Application of PTC-209 in preparation of medicine for treating liver cancer

Abstract

The invention discloses application of PTC-209 in preparation of a medicine for treating liver cancer, and in screening of a large number of compounds, it is found that the compound PTC-209 (ZINC853334) shows up to 98.13% of inhibition rate of combination of UBE2S and ubiquitin. A further dose-dependent secondary screening experiment shows that PTC-209 can inhibit the combination of UBE2S and ubiquitin in a concentration-dependent manner, and the median inhibitory concentration (IC50) is 21.21 [mu] M; compared with the traditional cytotoxic antitumor drugs, the small molecular compound provides a more efficient and safer new way for clinical treatment of liver cancer by virtue of excellent selectivity, accurate targeting ability and lower cytotoxicity, and is expected to lead a significant progress in the field of liver cancer treatment.

Description

Technical Field

[0001] The present invention belongs to a new application field of known compounds, and the specific application field is the application of drugs for cancer treatment, and specifically the application of PTC-209 in the preparation of drugs for treating liver cancer. Background Art

[0002] Primary liver cancer is one of the most common malignant tumors. Its global incidence ranks sixth among all malignant tumors, and its mortality rate ranks third. Primary liver cancer is also a clinical problem that needs great attention in my country. Although radical treatments such as surgical resection, liver transplantation and radiofrequency ablation can effectively prolong the survival of patients with liver cancer, most patients are already in the middle and late stages when diagnosed, thus losing the opportunity to receive these radical treatments. For the clinical treatment of patients with middle and late stage liver cancer, systemic treatments such as targeted therapy and immunotherapy are mainly used. Among them, targeted therapy mainly includes multi-kinase inhibitors and anti-angiogenic drugs such as sorafenib, lenvatinib, donafenib, regorafenib and apatinib, and immunotherapy is represented by immune checkpoint inhibitors. Although the clinical treatment of liver cancer has achieved certain results, the survival of patients with liver cancer is still relatively limited. In view of this situation, it is still an urgent and vital scientific issue to continue to explore more effective therapeutic targets and further prolong the survival time of patients.

[0003] The formation of liver cancer is a long and complex process, which is usually induced by multiple pathogenic factors such as viruses, alcohol, and aflatoxin, involving gene mutations and abnormal changes in multiple biological pathways. In the chronic process of normal liver gradually evolving into hepatitis, cirrhosis, and finally developing into liver cancer, ubiquitination modification plays a vital role by precisely regulating the degradation process or signal transduction pathway of proteins. As a key post-translational modification of proteins, ubiquitination plays an indispensable role in maintaining protein stability. This process depends on the synergistic action of three key ubiquitinases: E1 ubiquitin activating enzyme, E2 ubiquitin conjugating enzyme, and E3 ubiquitin ligase. Specifically, under the condition of ATP energy supply, the E1 enzyme forms a thioester bond with the C-terminal glycine of ubiquitin through its own cysteine ​​residue to activate a single free ubiquitin. The activated ubiquitin is then transferred to the cysteine ​​residue of the E2 enzyme. Finally, the specific lysine residue of ubiquitin is connected to the protein substrate by the E3 enzyme, thereby achieving precise regulation of the protein substrate. (1) Given the profound effects of ubiquitination on tumor biological behavior, it has become a promising target for anti-tumor therapy. In fact, dysregulation of ubiquitinases is a common feature of many cancers, including liver cancer. Therefore, the development of targeted drugs for key ubiquitination enzymes is expected to open up new and effective avenues for the treatment of liver cancer.

[0004] For a long time, E2 enzymes have been generally regarded as "bridges for delivering ubiquitin" with only auxiliary effects in the ubiquitination process. However, in recent years, many studies have revealed that E2 enzymes play a crucial regulatory role in the ubiquitination process. They precisely control the process and topological structure of the initiation, extension, and chain assembly reactions of ubiquitin chains, thereby determining the type of ubiquitination modification of substrate proteins and the different fates and outcomes of substrate proteins. Although drug development for E2 enzymes is still in its infancy, preliminary research results have revealed the potential and efficacy of such drugs in anti-tumor. For example, the compounds Leucetta A, Manadosterols A and B can prevent the formation of the E2 enzyme Ubc13-Uev1A complex. Knockdown of Ubc13 promotes the expression of the tumor suppressor gene p53, so these compounds, as inhibitors of Ubc13, are expected to become lead compounds for anti-cancer drugs. In addition, compound CC0651, as an allosteric inhibitor of the E2 enzyme Cdc34, inserts into the binding pocket on Cdc34 away from the catalytic site, changes its structure, and thus inhibits its activity. Further inhibition of the ubiquitination degradation of P27 will eventually inhibit tumor cell proliferation and is expected to play an anti-tumor role. Given the key role of E2 enzymes in the ubiquitination process and the continuous exploration of E2 enzyme inhibitors, it is expected that targeted drugs that can accurately lock specific E2 enzymes will be developed in the future, thereby achieving fine regulation of the ubiquitination mechanism. This precision medicine strategy may provide new hope for the treatment of malignant tumors. Summary of the invention

[0005] The study found that the expression level of UBE2S in liver cancer tissues was significantly higher than that in adjacent tissues, and was significantly positively correlated with the poor clinical prognosis of liver cancer patients. Given that UBE2S, as an E2 enzyme, plays a key role by catalyzing the transfer of ubiquitin, the goal of this invention is to focus on the development of small molecule compounds that can specifically block the binding of UBE2S to ubiquitin. Compared with traditional cytotoxic anti-tumor drugs, this type of small molecule compound provides a more efficient and safe new approach for the clinical treatment of liver cancer with its excellent selectivity, precise targeting ability, and low cytotoxicity, and is expected to lead to major progress in the field of liver cancer treatment.

[0006] In order to achieve the above object, the technical solution adopted by the present invention includes: Application of PTC-209 in the preparation of drugs for treating liver cancer.

[0007] Specifically, the chemical structure of PTC-209 is as follows:

[0008] Specifically, among the drugs for treating liver cancer, the half inhibitory concentration IC of PTC-209 is 50The value is 1~4 μM.

[0009] Use of PTC-209 in the preparation of inhibitors for therapeutically inhibiting the binding of UBE2S to ubiquitin.

[0010] Specifically, among the inhibitors, the half inhibitory concentration IC of PTC-209 is 50 It is 21.21 μM.

[0011] Specifically, the PTC-209 inhibits the ubiquitination of the substrate Securin through the UBE2S target, causing the accumulation of Securin protein.

[0012] Application of PTC-209 in the preparation of specific inhibitors of UBE2S binding to ubiquitin.

[0013] The advantages of the present invention are: In the screening of a large number of compounds, the present invention found that the compound PTC-209 (ZINC853334) exhibited an inhibition rate of up to 98.13% on the binding of UBE2S to ubiquitin. Further dose-dependent secondary screening experiments showed that PTC-209 could inhibit the binding of UBE2S to ubiquitin in a concentration-dependent manner, with a half inhibitory concentration (IC 50 ) is 21.21 μM; compared with traditional cytotoxic anti-tumor drugs, this type of small molecule compounds, with its excellent selectivity, precise targeting ability, and lower cytotoxicity, provides a more efficient and safe new approach for the clinical treatment of liver cancer, and is expected to lead to major progress in the field of liver cancer treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings are used to provide a further understanding of the present disclosure and constitute a part of the specification. Together with the following specific embodiments, they are used to explain the present disclosure but do not constitute a limitation of the present disclosure. In the accompanying drawings: Figure 1 (A) Virtual screening flow chart; (B) Structure diagram of 15 compounds obtained by virtual screening.

[0015] Figure 2(A) Schematic diagram of the high-throughput screening platform based on the FRET principle; (B) UBE2S-Ypet and Ub-Cypet proteins were expressed in prokaryotes and the purity was detected by Coomassie Brilliant Blue staining; (C) Fluorescence value changes at different time points of co-incubation of the high-throughput screening platform system; (D) Evaluation of the high-throughput screening platform; (E) Results of the initial screening of 15 compounds (A: ZINC98208167, inhibition rate 13.49%; B: ZINC34997445, inhibition rate 29.21%; C: ZINC207774661, inhibition rate 18.08%; D: ZINC82165247, inhibition rate 4.78%; E: ZINC797, inhibition rate 31.03%; F: ZINC3961115, Inhibition rate 17.02%; G: ZINC29118586, inhibition rate 46.94%; H: ZINC3817808, inhibition rate 11.63%; I: ZINC3767, inhibition rate -104.78%; J: ZINC853334 (PTC-209), inhibition rate 98.13%; K: ZINC1549162951, inhibition rate 39.89%; L: ZINC225488545, inhibition rate -172.39%; M: ZINC3840427, inhibition rate -13.67%; N: ZINC96113178, inhibition rate 4.91%; O: ZINC2106, inhibition rate -80%. ) (F) Secondary concentration-dependent screening results of PTC-209.

[0016] Figure 3 (A) Wild-type UBE2S full-length protein was expressed in prokaryotes and the purity was tested by Coomassie Brilliant Blue staining. (B) SPR detected the affinity of PTC-209 to wild-type UBE2S protein. (C) Computer docking interface diagram of PTC-209 and UBE2S. (D) Key binding sites predicted by computer docking. (E) MST detected the affinity of PTC-209 to wild-type UBE2S protein. (F) MST detected the affinity of PTC-209 to UBE2S protein with point mutations (G67A, K76A, E93A, I94A, K100A).

[0017] Figure 4(A) Western blot detection of the effect of PTC-209 on the formation of UBE2S-ubiquitin thioester bonds. (B) Western blot detection of the effect of PTC-209 on the formation of UBA1-ubiquitin thioester bonds. (C) Western blot detection of the effect of PTC-209 on the formation of UBE2C-ubiquitin thioester bonds. (D) Western blot detection of the effect of PTC-209 on the formation of UBE2S-ubiquitin thioester bonds in liver cancer cell lines. (EF) Western blot detection of the effect of PTC-209 on the UBE2S protein level in liver cancer cell lines. (GH) qPCR detection of the effect of PTC-209 on the UBE2S mRNA level in liver cancer cell lines.

[0018] Figure 5 (A) Western blot was used to detect the expression of Securin protein in Huh-7 cell lines with UBE2S overexpression or knockout. (B) Western blot was used to detect the expression of Securin protein in liver cancer cell lines treated with different concentrations of PTC-209. (C) Western blot was used to detect the expression of Securin protein in liver cancer cell lines treated with PTC-209 for different time periods. (D) Immunoprecipitation combined with Western blot was used to detect the effect of PTC-209 on the ubiquitination of Securin in liver cancer cell lines. (E) Western blot was used to detect the effect of PTC-209 on the stability of Securin protein in liver cancer cell lines. (F) Western blot was used to detect the expression of Securin protein in UBE2S knockout liver cancer cell lines treated with different concentrations of PTC-209. (G) Western blot was used to detect the expression of Securin protein in UBE2S knockout liver cancer cell lines treated with PTC-209 for different time periods. (H) Immunoprecipitation combined with Western blot assay to detect the effect of PTC-209 on the ubiquitination of Securin in UBE2S knockout liver cancer cell lines. (I) Western blot assay to detect the effect of PTC-209 on the stability of Securin protein in UBE2S knockout liver cancer cell lines.

[0019] Figure 6 (AB) CCK8 detection of the effect of PTC-209 on the proliferation of different liver cancer cell lines; (CF) CCK8 detection of the IC of PTC-209 in different liver cancer cell lines 50 value;** p <0.01,*** p <0.001.

[0020] Figure 7(A) Representative images of subcutaneous tumor fluorescein images before and after treatment with different concentrations of PTC-209; (B) General images of subcutaneous tumors in nude mice after 5 treatments with different concentrations of PTC-209; (C) Dynamic changes in the volume of subcutaneous tumors in nude mice after treatment with different concentrations of PTC-209; (D) Statistical graph of subcutaneous tumor fluorescein in nude mice after treatment with different concentrations of PTC-209; (E) Dynamic changes in the weight of nude mice after treatment with different concentrations of PTC-209; (F, G) IHC staining of mouse tumor tissues and HE staining of important organs after treatment with different concentrations of PTC-209, scale is 100 μM; * p <0.05,** p <0.01,*** p <0.001. DETAILED DESCRIPTION

[0021] The technical solution of the present invention is described in detail below in conjunction with the accompanying drawings: At present, about 40 E2 enzymes have been identified in human genes. How to accurately screen effective targets for anti-liver cancer drugs from this huge group is still a major challenge. Among the many E2 enzymes, UBE2S has attracted much attention due to its significant role in a variety of malignant tumors. Studies have shown that UBE2S is highly expressed in a variety of cancers such as brain cancer, cervical cancer, colon cancer, liver cancer, ovarian cancer, lung cancer, breast cancer and endometrial cancer, and its high expression level is closely related to the poor clinical prognosis of patients. In view of this, UBE2S is regarded as a highly potential diagnostic and therapeutic target, which is expected to open up new avenues in the treatment of malignant tumors. In the previous research work, the research team has conducted in-depth exploration of the mechanism of action of UBE2S in liver cancer. The results showed that the expression level of UBE2S in liver cancer tissue was significantly higher than that in adjacent cancer tissues, and was significantly positively correlated with the poor clinical prognosis of liver cancer patients. The specific mechanism of action is that UBE2S enters the cell nucleus through the nuclear localization signal (NLS) and interacts with TRIM28, thereby promoting the ubiquitination process of p27 and accelerating the occurrence and development of liver cancer. At the same time, UBE2S also regulates the VHL / HIF-1ɑ signaling pathway through ubiquitination modification, promotes glycolysis of liver cancer cells, and further promotes the occurrence and development of liver cancer. Of particular importance, a compound called cephalosporin was discovered in the study, which can effectively inhibit the expression level of UBE2S in liver cancer cells and successfully inhibit the growth of liver cancer in a tumor-bearing mouse model. However, it is worth noting that the inhibitory effect of cephalosporin on the expression level of UBE2S may not be completely specific, which means that in subsequent studies, we need to focus on developing inhibitors with higher specificity. Given that UBE2S, as an E2 enzyme, plays a key role by catalyzing the transfer of ubiquitin, our goal is to focus on the development of small molecule compounds that can specifically block the binding of UBE2S to ubiquitin. Compared with traditional cytotoxic anti-tumor drugs, this type of small molecule compound provides a more efficient and safe new approach for the clinical treatment of liver cancer with its excellent selectivity, precise targeting ability, and lower cytotoxicity, and is expected to lead to major progress in the field of liver cancer treatment.

[0022] The specific screening and experimental results are as follows: 1. Through virtual screening, 15 lead compounds that block the binding of UBE2S to ubiquitin were obtained.

[0023] 1.1 Experimental materials: 15 compounds were purchased from MCE, USA 1.2 Experimental methods: (1) Compound dissolution After calculating the concentration according to the molecular weight, the compound was dissolved in DMSO to a 20 mM stock solution, which was then aliquoted and frozen in a -20°C refrigerator.

[0024] (2) Model construction The initial model for this study was derived from the X-ray crystal structure of UBE2S (PDB: 5BNB) using the molecular transformation program implemented in the ICM version 3.9-1d program (Molsoft). The molecular transformation program implemented in the ICM-Pro 3.9-1d program can read, build, transform, optimize, analyze, and superimpose molecules, in addition to providing target evaluation to generate a three-dimensional model. Hydrogen atoms and missing heavy atoms were added to the receptor structure, and atom types and partial charges were assigned. The model was then subjected to local energy minimization using the ICM partial probabilistic Monte Carlo algorithm and analytical derivatives in the internal coordinates to determine the best position, with an optimization gradient of 45 kcal / mol / Å.

[0025] (3) High-throughput molecular docking A chemical library containing more than 50,000 natural products or natural product analogs (ZINC Natural Products Database) was used for in silico docking with the molecular model of UBE2S. Molecular docking was performed using the Virtual Library Screening (VLS) module in the ICM-Pro 3.9-1d program (Molsoft). During ICM fast docking and VLS, the receptor all-atom model was converted into an energy potential map calculated on a fine three-dimensional grid (0.5 Å cell). The grid potential map takes into account van der Waals forces, hydrogen bonds, hydrophobic and electrostatic interactions between the ligand and the receptor. The search region for molecular docking was restricted to the domain around amino acid residue Cys95 of UBE2S. Each compound in the library was assigned atom types and charges from the MMFF force field and then subjected to Cartesian minimization. During docking analysis, the ligand was represented by the all-atom model and was considered fully flexible in the potential field of the receptor, and its binding pose and internal torsion were sampled by a partial probabilistic Monte Carlo (BPMC) minimization procedure, which included local energy minimization after each random move. Each compound was docked into the binding pocket of the protein complex and a docking score was assigned to each compound based on the weighted components of the ICM scoring function (see below). To ensure convergence of the Monte Carlo optimization, each compound was docked three times and the lowest score for each ligand from three independent docking experiments was retained for ranking. The docking process took approximately 30 seconds per compound on an Intel Core 2.9 GHz CPU. A lenient cutoff score of -15.0 was chosen to exclude low affinity ligands and reduce the number of compounds tested in vitro. Ultimately, 15 compounds were purchased for in vitro biological testing.

[0026] (4) ICM all-atom ligand-receptor complex optimization and scoring Once the ligand-receptor complexes are generated by molecular docking, they need to be optimized and scored. According to the ICM method, internal coordinates are used as variables to describe the molecular system. The energy calculations are based on the ECEPP / 3 force field with a distance-dependent dielectric constant. The BPMC minimization procedure is used for global energy optimization. The procedure consists of four iterative steps. The BPMC global energy optimization method includes: 1) random conformational changes of free variables according to a predefined continuous probability distribution; 2) local energy minimization of analytically differentiable terms; 3) calculation of the full energy including non-differentiable terms such as entropy and solvation energy; 4) acceptance or rejection of the total energy based on the Metropolis criterion and return to step (1). The binding of small molecules to UBE2S is evaluated by the all-atom ICM ligand binding score in the multi-receptor screening benchmark, which is a compromise between the approximate binding Gibbs free energy and numerical error. The scoring function should give a good approximation of the binding free energy between the ligand and the receptor and is a function of different energy terms based on the force field. The ICM scoring function is weighted according to the following parameters: (i) the internal force field energy of the ligand, (ii) the entropy loss of the ligand between the bound and unbound states, (iii) ligand-receptor hydrogen bonding interactions, (iv) the polar and nonpolar solvation energy differences between the bound and unbound states, (v) electrostatic energy, (vi) hydrophobic energy, and (vii) desolvation of hydrogen bond donors or acceptors. The lower the ICM score, the higher the probability that the ligand is a binder. The score is calculated by the following formula: Sbind = Eint + TΔSTor + Evw + α1Eel + α2Ehb + α3Ehp+ α4Esf, where Evw, Eel, Ehb, Ehp, and Esf represent the solvation energy differences of van der Waals, electrostatic, hydrogen bonding, nonpolar, and polar atoms between the bound and unbound states, respectively. Eint is the internal tension of the ligand, ΔSTor is the loss of its conformational entropy upon binding, T = 300 K (i.e., room temperature), and αi is a constant that is independent of the ligand and receptor.

[0027] 1.3 Experimental Results In order to develop compounds that can block the binding of UBE2S to ubiquitin, we used the X-ray crystal structure data of UBE2S (PDB number: 5BNB) to select the binding pocket near the amino acid residue Cys95 in the active site of UBE2S. Subsequently, ICM-Pro 3.9-1d software was used to perform high-throughput molecular docking screening in a compound library containing more than 50,000 natural products or their analogs (i.e., the ZINC Natural Products Database). By setting the docking score threshold below -15, 15 potential high-affinity lead compounds were successfully screened out ( Figure 1 A, Figure 1B), these compounds are promising candidates for further investigation.

[0028] 2. Successfully constructed a high-throughput screening platform based on the FRET principle and screened the target compound PTC-209 2.1 Experimental Materials: (1) Instruments: AKTA purifier protein purifier (GE, USA); Histrap chromatography column (GE, USA); Tecan Spark microplate reader (Tecan, Switzerland); microwave oven (Midea); protein electrophoresis instrument (Bio-Rad, USA); protein developer (Bio-Rad, USA); 0.45 μm filter (Corning, USA).

[0029] (2) Materials: UBE2S-Cypet, Ub-Ypet, UBE2S wild-type and UBE2S (Gly67A, Lys76A, Glu93A, Ile94A, Lys100A) mutant vectors (Shanghai Genetech Co., Ltd.); BL21 (DE3) Escherichia coli (Beijing Qingke Biotechnology Co., Ltd.); IPTG (Beijing Solebow Technology Co., Ltd.); ATP, DTT (Dithiothreitol) (Selleck, USA); Sodium chloride, magnesium chloride (Sigma); 96-well plate (Corning, USA); One-step PAGE gel rapid preparation kit 10% (Shanghai Yazyme Biotechnology Co., Ltd.); 5× protein loading buffer (Shanghai Biotech Co., Ltd.); Coomassie Brilliant Blue R250 stain (Shanghai Biotech Co., Ltd.); ultrasensitive ECL luminescent solution (Shanghai Biotech Co., Ltd.).

[0030] 2.2 Experimental methods: (1) Protein expression and purification UBE2S-Cypet, Ub-Ypet, UBE2S wild type and UBE2S mutant vectors (Gly67A, Lys76A, Glu93A, Ile94A, Lys100A) were cloned into the GV296 vector with his tag and expressed in BL21 (DE3) competent cells. 1mM IPTG was added and induced at 180rpm and 16℃ for 16 h. After cell lysis and filtration, protein was purified using Histrap HP column and superdex. TM The purified protein was concentrated and stored in a -80°C refrigerator.

[0031] (2) FRET-based high-throughput screening High-throughput screening experiments were performed in 96-well plates using 3 mM ATP, 9 mM MgCl 2, 25 mM tris (pH7.0), 100 mM NaCl (labeled as FRET buffer). The final concentration of UBA1, UBE2S-Ypet and Ub-CyPet proteins was 1 μM. Since there were no previously reported inhibitors targeting UBE2S, DTT was used as a positive control to non-specifically disrupt the binding of UBE2S to ubiquitin. The specific experimental steps were to add 50 μL of UBA1, UBE2S-Ypet and Ub-CyPet dissolved in FRET buffer to each well of a 96-well plate. Then 20 μM of the compound was added to each well and incubated at 37°C for 1 h. The fluorescence intensity was measured using a full-spectrum microplate reader (excitation wavelength / emission wavelength: 414nm / 530nm, 414nm / 475nm and 475nm / 530nm). The hit compounds were initially selected, and then secondary screening was performed at different concentrations.

[0032] (3) SDS-PAGE Prepare polyacrylamide gel according to the instructions of the Yazyme gel preparation kit, take 5 μg of protein and add 1 / 4 volume of 5× protein loading buffer (containing β-mercaptoethanol), and heat at 95℃ for 10 min. Add the above samples to the polyacrylamide gel, keep the voltage at 180 V, and perform electrophoresis for 45 min. After the electrophoresis, take out the gel and put it into Coomassie brilliant blue solution, heat it at high heat in a microwave for 3 min, decolorize it at high heat in tap water for 30 min, take out the gel, take out the image, and store it in the imaging system.

[0033] 2.3 Experimental Results The FRET-based high-throughput screening (HTS) platform was used to further screen 15 potential compounds ( Figure 2 A, Figure 2 B). The principle of this screening platform is that in the presence of E1 enzyme and ATP, the FRET signal obtained by exciting Ub-CyPet provides a method to directly detect the binding of UBE2S to ubiquitin. After detection by a full-spectrum microplate reader, time-dependent fluorescence changes were successfully observed ( Figure 2 C), indicating that in this system UBE2S and ubiquitin can indeed bind and produce detectable fluorescence signals. Literature reports that the Z factor value is a key indicator for measuring whether the FRET screening platform is suitable for high-throughput screening. In subsequent experiments, we designed 20 negative control samples (DMSO) and 20 positive control samples (DTT) to calculate the Z factor value of the platform. After calculation and analysis, the Z factor value of the screening platform was 0.75 ( Figure 2 D), indicating that the platform is suitable for high-throughput screening. FRETThe percentage of signal suppression was used to represent the experimental results. Em was calculated according to the description in the previous literature. FRET In brief, the mixed system containing UBE2S-YPet and Ub-CyPet was excited by fluorescence at 435 nm and the fluorescence at 530 nm (Em total ) due to the nature of fluorescent proteins, the fluorescence of Cypet and Ypet at 435 / 530 nm is proportional to their actual peak values ​​(435 / 475 nm: FL DD ,475 / 530 nm:FL AA ). Therefore, the precise FRET signal (EmFRET) can be calculated using the following formula: Em FRET =Em total -X ×FL DD -Y × FL AA We detected the fluorescence intensity of Cypet-Ub and Ypet-UBE2S at different concentrations and calculated the values ​​of X and Y. In the initial screening experiment, we selected compounds with an inhibition rate of more than 50% as candidates. Compound PTC-209 (ZINC853334) showed an inhibition rate of up to 98.13% ( Figure 2 E). Further dose-dependent secondary screening experiments showed that PTC-209 could inhibit the binding of UBE2S to ubiquitin in a concentration-dependent manner, with a half inhibitory concentration (IC 50 ) is 21.21 μM ( Figure 2 F).

[0034] 3. PTC-209 can bind to UBE2S with good affinity 3.1 Experimental Materials (1) Instruments: Metal heater (Stuart, Shanghai); NanoTemper microthermophoresis instrument, capillary pipette (NanoTemp, Germany); BIAcoreT200 biomolecular interaction system, CM5 sensor chip (Cytiva); cell culture incubator (Thermo Fisher Scientific, USA).

[0035] (2) Materials: DMSO (Sigma); methanol (Tianjin Damao Reagent Factory); rapid transfer buffer, antibody diluent (Suzhou Xinsaimei Biotechnology Co., Ltd.); PVDF membrane (0.45 μm) (Merck Millipore Corporation, USA); RIPA cell lysis buffer, protease inhibitors (Shanghai Biotechnology Co., Ltd.); HBS-P buffer (pH 7.4, Cytiva, BR100671), amino coupling kit (GE Healthcare, BR-1000-50), acetate buffer (10 mM / pH 5.0, GE Healthcare, BR-1003-51), glycine-HCl buffer (10 mM / pH 1.5, GE Healthcare, BR-1003-54), sodium hydroxide solution (50 mM, Cytiva, BR100358); His-Tag protein labeling kit (Notamp, Germany).

[0036] 3.2 Experimental methods: (1) Microscale thermophoresis (MST) technology Dilute PTC-209 to 500 μM with PBS containing 5% DMSO. Take 20 μL and add it to a PCR tube. Take 10 μL of PBS containing 5% DMSO to each of several PCR tubes. Take 10 μL of PTC-209 from the first PCR tube and add it to the second PCR tube. Mix well and continue to take 10 μL and add it to the third PCR tube. Continue to dilute PTC-209 in a gradient manner and discard 10 μL of liquid from the last tube. Dilute the His-tag labeled UBE2S wild-type or mutant protein to 100 nM, add 10 μL of protein to all PCR tubes with PTC-209 and mix well. Use a capillary to draw up the sample and place the tray into the machine to start the machine test.

[0037] (3) Surface plasmon resonance assay (SPR) The SPR experiment was performed using a Biacore T200 instrument, and all experiments were performed at 25°C. The purified His-tagged UBE2S protein was immobilized on a CM7 chip, and small molecule compounds were used as the mobile phase, diluted with HBS to 7 concentrations. The diluted samples were placed in the designated position and the detection was started. Two zero concentration controls were set to correct for system deviations. The results were analyzed by 1:1 binding fitting using BiacoreT200 Evaluation Software to obtain the kinetic parameters of the interaction.

[0038] (4) The interaction map between UBE2S and PTC-209 was generated using LigPlot+ (version 2.2). Default parameters were used and the output was manually checked for accuracy.

[0039] 3.3 Experimental Results The premise for PTC-209 to work by blocking the binding of UBE2S to ubiquitin is that it can bind to UBE2S. Therefore, SPR was used to detect the affinity of PTC-209 binding to UBE2S. The results showed that the affinity can reach 1.24μM ( Figure 3 A, Figure 3 B). To further clarify the binding interface between PTC-209 and UBE2S, we docked UBE2S and PTC-209 by computer. The docking results showed that PTC-209 binds to a domain near Cys95 of UBE2S, and the methoxy group on the benzene ring of PTC-209 forms a hydrogen bond with Gly67 of UBE2S. At the same time, it interacts with residues Leu65, Leu66, Lys68, Asp69, Phe70, Pro71, Ser73, Pro74, Pro75, Lys76, Gly77, Tyr78, Glu93, Ile94, Cys95, Val96, Leu99, Lys100, Val112, Leu129, etc. ( Figure 3 C). To verify the accuracy of the predicted sites, we mutated the side chains of key amino acids Gly67, Lys76, Glu93, Ile94, and Lys100 ( Figure 3 D). The MST experiment was used to verify the changes in affinity before and after mutation. The results showed that since Gly67 is connected to PTC-209 through the main chain, the affinity after mutation is similar to that of wild type ( Figure 3 E) did not change much. However, after mutations in Lys76, Glu93, Ile94, and Lys100, the affinity decreased significantly, verifying the accuracy of the computer-predicted sites. This proves that compound PTC-209 does interact with UBE2S ( Figure 3 F), and the action site is consistent with the initial virtual screening site.

[0040] 4. PTC-209 can specifically inhibit the binding of UBE2S to ubiquitin 4.1 Experimental Materials (1) Instruments: Real-time quantitative PCR instrument (Thermo Fisher Scientific, USA); Nanodrop 2000 (Thermo Fisher Scientific, USA); (2) Materials: UBE2S antibody, α-tubulin antibody (Wuhan Sanying Biotechnology Co., Ltd.); UBE2C antibody; total cell RNA extraction kit (OMEGA, USA); TB Green fluorescent dye (Takara, Japan); q-PCR primers (Beijing Qingke Biotechnology Co., Ltd.); Pierce™ Cross-linking IP Kit (Thermo Fisher Scientific, USA, 26147).

[0041] (3) Cell lines: Humanized hepatocellular carcinoma cell lines: Huh-7, HCCLM3, HepG2, and Hep3B.

[0042] 4.2 Experimental Methods (1) In vitro ubiquitination assay In vitro ubiquitination experiments were performed according to literature reports. Briefly, 0.25 μM UBA1, 30 μM ubiquitin, 3 mM ATP, 9 mM MgCl 2 Mix well in 25 mM tris (pH 7.0) and 100 mM NaCl solution and incubate on ice for 3 min. Add or not add UBE2S or UBE2C, incubate at room temperature for 10 min, terminate the system with non-reducing protein loading buffer, and use for western blotting experiments.

[0043] (2) Western blot experiment After digestion of liver cancer cells, the cell pellets were collected by centrifugation and washed once with 1× PBS. 6 Add 100 μL of RIPA lysis buffer to each cell and lyse on ice for 30 min. Centrifuge at 10000 g for 30 min, and pipette the supernatant into a new 1.5 mL EP tube. Quantify the supernatant using Nanodrop 2000, and add 1 / 4 volume of 5X reducing denatured protein loading buffer (containing β-mercaptoethanol) or non-reducing non-denatured protein loading buffer (without β-mercaptoethanol) after quantification. The reducing sample is heated at 95°C for 10 min, and the non-reducing sample is not heated. Prepare polyacrylamide gel according to the instructions of the Yazyme gel preparation kit. After loading, keep the voltage at 180 V and perform electrophoresis for 45 min. Use a fast transfer solution with a constant current of 400 mA for 30 min. Block with 5% skim milk powder at room temperature for 1 h, and incubate the primary antibody at 4°C overnight. Reheat for half an hour after overnight, wash three times with PBST, incubate with the secondary antibody at 37°C for 1 h, wash three times with PBST, and develop on a luminometer using a luminescent solution.

[0044] (3) Real-time fluorescence quantitative PCR Total RNA was extracted from cells according to the instructions of the total RNA extraction kit, and the RNA concentration was measured by Nanodrop2000 and then reverse transcribed into cDNA. The total volume of reverse transcription was 20 μL, and the RNA content was 1000 ng. The reverse transcription system was:

[0045] The reverse transcription reaction conditions were:

[0046] The qPCR reaction system is 20 μL, as shown in the following table:

[0047] The specific primer sequences are as follows: hUBE2S-F: CCGACACGTACTGCTGACC; hUBE2S-R:GCCGCATACTCCTCGTAGTTC; After the reaction, the internal reference was used as the standard to calculate gene 2 -ΔΔct , and finally the gene expression level is obtained.

[0048] (4) IP experiment According to the instructions of the IP kit, 10 μg of Securin antibody was cross-linked to Protein A / G resin. Huh-7 and HCCLM3 cells were lysed with IP lysis buffer, and the cell lysate was mixed with the cross-linked antibody and incubated overnight at 4°C. The resin was eluted with elution buffer, the flow-through was collected, and the protein ubiquitination was detected with anti-ubiquitin antibody.

[0049] 4.3 Experimental Results In order to verify the effectiveness of PTC-209 in inhibiting the binding of UBE2S to ubiquitin, we designed a series of in vitro ubiquitination experiments that simulated the key steps of the ubiquitination enzymatic cascade. In the experiment, we sequentially detected the effects of PTC-209 on the formation of the E2 enzyme UBE2S-ubiquitin thioester bond, the E1 enzyme UBA1-ubiquitin thioester bond, and the E2 enzyme UBE2C-ubiquitin thioester bond. The E1 enzyme, E2 enzyme and ubiquitin protein were mixed in the reaction system, and PTC-209 or DMSO was added to the system as a control. The results showed that PTC-209 could significantly inhibit the formation of the UBE2S-ubiquitin thioester bond in a concentration-dependent manner ( Figure 4 A). Notably, PTC-209 inhibits the UBA1-ubiquitin thioester bond ( Figure 4 B) and UBE2C-ubiquitin thioester bond ( Figure 4In addition, we also conducted corresponding experiments in liver cancer cell lines and found that PTC-209 also blocked the binding of UBE2S to ubiquitin in a concentration-dependent manner ( Figure 4 D). These experimental results consistently show that PTC-209 does have the ability to block the binding of UBE2S to ubiquitin. More importantly, our study also found that PTC-209 does not cause UBE2S protein levels in liver cancer cells ( Figure 4 E, Figure 4 F) and mRNA levels ( Figure 4 G, Figure 4 This finding further supports the potential of PTC-209 as a specific inhibitor of UBE2S binding to ubiquitin.

[0050] 5. PTC-209 inhibits the ubiquitination of the substrate protein Securin, causing Securin protein accumulation 5.1 Experimental Materials: Securin antibody (Wuhan Sanying Biotechnology Co., Ltd.); ubiquitin antibody (Abcam, USA); Cycloheximide (CHX) (Shanghai Biotech Co., Ltd.).

[0051] 5.2 Experimental methods Ibid.

[0052] 5.3 Experimental Results UBE2S is a cofactor of the E3 enzyme APC / C, responsible for extending K11 ubiquitin chains. This process ubiquitinates cell cycle regulatory proteins (such as securin), which in turn promotes these proteins to be recognized and degraded by the 26S proteasome, thereby promoting the cell cycle to enter the late stage smoothly. (2) To verify the specific effect of UBE2S on the expression level of substrate protein Securin, we constructed two cell lines: one was a UBE2S knockout cell line, and the other was a UBE2S overexpression cell line. Western blot results showed that in the UBE2S knockout cell line, the expression level of Securin showed an upward trend; on the contrary, in the UBE2S overexpression cell line, the expression level of Securin decreased significantly ( Figure 5 A). Based on the above findings, we further speculated that if PTC-209 could inhibit the binding of UBE2S to ubiquitin, it might also affect the expression level of Securin. To verify this hypothesis, we then tested the effect of PTC-209 on the expression level of Securin protein. The results showed that PTC-209 could promote the accumulation of Securin protein in a concentration- and time-dependent manner ( Figure 5 B. Figure 5 C). In order to further explore whether PTC-209 regulates Securin protein expression by affecting its ubiquitination level, we conducted a cellular ubiquitination experiment. The experimental results showed that PTC-209 significantly inhibited the ubiquitination process of Securin ( Figure 5 D) and prolonged the half-life of Securin ( Figure 5 E). Of course, small molecule compounds may have off-target effects. In order to exclude off-target effects, we conducted the above experiment in the UBE2S knockout cell line. The results showed that PTC-209 could not induce the accumulation of Securin after UBE2S knockout ( Figure 5 F, Figure 5 G), and could not affect its ubiquitination ( Figure 5 H) and half-life ( Figure 5 I). The above experiments show that the compound PTC-209 inhibits the ubiquitination of the substrate Securin through the UBE2S target, causing the accumulation of Securin protein.

[0053] 6. PTC-209 inhibits the proliferation of liver cancer cells 6.1 Experimental Materials (1) Instrument: ELISA reader (BioTek, USA).

[0054] (2) Materials: Cell cycle detection kit (Jiangsu KeyGen Biotech Co., Ltd.); Nocodazole (Selleck, USA).

[0055] 6.2 Experimental Methods (1) CCK8 detection IC 50 Hepatoma cells in the logarithmic growth phase were cultured at a rate of 5×10 3 The cells were inoculated into 96-well plates and treated with different concentrations of PTC-209 for 72 h. After 72 h, 10 μL of CCK-8 was added to each plate, and the cell growth was detected by an ELISA instrument. The inhibition curve was drawn using GraphPad Prism software to calculate the IC 50 .

[0056] 6.3 Experimental Results In order to evaluate the effect of PTC-209 on the growth of liver cancer cells, we used CCK8 assay to detect the proliferation of liver cancer cells. The results showed that PTC-209 had a significant dose-dependent inhibitory effect on the growth of liver cancer cells ( Figure 6 A, Figure 6B). Subsequently, we further explored the anticancer activity of PTC-209 in four different liver cancer cell lines. Through a 72-h CCK8 cell proliferation assay, we observed that PTC-209 exhibited growth inhibitory activity in all tested liver cancer cell lines, with a half inhibitory concentration (IC 50 ) values ​​ranged from 1 to 4 μM ( Figure 6 C, Figure 6 D, Figure 6 E, Figure 6 F) The above experiments prove that PTC-209 has a significant inhibitory effect on liver cancer cells.

[0057] 7. PTC-209 inhibits liver cancer growth in vivo 7.1 Experimental Materials (1) Experimental animals: 6-8 week old male nude mice were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd.

[0058] (2) Instruments: Small animal in vivo imaging system (Carestream, USA); oven (Tianjin Tester Company); film scanner (Olympus, Japan); pressure cooker (Supor).

[0059] (3) Materials: isoflurane (Shenzhen Ruiwode); 4% paraformaldehyde (Wuhan Boster Biotechnology Co., Ltd.); xylene (Chengdu Cologne Co., Ltd.); anhydrous ethanol (Tianjin Damao Reagent Factory); hematoxylin staining solution (Beijing Solebold Technology Co., Ltd.); eosin staining solution (Zhuhai Beso Biotechnology Co., Ltd.); adhesive slides (Jiangsu Shitai Co., Ltd.); mounting medium (Wuxi Jiangyuan Industrial Co., Ltd.); histochemical pen, immunohistochemistry kit (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd.); D-luciferin potassium salt (Biyuntian Biotechnology); Ki67 antibody (Wuhan Sanying Biotechnology Co., Ltd.).

[0060] 7.2 Experimental Methods (1) Subcutaneous tumor formation in nude mice Six-week-old male nude mice were purchased and placed for 3 days before the experiment. Huh-7 cells expressing luciferase (Huh7-Luc) in the logarithmic growth phase were digested and centrifuged at 1000 rpm for 5 min after the complete medium was terminated. The supernatant was discarded and washed once with the medium, and the cells were resuspended and counted to 3×10 7 / ml. Take 150 μL of cells from each mouse and slowly insert the needle into the subcutaneous part of the nude mouse along the back. Two weeks after tumor inoculation, the mice were randomly divided into 4 groups according to tumor size (Control group; PTC-209: 50 mg / kg body weight; 30 mg / kg body weight; 15 mg / kg body weight). The drug was intraperitoneally administered once every 3 days according to the dose, and the body weight and tumor volume of the nude mice were measured. After five treatments, the nude mice were killed and the tumor tissues were separated, weighed and photographed. The heart, liver, spleen, lungs and kidneys of the mice were taken for HE staining.

[0061] (2) In vivo imaging of small animals D-luciferin potassium salt was prepared into a 15 mg / ml solution, and 100 μL / mouse was intraperitoneally injected. The mice were anesthetized with isoflurane gas, and after thorough anesthesia, they were placed in a small animal in vivo imaging instrument for imaging.

[0062] (3) HE staining Baking: Place the tissue paraffin sections in an oven at 80°C for 2 h.

[0063] The sections were stained as follows: xylene twice, 5 min each. Absolute ethanol twice, 5 min each. 95% ethanol twice, 2 min each. 80% ethanol 2 min. 75% ethanol 2 min. Rinse with tap water for 2 min. Stain with hematoxylin solution for 5 min. Wash off the hematoxylin solution with running water for 2 min. 1% hydrochloric acid ethanol for 1 s. Rinse with tap water for 2 min. Stain with eosin for 5 min. Rinse with tap water for 30 s. 95% ethanol for 10 s. Absolute ethanol twice, 2 min each. Xylene (absolute ethanol) twice, 2 min each.

[0064] Sealing and reading: Sealing with neutral gum, add neutral gum to the wax sheet of the slide, and slowly cover the cover glass at 45 degrees to avoid bubbles. If bubbles remain, gently press the cover glass until the bubbles are removed. After sealing, dry in a ventilated place and store after the reading is qualified.

[0065] (4) Immunohistochemistry Baking: Place the tissue paraffin sections in an oven at 80°C for 2 h.

[0066] Dewaxing and hydration: xylene twice, 20 min each time. Absolute ethanol twice, 5 min each time. 95% ethanol twice, 5 min each time. 90% ethanol 2 min. 80% ethanol 2 min. 75% ethanol 2 min. Rinse with tap water for 5 min.

[0067] Antigen repair: Take a bag of antigen repair solution and dissolve it in 2 L of pure water. After dissolving, pour the liquid into the pressure cooker. Turn the pressure cooker to hot pot without covering the lid. After the pressure cooker boils, put the slices in and cover the pressure cooker. After the pressure cooker boils again, count 2 minutes. Stop heating immediately after 2 minutes, cool the antigen repair solution in the pressure cooker, take out the slices, rinse with PBS and proceed to the next experiment.

[0068] Block endogenous peroxidase: After the tissue is stained with a pen, add a drop of blocking agent for endogenous peroxidase and keep at room temperature for 10 min. After that, wash three times with PBS, each time for 3 min.

[0069] Primary antibody: dilute Ki67 at 1:1000, add 100 μL on the tissue, and incubate at 4°C overnight.

[0070] Add reaction enhancement solution: After the primary antibody is left overnight, take it out of the refrigerator and warm it up to room temperature for 30 minutes. After 30 minutes, wash it three times with PBS, each time for 3 minutes. Add reaction enhancement solution and incubate at 37℃ for 20 minutes. After that, wash it three times with PBS, each time for 3 minutes.

[0071] Enhanced enzyme-labeled goat anti-mouse / rabbit IgG polymer: Add enhanced enzyme-labeled goat anti-mouse / rabbit IgG polymer dropwise and incubate at 37°C for 20 min. Wash with PBS three times, 3 min each time.

[0072] DAB color development: Add one drop of concentrated DAB solution to every 1 ml of DAB substrate solution for color development and develop at room temperature for 2 min.

[0073] Hematoxylin staining: add hematoxylin dropwise and leave at room temperature for 2 min. Rinse with running water for 5 min.

[0074] Dehydration and transparency: Dewaxing and hydration steps are carried out in reverse order.

[0075] Sealing and reading: Sealing with neutral gum, add a drop of neutral gum on the wax sheet of the slide, and slowly cover the cover glass at 45 degrees to avoid bubbles. If bubbles remain, gently press the cover glass until the bubbles are removed. After sealing, dry in a ventilated place and store after the reading is qualified.

[0076] 7.3 Experimental Results To verify the therapeutic effect of PTC-209 in vivo, we constructed Huh-7 cells that stably express luciferase and successfully used this cell line to construct a nude mouse subcutaneous tumor model. 14 days after the model was established, we randomly divided the tumor-bearing mice into four groups according to the size of the tumor and injected the mice intraperitoneally with the predetermined dose. The treatment results showed that compared with the control group, mice treated with PTC-209 showed a significant decrease in tumor luciferin intensity and tumor weight ( Figure 7 Figures A-E). To gain a deeper understanding of the effects of PTC-209 on tumor growth, we further analyzed the expression of Ki67 (a marker protein for cell proliferation) in tumor sections by immunohistochemistry (IHC). The results showed that PTC-209 treatment could significantly downregulate the expression level of Ki67 ( Figure 7 F). In addition, we also performed HE staining analysis on important organs of mice, such as liver, heart, spleen, lung, and kidney. The results showed that PTC-209 did not cause obvious toxic side effects in these organs ( Figure 7G). These experimental results fully demonstrate the efficacy and safety of PTC-209 in in vivo treatment.

[0077] The preferred embodiments of the present disclosure are described in detail above in conjunction with the accompanying drawings; however, the present disclosure is not limited to the specific details in the above embodiments. Within the technical concept of the present disclosure, a variety of simple modifications can be made to the technical solution of the present disclosure, and these simple modifications all fall within the protection scope of the present disclosure.

[0078] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present disclosure will not further describe various possible combinations.

[0079] In addition, various embodiments of the present disclosure may be arbitrarily combined, and as long as they do not violate the concept of the present disclosure, they should also be regarded as the contents disclosed by the present disclosure.

Claims

1. Application of PTC-209 in the preparation of drugs for the treatment of liver cancer.

2. The use according to claim 1, characterized in that: The chemical structural formula of the PTC-209 is as follows: 。 3. The use according to claim 1 or 2, characterized in that: Among the drugs for treating liver cancer, the half inhibitory concentration IC of PTC-209 is 50 The value is 1~4 μM.

4. Application of PTC-209 in the preparation of inhibitors for therapeutic inhibition of UBE2S binding to ubiquitin.

5. The use according to claim 4, characterized in that: Among the inhibitors, PTC-209 has a half inhibitory concentration IC 50 It is 21.21 μM.

6. The use according to claim 4, characterized in that: The PTC-209 inhibits the ubiquitination of the substrate Securin through the UBE2S target, causing the accumulation of Securin protein.

7. Application of PTC-209 in the preparation of specific inhibitors of UBE2S binding to ubiquitin.

Images