CHO-K1 engineering cell strain with humanized glycosylation constitutive mode

Abstract

The invention discloses a CHO-K1 engineering cell strain with a humanized glycosylation constitution mode, the genome of the cell strain is integrated with coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTIII, and the CHO-K1 engineering cell strain can be used for producing humanized glycoprotein. The invention also discloses a carrier of the landing frame containing the targeting CHO-K1 cell genome Rosa26 site, and a CHO-K1 engineering cell strain integrating the landing frame at the genome Rosa26 site.

Description

Technical Field

[0001] The invention relates to a CHO engineering cell strain and belongs to the field of cytology. Background Art

[0002] With the rapid development of the biopharmaceutical industry, the continuous deepening of basic research in life sciences, the increasing demand for in vitro diagnostics, and the rise of fields such as mRNA vaccines, the demand for recombinant proteins continues to grow, and 70% of recombinant protein drugs are glycoproteins. At present, with the development of genetic engineering technology, therapeutic recombinant proteins have the characteristics of high safety, strong specificity and easy large-scale production, but they are prone to aggregation and degradation during storage. Glycosylation is a very important and ubiquitous post-translational modification in proteins, which plays an important role in regulating protein stability, folding, targeted transport, immunogenicity, biological activity, and especially circulation half-life. Therefore, the stability of glycoprotein drugs is closely related to glycosylation modification, and glycosylation is also considered to be one of the key quality attributes of glycoprotein drugs.

[0003] The production of glycoprotein drugs often uses mammalian cells, such as HEK293, HuH-7, CHO cells (Chinese Hamster Ovary cells), etc., due to their immunogenicity. CHO-K1 cells are a laboratory-cultured cell line derived from Chinese hamster ovary cells. In the more than 60 years of CHO cell research history, a variety of different cell lines with different properties have been derived from the original cell line. The most common CHO derivative is CHO-K1, which was born in 1957. It is a subclone of early CHO cells and has not been modified. It belongs to wild-type cells. CHO-K1 cells are the preferred host cells for the production of protein drugs because compared with other systems, CHO-K1 cells are similar to human protein glycosylation modification mechanisms, can be cultured on a large scale, and have a clear genetic background. Therefore, it is currently the most commonly used mammalian cell for recombinant protein expression. However, the expression levels of different glycosyltransferases in CHO-K1 cells are different from those in humans, and the glycoforms of the produced glycoproteins are also diverse. Different glycosylation forms will cause changes in the conformation of glycoproteins, thereby affecting their ability to bind to receptors, enzyme activity and other functions. Therefore, it is necessary to produce glycoprotein drugs with uniform glycoforms to ensure consistent efficacy and pharmacokinetics in the body.

[0004] The core structure of the N-glycan molecule is a complex "biantenna-type" pentasaccharide molecule composed of 3 mannose and 2 N-acetylglucosamine molecules, and different glycoforms can contain different numbers of other molecules, such as fucose, mannose, N-acetylglucosamine, galactose, bisected N-acetylglucosamine and sialic acid. The differences in the length of the sugar chain, the way of bifurcation, and the order of arrangement of monosaccharides result in the complex and variable structure of N-glycans. This core structure of N-glycans can be further diversified by the action of various enzymes, and can be roughly divided into three structures, namely high mannose type, hybrid type and complex type. When there are multiple different glycosylation forms in protein drugs, the immunogenicity of glycoprotein drugs and the toxicity of drugs to non-target organs or other adverse reactions will be increased. Studies have reported that increasing the galactose, sialic acid and terminal N-acetylglucosamine groups of glycoprotein drugs can increase the half-life and improve the efficacy of drugs. In order to achieve humanization, it is necessary to understand the differences in glycosyltransferases contained in human cells and CHO-K1 cells. On the one hand, human cells can express both α2,3 and α2,6 sialyltransferases, while CHO-K1 cells only express α2,3 sialyltransferases; on the other hand, CHO-K1 cells do not contain N-acetylaminoglycosyltransferase III. Therefore, we need to overexpress α2,6 sialyltransferase (ST6GAL1) and N-acetylaminoglycosyltransferase III in CHO-K1 cells. Although CHO-K1 cells have endogenous α2,3 sialyltransferases, their expression level is not enough to fully occupy all potential glycosylation sites on the target protein.

[0005] The purpose of the present invention is to provide a CHO-K1 engineered cell strain, which is closer to the glycosyltransferase composition pattern of human cells, so as to improve the humanization degree of CHO-K1 cells as an engineered cell strain. Summary of the invention

[0006] Based on the above objectives, the present invention first provides a gRNA, which targets and recognizes the Rosa26 gene site in the CHO-K1 cell genome.

[0007] In a preferred embodiment, the sequence of the gRNA is as shown in SEQ ID NO.2.

[0008] Secondly, the present invention provides a lentiviral vector containing the above-mentioned gRNA, wherein the lentiviral vector also contains a gene encoding a Cas9 protein and a gRNA scaffold element.

[0009] In a specific embodiment of the present invention, the lentiviral vector is a LentiCRISPRV2 vector, which is a CRISPR / Cas9-based vector for gene knockout in mammalian cells.

[0010] Third, the present invention provides a method for integrating the above-mentioned lentiviral vector into a landing carrier vector at the Rosa26 gene site of the CHO-K1 cell genome, the method comprising the following steps: (1) constructing a landing pad vector containing a homology arm of the Rosa26 locus, wherein the landing pad vector has a structure of loxP element A-resistance gene element-loxP element B-PGK-FRT, a left homology arm homologous to the 5' end of the Rosa26 gene is arranged at its left end, and a right homology arm homologous to the 3' end of the Rosa26 gene is arranged at its right end; (2) transfecting the landing pad vector obtained in step (1) and the above-mentioned lentiviral vector into a CHO-K1 cell line; (3) Obtain a CHO-K1 cell line in which the landing pad vector is integrated into the Rosa26 site of the genome through the resistance screening described in step (1).

[0011] In a preferred embodiment, the sequence of the left homology arm in step (1) is shown as bp 1-1784 of SEQ ID NO.51: the sequence of the right homology arm is shown as bp 1785-2643 of SEQ ID NO.51.

[0012] In another preferred embodiment, the loxP element A and loxP element B in step (1) are respectively selected from one of wild-type loxP, lox2272, lox511, and lox5171.

[0013] In another preferred embodiment, the resistance gene element in step (1) is the blasticidin S gene.

[0014] Fourth, the present invention provides a CHO-K1 engineered cell strain with a landing carrier vector integrated at the Rosa26 site of the genome, wherein the structure of the landing carrier vector is loxP-BSD-lox5171-PGK-FRT. Wherein, loxP is the abbreviation of Locus of X-overP1, which is a 34bp sequence located in the P1 bacteriophage, and is composed of two 13bp reverse palindromic sequences and an 8bp intermediate spacer sequence (5'-ATAACTTCGTATA-GCATACAT-TATACGAAGTTAT-3'), the reverse palindromic sequence is the recognition and binding region of the Cre recombinase, the spacer sequence determines the direction of the loxP sequence, and when there are two loxP sites in the cell genome, the Cre recombinase will induce the sequence between the two loxP sites to recombine. In addition to the wild-type loxP, lox2272, lox511, and lox5171 are also common; BSD is blasticidin resistance, PGK is a promoter, and FRT is the recognition site of the Flp recombinase.

[0015] Fifth, the present invention provides a method for obtaining a target gene integrated into the Rosa26 locus of the genome by using the CHO-K1 engineered cell line having a landing carrier vector integrated into the Rosa26 locus of the genome, the method comprising the following steps: (1) Construction of a Cre / loxP gene editing vector containing the target gene, loxP element, and resistance selection gene; (2) transfecting the Cre / loxP gene editing vector obtained in step (1) into the above-mentioned CHO-K1 engineering cell line; (3) Obtain CHO-K1 engineered cells with the target gene integrated into the Rosa26 site of the genome through the resistance screening described in step (1).

[0016] In a preferred embodiment, the target gene expression product is a glycoprotein, a protective antigen, a tumor antigen, an enzyme or a viral structural protein.

[0017] In a preferred embodiment of the present invention, the target genes are genes encoding human glycoproteins B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ.

[0018] Finally, the present invention provides a CHO-K1 engineered cell strain having a humanized glycosylation pattern, wherein the genome of the CHO-K1 engineered cell strain is integrated with the coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ.

[0019] In a preferred embodiment of the present invention, the coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ are integrated into the Rosa26 site of the genome of the CHO-K1 engineered cell line.

[0020] In a more preferred embodiment of the present invention, the coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ are sequentially connected in series.

[0021] In a specific embodiment of the present invention, the CHO-K1 engineered cell line with a humanized glycosylation pattern is constructed by using the above-mentioned method of integrating the target gene into the Rosa26 site of the genome by integrating the landing carrier vector into the Rosa26 site of the genome of the CHO-K1 engineered cell line.

[0022] The present invention constructs a targeted CHO cell engineering strain, and on this basis, uses the Cre enzyme-mediated cassette exchange technology to achieve the cyclic insertion of multiple glycosyltransferase genes. The present invention first considers overexpressing α 2,3 sialyltransferase in CHO-K1 cells. Before the sugar chain is sialylated, the terminal glycosylation modification of the sugar chain is galactose. Therefore, increasing the proportion of galactose modification can increase the sialylation modification to a certain extent. Because among the isozymes of galactosyltransferase, β1,4 galactosyltransferase (B4GALT1) contributes the most to galactosylation, the present invention simultaneously overexpresses B4GALT1 when transforming CHO cells. Since most of the mannose on the original sugar chain is removed during the transport of glycoproteins in the endoplasmic reticulum and the Golgi apparatus, and then galactose is added first, and then sialic acid is added on this basis, the present invention connects the glycosyltransferases in such an order to construct an overexpression plasmid connected with B4GALT1 (β1,4 galactosyltransferase 1), ST6GAL1 (sialyltransferase), ST3GAL4 (β-galactoside α2-3 sialyltransferase), and GnTⅢ (N-acetylglucosamine transferase Ⅲ), and then uses the Cre enzyme-mediated cassette exchange technology to site-specifically integrate the constructed plasmid into the Rosa26 site of CHO-K1. Among them, the protein levels of the glycosyltransferase integrated by clone 3 of the site-specific integration of pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ were overexpressed, and a monoclonal cell line that can stably express and genetically produce uniform glycoforms was obtained, which can be used to improve the stability and efficacy of glycoprotein drugs.

[0023] The landing pad vector provided by the present invention, and the CHO-K1 engineered cell strain with the above-mentioned landing pad vector integrated at the Rosa26 site of the genome, can not only use the Cre / loxP system to insert single or multiple glycosyltransferase genes of modified glycoprotein drugs at any time, thereby improving the stability and efficacy of glycoprotein drugs; the gene of a specific recombinant glycoprotein can also be accurately site-specifically integrated into the Rosa26 safe site of the engineered cell, and glycoprotein drugs with relevant characteristics can be quickly obtained, greatly shortening the drug research and development cycle; the structural protein gene of the virus can also be site-specifically integrated into the engineered cell, so that it is expressed in the cell and assembled into virus-like particles, which have similar structure and immunogenicity to natural viruses but are not infectious, and are used to produce vaccines; and the specific antigen gene of the pathogen can be site-specifically integrated into the engineered cell, so that it expresses and secretes specific antigen proteins, which are used to produce subunit vaccines; and the patient's tumor cell gene can be sequenced to determine tumor-specific antigens, and personalized vaccines targeting these specific antigens can be produced using the engineered cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Design of gRNA and detection of target efficiency; Figure 2 Flow chart for site-specific integration of the landing pad vector into the Rosa26 locus; Figure 3 To construct cell validation for site-specific integration landing pad; Figure 4 The constructed plasmid map of pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ; Figure 5 This is the restriction enzyme verification diagram of the constructed pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ plasmid; Figure 6 Schematic diagram of landing pad vector construction, pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ overexpression plasmid construction and Cre / lop recombination; Figure 7 Verification of the genomic level for site-directed integration of pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ; Figure 8 Verification of the mRNA level of site-directed integration of pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ; Fig. 9 Verification of protein levels of site-directed integration of pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ. DETAILED DESCRIPTION

[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation on the scope of protection defined by the claims of the present invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0027] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0028] Example 1. Construction of cells for site-specific integration of landing pad vectors In cells, the landing pad of the targeted integration vector is mainly used for precise gene editing. It is like a "locator" that provides a specific, predetermined integration site for gene editing tools (such as the CRISPR-Cas system), so that the target gene can be accurately inserted into a specific location in the genome, avoiding the potential risks of random integration, such as the destruction of normal gene function. The Landing Pad is used for homologous recombination based on the genomic sequence of the cutting site after the CRISPR-Cas system performs a targeted cutting. This technology can achieve the targeted integration of the target gene into a specific location in the genome.

[0029] 1. Determination of CHO-K1 Rosa26 Sequence Since the Rosa26 sequence of CHO-K1 cells (purchased from ATCC cell bank) is unknown, we need to first determine the sequence of Rosa26 (currently, the Rosa26 site has been determined to be non-functional in cells of various species, and gene integration at this site does not affect the normal gene function of the cell, so we also selected this safe site in hamster cells). We found the mouse Rosa26 (Genbank ID: 14910) sequence based on the NCBI website, and divided it into multiple segments using the mouse Rosa26 sequence as a reference, and designed corresponding primers for each sequence. Then, the genome of CHO-K1 cells was extracted using a DNA extraction kit as a template, and PCR amplification was performed in segments using the designed primers, and the amplified products were directly sent for sequencing. Using SnapGENE software, the obtained sequencing results were compared and analyzed with the mouse genome sequence. The comparison results showed that most of the sequence homology between the two was above 90%, so it was considered that the measured sequence was the Rosa26 sequence of CHO-K1 (as shown in SEQ ID NO.51).

[0030] 2. Screening and verification of gRNA After determining the Rosa26 sequence of CHO-K1, two gRNAs were designed based on the determined sequence: gRNA1: CTGGGTACGATTCGTACGC (SEQ ID NO.1); gRNA2: GCTCACGTCTCGTCGCTGAT (SEQ ID NO. 2).

[0031] Since we need to use gRNA to identify the target gene sequence in the future to guide the Cas9 protein to effectively cut the DNA double strand, we need to select gRNA with high cutting efficiency before using CRISPR-Cas9 gene editing technology. Therefore, we use the NK activation receptor NKp46 gRNA-specific upstream primer mNKp46_g1F and gRNA universal downstream primer gRNA-R, and use the artificially synthesized gRNA universal template DNA fragment (DNA template in the gRNA efficiency detection kit) as a template.

[0032] The obtained gRNA was mixed with Cas9 nuclease and target DNA (DNA fragment containing the gRNA end sequences amplified from the CHOK1 cell genome) and incubated. The total reaction system (20 μL) was in accordance with the reaction system table 1. The reaction solution was mixed and incubated at 37°C for 30 min and 65°C for 5 min.

[0033] Table 1. gRNA in vitro target efficiency detection system

[0034] The reaction product was subjected to agarose gel electrophoresis. The band size and fragment grayscale were observed to determine the cutting efficiency. Figure 1 As shown, gRNA2 has a higher cutting efficiency (by comparing the brightness at the size of the gRNA-cut template DNA, it is found that the brightness of the DNA cut by gRNA2 is lower than that of gRNA1, indicating that gRNA2 has a higher cutting efficiency).

[0035] 3. Construction of LentingV2 vector containing Cas9 protein and gRNA LentiCRISPRV2 vector (containing Cas9 protein) (Addgene, Plasmid #52961, see Sanjana et al Nat Methods. 2014 Aug;11(8):783-4. doi: 10.1038 / nmeth.3047.), after the vector is digested with BsmBI restriction endonuclease, a pair of oligonucleotide fragments formed by annealing of the designed gRNA2 can be connected to the gRNA scaffold of the vector.

[0036] 3.1. Enzyme digestion and dephosphorylation of LentiCRISPRV2 vector: Digestion with BsmBI at 37°C for 30 min.

[0037] Table 2. Enzyme digestion system

[0038] After the enzyme digestion, agarose gel electrophoresis was used to recover and purify the large fragment.

[0039] 3.2. Oligo phosphorylation and annealing to double-stranded DNA According to the 5' end of the gRNA sequence, the homologous sequence after BsmBI digestion was introduced, and the single-stranded forward and reverse sequences were synthesized by BGI. Phosphorylation and annealing into double-stranded DNA were performed according to the system in the table below.

[0040] Table 3. Oligo phosphorylation and annealing to double-stranded DNA system

[0041] Oligo phosphorylation and annealing to double-stranded DNA reaction program: 37℃, 30min, 95℃, 5min, 95℃ to 25℃, 5℃ / min. The annealed product was diluted 1:200 in sterile water.

[0042] 3.3. Ligation reaction Table 4. Connection system

[0043] 3.4. Conversion After the connection is completed, 100 μL of Trans10 competent cells are added to the connection system. After an ice bath for 30 minutes, heat shock is performed in a 42°C metal water bath for 30 seconds. After the end, ice bath is performed again for 5 minutes. Then, 500 μL of antibiotic-free LB medium is added, and the plate is shaken in a 37°C shaking incubator for 1 hour. All the bacterial liquid is spread on a solid LB culture plate containing ampicillin resistance. After culturing in a 37°C incubator for 12-16 hours, a single colony is selected for expansion and culture, and the plasmid is extracted to obtain the LentiCRISPRV2-gRNA2 plasmid, which is subsequently transfected into CHO cells together with the constructed landing pad vector.

[0044] 4. Construction of Landing Pad vector and transfection and verification of site-specific integration cells According to the CHO-K1 Rosa26 gene sequence, the sequences on both sides of the gRNA target site (since the gRNA was designed based on the measured CHO-K1 Rosa26 gene sequence, the sequences on both sides of the gRNA target site on the Rosa26 sequence were selected) were selected as the left and right homology arms (left homology arm LHA (SEQ ID NO.51 1-1784 bp): right homology arm RHA (SEQ ID NO.51 1785-2643 bp). PCR amplified the kanamycin resistance gene (EU360687.1), and the PCR product was recovered by an agarose gel recovery kit. PCR amplified the left and right homology arms at both ends of the Cas9 cleavage Rosa26 site ( Figure 2 Left), respectively placed at both ends of the landing rack (loxP-BSD-lox5171-PGK-FRT), to obtain the targeting vector (LentiCRISPRV2-gRNA2 vector and landing rack vector ( Figure 2 In the middle), the two vectors are used together and subsequently transfected simultaneously. The landing platform vector contains various gene elements, such as loxP recognition sites, resistance genes, etc., among which loxP is the abbreviation of Locus of X-overP1, which is a 34bp sequence located in the P1 phage, composed of two 13bp inverse palindromic sequences and an 8bp intermediate spacer sequence. The inverse palindromic sequence is the recognition and binding region of the Cre recombinase, and the spacer sequence determines the direction of the loxP sequence. When there are two LoxP sites in the cell genome, the Cre recombinase will induce the sequence between the two loxP sites to recombine. In addition to the wild-type loxP, lox2272, lox511, and lox5171 are also common; BSD is blasticidin resistance, PGK is a promoter, and FRT is the recognition site of the Flp recombinase. Figure 2 It is a flow chart for site-specific integration of the landing pad vector into the Rosa26 site, and the arrows indicate the positions of primers designed when the landing pad is integrated into the Rosa26 site.

[0045] When stably transfecting landing pad cells CHO-K1, first inoculate the cells at a certain concentration into a 10cm×10cm small dish. After 24 hours, the precipitate after cell digestion and centrifugation is mixed with LentiCRISPRV2-gRNA2 and landing pad plasmid by pipetting with the prepared electroporation solution, and then added to the electroporation cup. Gently shake to remove bubbles, put it into the electroporator and set the program for electroporation. After electroporation, immediately add DMEM culture medium and mix well, then transfer to the culture dish. After 24 hours, use Blasticidin S HCl for pressure screening, and then inoculate the cells into a 96-well plate at 1.5 cells / well by limiting dilution method. Add 130μL culture medium to each well. After 10 days of static culture in the incubator, observe the grown single cell clusters under a microscope to obtain stably transfected monoclonal cells. Then, when the monoclonal cells are expanded and cultured to fill the six-well plate, the genome of the monoclonal cells is extracted using the genome extraction kit DNeasy Blood & Tissue Kit (50) (REF 69504). Verify whether the landing pad has been successfully integrated. The extracted genome is used as a template and primers for key elements are designed according to the landing pad. The primer sequences are shown in Table 5: Primers for verifying the BSD element on the landing pad, as well as primers designed at both ends of the left end of the left homologous arm of the Rosa26 site of CHO-K1 and the right end of the left homologous arm of the landing pad (across the left homologous arm), primers designed at both ends of the right end of the right homologous arm of the Rosa26 site of CHO-K1 and the left end of the right homologous arm of the landing pad (across the right homologous arm), and identified at the genomic level. If both the left and right homologous arms are successfully expressed, it means that the landing pad has successfully undergone homologous recombination and site-specific integration at the Rosa26 site ( Figure 2 right).

[0046] Table 5. Primer sequence information used in PCR reaction

[0047] Table 6. PCR reaction system

[0048] Prepare the PCR reaction system according to Table 6, use the extracted monoclonal genome as a template, put the prepared system into the PCR reaction instrument, and the reaction program is: 95℃, 3min; (95℃30sec, 58℃30sec, 72℃1min)×34cycles; 72℃1min, and store at 4℃ for later use.

[0049] After the reaction, the PCR products were separated and identified by agarose gel electrophoresis. Figure 3As shown in the figure, the selected monoclonal cells 1-9 have successfully integrated the landing pad. Therefore, the cell line with site-specific integration of the landing pad was successfully constructed using CRISPR / Cas9 technology.

[0050] Example 2. Construction of site-specific integration of glycosyltransferase cells 1. Construction of glycosyltransferase overexpression plasmid 1.1. Retrieval of glycosyltransferase genes 1.1.1. RNA was extracted from human 293FT cells using the isopropanol method.

[0051] 1.1.2. Reverse transcription of RNA from 293FT cells 1.1.2.1. Prepare the reverse transcription system (Table 7), place it in a 96-well PCR instrument, and set the reaction conditions as follows: 25°C, 10 min; 37°C, 120 min; 85°C, 5 min; 4°C, set aside.

[0052] Table 7. Reverse transcription reaction system

[0053] 1.1.3. Primer design. Amplification primers were designed based on the gene sequences of the CDS region of 4GALT1 (Genbank ID: 2683), ST6GAL1 (Genbank ID: 6480), GnTⅢ (Genbank ID: 4248), and ST3GAL4 (Genbank ID: 6484). Since we needed to use the Cre / loxP-mediated cassette exchange technology, we needed to construct the target gene on the pGS31K vector (synthesized by Beijing Liuhe BGI Gene Technology Co., Ltd.) containing the loxP element to achieve site-specific integration of the gene. However, this vector did not have P2A and promoter, so we needed to use the intermediate vector pcDNA3.1 to add P2A (sequence as shown in SEQ ID NO.52, function: when the ribosome translates to the P2A sequence, it will trigger the breakage of the polypeptide chain, and then continue to translate the next protein, that is, to separate the two different genes) and CMV promoter to amplify the glycosyltransferase gene. The specific primer names and sequences are shown in Table 8.

[0054] Table 8. Primer sequence information used in PCR reaction

[0055] 1.1.4. PCR reaction system and reaction conditions RNA was extracted from human 293FT cells and reverse transcribed to obtain cDNA as a template. The primers were the primers for regulating the gene mentioned above. The PCR system was as shown in Table 9. The reaction procedure was: 95°C, 3 min; (95°C 30 sec, 58°C 30 sec, 72°C 1 min) × 34 cycles; 72°C 1 min, and stored at 4°C for later use.

[0056] Table 9. PCR reaction system

[0057] After mixing the prepared PCR reaction system, transfer it to an eight-tube tube and place it in a PCR instrument for reaction. The PCR reaction conditions are shown in Table 9. The PCR product was separated and identified by agarose gel electrophoresis. The correct amplified band was observed in a gel imager, and the correct band was recovered by gel.

[0058] 1.2. pcDNA3.1 double restriction digestion and DNA fragment ligation Prepare the pcDNA3.1 double enzyme digestion system according to Table 10, place it in a 37℃ incubator and incubate it for 3-4h. After the digestion is completed, run the digestion product on agarose gel electrophoresis to observe whether the size of the digestion band is correct. If the size is correct, perform gel recovery. Then seamlessly connect the gel-recovered vector fragment and the amplified glycosyltransferase gene fragment. The connection system is shown in Table 11. Incubate the configured connection system in a metal water bath at 50℃ for 15min to connect the digestion vector with the amplified fragment.

[0059] Table 10. Double enzyme digestion system

[0060] Table 11. Seamless connection system

[0061] 1.3. Transformation of recombinant glycosyltransferase plasmid and colony PCR verification After the seamless connection is completed, add 100 μL of Trans10 competent cells to the connection system, ice bath for 30 minutes, heat shock in a 42°C metal water bath for 30 seconds, and then ice bath for 5 minutes. Then add 500 μL of antibiotic-free LB culture medium and shake in a 37°C shaking incubator for 1 hour. Take all the bacterial liquid and spread it on a solid LB culture plate containing ampicillin resistance, and place it in a 37°C incubator for 12-16 hours.

[0062] After overnight culture, it was found that a positive E. coli monoclone had grown successfully on the solid LB culture plate. Then use tweezers to pick up the small white gun tip and pick up 4 positive E. coli monoclones on the solid culture plate in 1mL LB culture medium containing ampicillin resistance, and then shake in a shaking incubator for 4-6h. Then prepare the reaction system according to the bacterial solution PCR in Table 6, take 1μL of bacterial solution in the bacterial culture tube as the PCR template, shake and mix, and place it in the PCR reactor. The reaction program is: 95℃, 3min; (95℃30sec, 58℃30sec, 72℃1 min)×34cycles; 72℃1 min, 4℃ for storage. After the PCR is completed, take the PCR product for agarose gel electrophoresis identification.

[0063] 1.4. Sequencing and restriction enzyme digestion identification of recombinant glycosyltransferase plasmid According to the electrophoresis results, the bacterial solution with the correct band was sent to a biological company for sequencing. The sequencing results were compared, and the plasmid with the correct sequencing was returned for transformation and amplification to obtain the recombinant glycosyltransferase plasmid, and enzyme digestion identification was performed to further verify the correctness of the constructed plasmid.

[0064] 1.5. Construction of plasmids with multiple glycosyltransferases linked together (same as above) Primers were designed by overlapping PCR technology, and the successfully constructed pcDNA3.1-B4GALT1, pcDNA3.1-ST6GAL1, pcDNA3.1-ST3GAL4, and pcDNA3.1-GnTⅢ plasmids were used as templates to amplify the corresponding fragments by PCR. Then, the overlapping PCR method was used to first use the amplified B4GALT1 and ST6GAL1 fragments as templates to obtain the B4GALT1-ST6GAL1 connected fragment, and then the B4GALT1-ST 6GAL and ST3GAL4 were used as templates to obtain the B4GALT1-ST6GAL1-ST3GAL4 connected fragment. Finally, B4GALT1-ST6GAL1-ST3GAL4 and GnTⅢ were used as templates to obtain the B4GALT1-ST6GAL1-ST3GAL4-GnTⅢ connected fragment. Then, it was connected to the restriction fragment of pGS31K plasmid (plasmid from our laboratory) containing loxP elements by seamless ligation. The method used was the same as above. The structure of the constructed plasmid is shown in the figure. Figure 4As shown in the figure, the constructed plasmid contains lox elements for subsequent cassette exchange, CMV promoters that promote transcription and translation of glycosyltransferase genes, and the resistance gene puromycin, which is often used to screen cells that can express the pac gene (puroR) and KanR sequence (the gene was originally derived from Escherichia coli and is a gene that can produce antibiotic resistance. Its full name is kanamycinresistance gene, referred to as KanR gene). KanR gene has the characteristics of antibiotic resistance and can make bacteria resistant to antibiotics such as kanamycin. Plasmid restriction enzyme cutting verification is as follows Figure 5 As shown, using the constructed plasmid as a template, a 20 μL system was prepared, with 1 μg of plasmid, 2 μL of cutsmart buffer, 0.5 μL of the corresponding enzyme, and the rest was made up with water. The solution was placed in a 37°C water bath for 1 h, 4 μL of 6×loading Buffer was added, and nucleic acid electrophoresis was performed after mixing. The first lane was cut with BamHI enzyme, the second lane was cut with NotI and XbaI, and the third lane was cut with NotI and AgeI. The figure on the left is the expected bands predicted by snapGene based on the expected vector structure and the corresponding enzymes were added. The actual bands were consistent with the expectations, indicating that the plasmid was constructed correctly.

[0065] 2. Construction of pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ overexpression cells The plasmid pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ constructed above for overexpression of glycosyltransferase was transfected into clone cell 2 based on the site-directed integration landing pad modified in Example 1 using FuGENE HD liposome (Promega, 100000068) (under the action of Cre enzyme, the exchange between lox5171 and loxP elements was achieved, such as Figure 6 As shown), a single clone of cells with site-specific integration (replacing the BSD element, i.e., integrating at the previous BSD position) of pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ was obtained.

[0066] 2.1. Verification of site-specific integration of glycosyltransferases in monoclonal cell genomes According to the above method, the genome of the monoclonal cell with site-directed integration of pGS31K-B4GALT1-ST6GAL-ST3GAL4-GnTⅢ was extracted, and relevant primers were designed to verify whether the cloned cells successfully integrated the glycosyltransferase at the genome level. The primers are shown in Table 12: Table 12. Primer sequence information used in PCR reaction

[0067] The PCR reaction system was prepared according to Table 6 above, and PCR amplification was performed. After the reaction, the products were separated and identified by agarose gel electrophoresis. The results are as follows: Figure 7 As shown, all clones transfected with pGS31K-B4GALT1-ST6GAL-ST3GAL4 had successfully integrated.

[0068] 2.2. Verification of monoclonal cells with site-specific integration of glycosyltransferase at the mRNA level 2. 2. 1. Design primers based on the glycosyltransferase gene sequence for real-time fluorescence quantitative PCR reaction. The specific primer names and sequences are shown in Table 13.

[0069] Table 13. Primer sequence information used in qPCR reactions

[0070] 2.2.2. qRT-PCR reaction system and conditions The RNA of cloned cells with site-specific integration of glycosyltransferase was extracted by isopropanol method, and the cDNA obtained by reverse transcription was used as a template. qRT-PCR was performed using the following system and reaction procedure: Use TOYOBO's THUNDERBIRDTM SYBR qPCR Mix Without ROX Kit and prepare the reaction system according to the instruction manual as follows (Table 14).

[0071] Table 14. qRT-PCR reaction system

[0072] The qRT-PCR reaction system was prepared according to the system shown in Table 14, and after being fully mixed, it was added to a 96-well PCR plate and placed in a real-time fluorescence quantitative PCR instrument for reaction. The PCR reaction conditions were as follows: pre-denaturation at 95°C for 3 min; (denaturation at 95°C for 10 s, annealing and extension at 60°C for 30 s) × 39 cycles.

[0073] Three replicate wells were set for each sample, with GAPDH as the internal reference gene. After the qPCR reaction was completed, the average Ct value of the three replicate wells of the target gene in each sample was taken as the final result. The relative expression of each target gene was calculated as 2^-△Ct, where △Ct = Ct (target gene) - Ct (internal reference gene).

[0074] qRT-PCR was used to detect the transcription levels of various glycosyltransferase genes in the site-specifically integrated pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ monoclonal cells. Figure 8 As shown, compared with CHO cells without site-specific integration of glycosyltransferase (NC in the figure, i.e., empty cells), the mRNA levels of various glycosyltransferase genes in the site-specific integration pGS31K- B4GALT1-ST6GAL-ST3GAL4-GnTⅢ monoclonal cells were significantly increased, with the mRNA level of B4GALT1 increased by about 30,000 times, ST6GAL1 increased by about 30,000 times, ST3GAL4 increased by about 40,000 times, and GnTⅢ increased by about 50,000 times (P<0.0001).

[0075] 2.3. Verification of monoclonal cells with site-specific integration of glycosyltransferase at the protein level The protein samples were quantified using the BCA assay kit, and the SDS-PAGE gel of appropriate concentration was prepared according to the verified protein molecular weight. According to the protein quantification results, a certain amount of protein sample was mixed with 6× SDS loading buffer according to a certain volume and placed in a 100℃ water bath and boiled for 5min. Then the denatured protein sample was loaded into the sample well of the SDS-PAGE gel, and the sample was first run at 80V for 30min to make the sample condense into a straight line in front of the separation gel, and then electrophoresis was performed at 120V. After separation to the appropriate position according to the protein marker, the electrophoresis was stopped. Then the protein on the gel was transferred to the PVDF membrane, and the PVDF membrane was first activated by soaking it in anhydrous methanol for 3min, and the filter paper was soaked in 1× transfer buffer. From bottom to top, there were three layers of filter paper, protein gel, PVDF membrane, and three layers of filter paper. During the placement process, it was important to drive away bubbles and transfer the membrane at 100V for 70min. After the transfer, the PVDF membrane was blocked with 5% skim milk for 1h or blocked overnight at 4℃. Then, the PVDF membrane was incubated with an appropriately diluted primary antibody for 1 hour. After the primary antibody incubation, it was washed three times with PBST buffer, each time for 10 minutes. After washing, the PVDF membrane was incubated with the corresponding diluted secondary antibody for 1 hour. After the incubation, it was washed three times with PBST buffer, each time for 10 minutes. After that, the incubated PVDF membrane was developed with an ECL color development kit (the luminescent liquid was configured according to a 1:1 ratio of liquid A and liquid B), and imaging was performed using a chemiluminescence imager.

[0076] The imaging results are as follows Fig. 9As shown, the protein levels of glycosyltransferases integrated by clone3 of site-directed integration of pGS31K-B4GALT1-ST6GAL—ST3GAL4-GnTⅢ were all overexpressed. Compared with the control group, the protein expression of B4GALT1 increased by 40 times, the expression of ST6GAL1 increased by 50 times, the expression of ST3GAL4 increased by 1.7 times, and the expression of GnTⅢ increased by more than 3 times. The above results show that B4GALT1, ST6GAL, ST3GAL4, and GnTⅢ were successfully site-directedly integrated at the Rosa26 site of CHO-K1, and a monoclonal cell line with stable expression and inheritance was obtained.

Claims

1. A gRNA, characterized in that The gRNA targets and recognizes the Rosa26 gene site in the CHO-K1 cell genome.

2. The gRNA according to claim 1, characterized in that The sequence of the gRNA is shown in SEQ ID NO.

2.

3. A lentiviral vector containing the gRNA according to claim 1 or 2, characterized in that The lentiviral vector also contains a gene encoding the Cas9 protein and a gRNA scaffold element.

4. A method for integrating the lentiviral vector of claim 3 into a landing carrier vector at the Rosa26 gene site of the CHO-K1 cell genome, characterized in that: The method comprises the following steps: (1) constructing a landing pad vector containing a homology arm of the Rosa26 locus, wherein the landing pad vector has a structure of loxP element A-resistance gene element-loxP element B-PGK-FRT, a left homology arm homologous to the 5' end of the Rosa26 gene is arranged at its left end, and a right homology arm homologous to the 3' end of the Rosa26 gene is arranged at its right end; (2) transfecting the landing pad vector obtained in step (1) and the lentiviral vector according to claim 3 into a CHO-K1 cell line; (3) Obtain a CHO-K1 cell line in which the landing pad vector is integrated into the Rosa26 site of the genome through the resistance screening described in step (1).

5. The method according to claim 4, characterized in that The sequence of the left homology arm in step (1) is shown as 1-1784 bp of SEQ ID NO.51: the sequence of the right homology arm is shown as 1785-2643 bp of SEQ ID NO.

51.

6. The method according to claim 4, characterized in that In step (1), the loxP element A and loxP element B are selected from wild-type loxP, lox2272, lox511, and lox5171, respectively.

7. The method according to claim 4, characterized in that The resistance gene element in step (1) is the blasticidin S gene.

8. A CHO-K1 engineered cell line with a landing carrier vector integrated into the Rosa26 locus of the genome, characterized in that: The structure of the landing gear carrier is loxP-BSD-lox5171-PGK-FRT.

9. A method for obtaining a target gene integrated into the Rosa26 locus of the genome using the CHO-K1 engineered cell line of claim 8, characterized in that: The method comprises the following steps: (1) Construction of a Cre / loxP gene editing vector containing the target gene, loxP element, and resistance selection gene; (2) transfecting the Cre / loxP gene editing vector obtained in step (1) into the CHO-K1 engineered cell line described in claim 8; (3) Obtain a CHO-K1 engineered cell line with the target gene integrated into the Rosa26 locus of the genome through the resistance screening described in step (1).

10. The method according to claim 9, characterized in that The expression product of the target gene is glycoprotein, protective antigen, tumor antigen, enzyme or virus structural protein.

11. A CHO-K1 engineered cell line having a humanized glycosylation pattern, characterized in that: The genome of the CHO-K1 engineered cell strain is integrated with the coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ.

12. The CHO-K1 engineered cell line with a humanized glycosylation pattern according to claim 11, characterized in that: The coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ are integrated into the Rosa26 site of the genome of the CHO-K1 engineering cell line.

13. The CHO-K1 engineered cell line with a humanized glycosylation pattern according to claim 12, characterized in that: The coding genes of B4GALT1, ST6GAL1, ST3GAL4 and GnTⅢ are sequentially connected in series.

Images