnesium acetate solution is added; the conditions for isothermal amplification of RT-RAA reverse transcriptase recombinase are: incubation at 42°C for 20 minutes.

4. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 2, characterized in that: In step S2, the method for purifying the amplified product is: after mixing equal volumes of DNA extraction phenol reagent and amplified product, centrifuging at 12000rpm for 5 minutes, retaining the supernatant; the DNA extraction phenol reagent is prepared by mixing Tris-saturated phenol, chloroform and isoamyl alcohol in a volume ratio of 25:24:

1.

5. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 4, characterized in that: In step S2, the reaction temperature during CRISPR detection was 37°C and the incubation time was 18 min.

6. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 2, characterized in that: In step S2, in the CRISPR reaction system, the molar concentration ratio of the LbCas12a enzyme to the crRNA probe is 1:

5.

7. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 6, characterized in that: In step S2, in the CRISPR reaction system, the molar concentration of the LbCas12a enzyme is 200 nM, and the molar concentration of the crRNA probe is 1000 nM.

8. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 7, characterized in that: In step S2, in the CRISPR reaction system, the molar concentration of the reporter molecule FB is 600 nM.

9. The CRISPR-based method for detecting apple necrotic mosaic virus according to claim 2, characterized in that: The CRISPR-based apple necrotic mosaic virus detection method has a detection limit of 500 fg / μL for apple necrotic mosaic virus nucleic acid.

10. Application of an apple necrotic mosaic virus detection kit, characterized in that: The application is to use the CRISPR-based apple necrotic mosaic virus detection kit as described in claim 1 to identify biological materials containing apple necrotic mosaic virus, or to identify apple necrotic mosaic virus.

Images