Method for creating and application of Xa5 excellent allele for improving resistance of rice to bacterial blight

Abstract

The present invention belongs to the field of modern agricultural technologies, and particularly relates to a method for creating excellent Xa5 alleles for improving the resistance of rice to bacterial blight and its application. The present invention has first discovered four Xa5 alleles that can improve the resistance of rice to bacterial blight, and provided biological materials for creating rice varieties with high resistance to bacterial blight. Experimental results show that using the four alleles of the present invention can reduce the length of leaf lesions infected by bacterial blight pathogen by 59.4% - 81.6%, providing gene resources and technical approaches for rice disease-resistant breeding, and having important breeding utilization value.

Description

Technical Field

[0001] The present invention belongs to the technical field of modern agriculture, and particularly relates to a method for creating and applying excellent Xa5 alleles for improving rice resistance to bacterial blight. Background Art

[0002] Rice (Oryza sativa) is a major food source for people's survival and is one of the main food crops in China. Bacterial blight (BB) is a disease caused by Xanthomonas oryzae pv. oryzae ( Xanthomonas oryzae pv.oryzae , Xoo). In severe cases, it can cause rice plants to wither and even result in no harvest at all. Therefore, rice bacterial blight is an important disease that seriously hinders the improvement of rice yield and quality.

[0003] There are various TAL effectors (Transcription activator-like effectors, TALE) in Xanthomonas oryzae pv. oryzae, which can enter rice through the type III secretion system and induce the expression of target genes in rice. The activation of the expression of some target genes by TALE requires the participation of the XA5 protein. Among the currently discovered genes resistant to bacterial blight, the rice recessive gene xa5 is a disease-resistant gene with broad-spectrum resistance to bacterial blight.

[0004] CRISPR / Cas9 is one of the most popular gene editing tools at present. The guide RNA (gRNA) is used to guide the Cas9 enzyme to the target DNA sequence. The Cas9 enzyme cuts the DNA double strand, and then gene editing is achieved through the cell's own DNA repair mechanism (such as non-homologous end joining NHEJ or homologous recombination repair HDR). Prime Editing (PE) is a new gene editing tool developed based on the CRISPR / Cas9 system. The PE technology fuses the Cas9 nickase with the reverse transcriptase and uses a special prime editing guide RNA (pegRNA) to achieve precise editing of the target DNA sequence. Compared with traditional editing technologies such as Zinc Finger Nucleases (ZFN) and Transcription Activator-Like Effector Nucleases (TALEN), it has the advantages of higher efficiency, stronger specificity, simpler operation, and richer editing types. Summary of the Invention

[0005] In view of the above technical problems, the present invention provides excellent Xa5 alleles that can improve rice resistance to bacterial blight and corresponding creation methods.

[0006] The objective of the first aspect of the present invention is to provide the Xa5 allele conferring resistance to bacterial blight in rice.

[0007] The objective of the second aspect of the present invention is to provide an sgRNA for preparing the Xa5 allele conferring resistance to bacterial blight in rice.

[0008] The objective of the third aspect of the present invention is to provide a pegRNA for preparing the Xa5 allele conferring resistance to bacterial blight in rice.

[0009] The objective of the fourth aspect of the present invention is to provide an editing vector for creating rice resistant to bacterial blight.

[0010] The objective of the fifth aspect of the present invention is to provide a kit for creating rice resistant to bacterial blight.

[0011] The objective of the sixth aspect of the present invention is to provide the application of the allele of the first aspect of the present invention, the sgRNA of the second aspect of the present invention, the pegRNA of the third aspect of the present invention, and / or the editing vector of the fourth aspect of the present invention in the preparation of products for breeding rice resistant to bacterial blight or improving the resistance of rice germplasm resources to bacterial blight.

[0012] The objective of the seventh aspect of the present invention is to provide a method for cultivating rice resistant to bacterial blight.

[0013] In order to achieve the above objectives of the present invention, the technical solutions adopted are as follows:

[0014] The first aspect of the present invention provides an Xa5 allele conferring resistance to bacterial blight in rice (the sequence of the first exon of the Xa5 gene), and the Xa5 allele is as shown in any one of SEQ ID NO: 20, 22, 25, and 26.

[0015] In some embodiments of the present invention, for the allele with the sequence as shown in SEQ ID NO: 20, a T base is inserted at the 123rd position of the Xa5 original sequence (SEQ ID NO: 19).

[0016] In some embodiments of the present invention, for the allele with the sequence as shown in SEQ ID NO: 21, a G base is inserted at the 123rd position of the Xa5 original sequence (SEQ ID NO: 19).

[0017] In some embodiments of the present invention, for the allele with the sequence as shown in SEQ ID NO: 25, the TC at the 116 - 117th positions of the Xa5 original sequence (SEQ ID NO: 19) mutates to AG.

[0018] In some embodiments of the present invention, for the allele with the sequence as shown in SEQ ID NO: 26, the T at the 116th position of the Xa5 original sequence (SEQ ID NO: 19) is mutated to A.

[0019] The second aspect of the present invention provides an sgRNA for preparing the rice bacterial blight-resistant Xa5 allele, and the nucleotide sequence of the sgRNA is as shown in SEQ ID NOs: 1 to 3.

[0020] In some embodiments of the present invention, the sgRNA with the sequence as shown in SEQ ID NO: 1 is used for single-site gene editing.

[0021] In some embodiments of the present invention, the sgRNAs with the sequences as shown in SEQ ID NOs: 2 and 3 are used for two-site gene editing.

[0022] The third aspect of the present invention provides a pegRNA for preparing the rice bacterial blight-resistant Xa5 allele, and the nucleotide sequence of the pegRNA is as shown in SEQ ID NO: 8.

[0023] The fourth aspect of the present invention provides an editing vector for creating bacterial blight-resistant rice; the vector includes the sgRNA described in the second aspect of the present invention and the pegRNA described in the third aspect of the present invention.

[0024] In some embodiments of the present invention, the vector includes a single-site editing vector, a two-site editing vector, and a PE editing vector.

[0025] In some embodiments of the present invention, the plant expression vectors for single-site editing include, but are not limited to, pYLCRISPR / Cas9, pRGEB301, pRGEB302, and pUbi-HyCas9 vectors, etc.

[0026] In some embodiments of the present invention, the plant expression vectors suitable for two-site editing include, but are not limited to, pCAMBIA type vectors, pX458M, pX459M, pHH-hU6-A-gRNA, pHH-hU6-B-gRNA, and plenticrispr-e vectors, etc.

[0027] In some embodiments of the present invention, the plant expression vectors suitable for PE editing include: pPE2, pPE3, and MS2PE system vectors, etc. The fifth aspect of the present invention provides a kit for creating bacterial blight-resistant rice, and the kit includes the sgRNA described in the second aspect of the present invention, the pegRNA described in the third aspect of the present invention, and / or the editing vector described in the fourth aspect of the present invention.

[0028] In some embodiments of the present invention, the kit further comprises at least one of Agrobacterium, buffer, and Cas protein.

[0029] A sixth aspect of the present invention provides the use of the allele of the first aspect of the present invention, the sgRNA of the second aspect of the present invention, the pegRNA of the third aspect of the present invention, and / or the editing vector of the fourth aspect of the present invention in the preparation of products for breeding rice resistant to bacterial blight or improving the resistance of rice germplasm resources to bacterial blight.

[0030] A seventh aspect of the present invention provides a method for cultivating rice resistant to bacterial blight, comprising the following steps:

[0031] Editing the Xa5 gene of rice using the kit described in the fifth aspect of the present invention, and screening for rice having the Xa5 allele described in the first aspect of the present invention.

[0032] In some embodiments of the present invention, the resistance of the rice having the Xa5 allele described in the first aspect of the present invention is improved compared to the reference level; the reference level is wild-type rice.

[0033] In some embodiments of the present invention, the editing system is at least one of the CRISPR / Cas9 system and the PE editing system (Prime Editor, PE).

[0034] In some embodiments of the present invention, further, homozygous mutant plants are selected from the rice having the Xa5 allele described in the first aspect of the present invention to cultivate the T1 generation lines.

[0035] The beneficial effects of the present invention are:

[0036] The present invention has for the first time discovered four Xa5 alleles that can improve the resistance of rice to bacterial blight, and provided biological materials for creating rice varieties with high resistance to bacterial blight. Experimental results show that the use of the four alleles of the present invention can reduce the length of leaf lesions infected by Xanthomonas oryzae pv. oryzae by 59.4% - 81.6%, providing gene resources and technical approaches for rice disease-resistant breeding, and having important breeding utilization value. Description of the Drawings

[0037] The following further describes the present invention in conjunction with the drawings and embodiments, wherein:

[0038] Figure 1 is Xa5Gene sequence and sgRNA information. A: Target site information based on the dual-target system; B: Target site information based on the single-target system; Box: Target sequence; Blue underline: PAM; C: Comparison of the TP309 Xa5 gene target sequence with the designed target sequence.

[0039] Figure 2 It is the pPE expression cassette and pegRNA information. A: Schematic diagram of the pPE expression cassette. The pPE fusion protein is expressed using the themize Ubiquitin 1 promoter and the 35S terminator. NLS, nuclear localization signal. B: Genomic sequence of pegRNA; The expected mutations at the start codon are marked in red underlined; The regions corresponding to the protospacer, PBS, and RT template are indicated in parentheses; PAM is marked with an orange box. C: C: Comparison of the TP309 Xa5 gene target sequence with the designed pegRNA sequence.

[0040] Figure 3 Genetic transformation process of rice materials. A: Callus induction; B: Screening of induced callus; C: Induction of tissue differentiation; D: Rooting of seedlings.

[0041] Figure 4 It is the PCR identification of T0 generation transgenic positive plants based on the CRISPR / Cas9 technology. M: DL 2000 DNA Marker; H2O: Negative control with sterile water as the template; A: Identification of the transformed seedlings of the dual-target system using the hygromycin resistance marker primers HYG-YF / HYG-YR; B: Identification of the transformed seedlings of the dual-target system using the Cas9 vector detection primers Cas9-jc-F3 / Cas9-jc-R3; C-D: Identification of the transformed seedlings of the single-target system using the primers Xa5T-F and Xa5TR primers, where C is the result of the single-target system transformed seedlings numbered 1-18, and D is the result of the single-target system transformed seedlings numbered 19-36.

[0042] Figure 5 It is the PCR identification of T0 generation transgenic positive plants based on the PE technology. M: DL 2000 DNA Marker; H2O: Negative control with sterile water as the template; A: Identification of the TC-AG transgenic seedlings using the hygromycin resistance marker primers OS35SHYG1-F3 / R3; B: Identification of the TC-AG transgenic seedlings using the PE vector detection primers Cas9 H840A-hjc-F1 / R1; C: Identification of the T-A transgenic seedlings using the hygromycin resistance marker primers OS35SHYG1-F3 / R3; D: Identification of the T-A transgenic seedlings using the PE vector detection primers Cas9 H840A-hjc-F1 / R1.

[0043] Figure 6 It is a representative sequencing chromatograph for targeted genome editing. WT; wild type; Editing: edited sequence; the editing is marked with a red box.

[0044] Figure 7 It is the target mutation type of the homozygous mutant line based on the CRISPR / Cas9 technology. Red bold letters: insertion; blue dotted line: deletion; A: target mutation type of the homozygous mutant line of the single-target system; B: target mutation type of the homozygous mutant line of the dual-target system.

[0045] Figure 8 It is the detection of T-DNA-free of transgenic plants edited based on the PE technology. M: DL 2000 DNA Marker; H2O: negative control with sterile water as the template; WT: wild type; A: detection of T-DNA-free of the T1 generation line (PE- Xa5 -1) of the single-target system +G mutation type; B: detection of T-DNA-free of the T1 generation line (PE- Xa5 -2) of the single-target system +T mutation type; C-H: detection of T-DNA-free of the T1 generation line (Cas9-Xa5-3~8) of the dual-target system.

[0046] Figure 9 Detection of T-DNA-free of transgenic plants edited based on the PE technology. M: DL 2000 DNA Marker; H2O: negative control with sterile water as the template; WT: wild type; A: detection of T-DNA-free of the T1 generation line (PE- Xa5 -1) of the T-A mutation type; B: detection of T-DNA-free of the T1 generation line (PE- Xa5 -2) of the T-A mutation type; C: detection of T-DNA-free of the T1 generation line (PE- Xa 5-3) of the TC-AG mutation type; D: detection of T-DNA-free of the T1 generation line (PE- Xa5 -4) of the TC-AG mutation type.

[0047] Figure 10 It is the resistance identification of different editing types of the T1 homozygous editing line. WT: wild type; +T / +G: homozygous editing line based on the single-target system; TC-AG / T-A: homozygous editing line based on the PE editing system; -AAG / -AA / -AA+G: homozygous editing line based on the dual-target system; XOO4 / PXO86 / PXO99A: three physiological races of Xanthomonas oryzae pv. oryzae. Detailed implementation method

[0048] The concept of the present invention and the resulting technical effects will be clearly and completely described below in conjunction with embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts belong to the scope of protection of the present invention.

[0049] For the instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, they are all conventional instruments, reagents, materials, etc. existing in the prior art and can be obtained through regular commercial channels. For the experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, they are all conventional experimental methods, detection methods, etc. in the prior art.

[0050] Experimental materials: Rice: TP309 strain.

[0051] Example 1 Design and detection of sgRNA for Xa5 gene in TP309

[0052] 1. Target site sequence and position of Xa5 gene

[0053] In this example, target sites were designed in the 30 bp region before and after the differential site TC between the Xa5 gene sequence open reading frame (ORF) and xa5 (such as A and B in Figure 1 ). Among them, two target sites G1 and G2 were designed based on the dual-target system, and one target site G3 was designed based on the single-target system. Their lengths were all 20 bp, and the PAMs were TGG, CGG, and TGG respectively. The GC contents were 35%, 50%, and 30%. At the same time, it was found that there were no consecutive 4 or more T bases in these three target site sequences, and the target site sequence and the transcribed sgRNA sequence would not pair continuously. Therefore, the sgRNA expression cassette constructed with this target site has no risk of premature transcriptional termination and generating RNA stem-loop structures.

[0054] Among them, the nucleotide sequence of the sgRNA for single-site editing is: AAGTAGATACCTTATCAAACTGG (SEQ ID NO:1).

[0055] The nucleotide sequence of the sgRNA for double-site editing is:

[0056] CCATTCAAGTTCTTGTCCAGTTT (SEQ ID NO:2);

[0057] CCGGAGCTCGCCATTCAAGTTC (SEQ ID NO:3).

[0058] 2. Detection of Xa5 gene target sites

[0059] Using the TP309 genomic DNA as a template, the upstream fragment of the Xa5 gene was amplified with the target detection primers Xa-KZ-F2 / Xa-KZ-R2 and sequenced. The Snapgene software was used to align with the designed Xa5 target base sequence. The results showed that the base sequence of the Xa5 gene target site of TP309 was consistent with the designed target sequence ( Figure 1 in C). It indicates that the designed target and target adapter primers are applicable to TP309 and the next step can be carried out.

[0060] The sequence of Xa-KZ-F2 is: 5’-CAAAAAGTTTAGGCGCACGC-3’ (SEQ ID NO:4).

[0061] The sequence of Xa-KZ-R2 is: 5’-CCGTCATAGACTAATCACAT-3’ (SEQ ID NO:5).

[0062] Example 2 Design and Detection of Xa5 Gene pegRNA of TP309

[0063] 1. Xa5 Gene pegRNA Sequence and Location

[0064] The Xa5 pegRNA was designed to replace TC with TC-AG or T-A at the differential site TC of Xa5 in the open reading frame (ORF) of the Xa5 gene sequence, so that the 39th amino acid encoded by Xa5 changes from valine to glutamic acid or aspartic acid ( Figure 2 in A, B).

[0065] 2. Detection of Xa5 Gene pegRNA Sequence

[0066] Using the TP309 genomic DNA as a template, the upstream fragment of the Xa5 gene was amplified with the target detection primers Xa-KZ-F4 / Xa-KZ-R2 and sequenced. The Snapgene software was used to align with the designed Xa5 pegRNA base sequence. The results showed that the base sequence of the Xa5 gene target site of TP309 was consistent with the designed pegRNA sequence ( Figure 2 in C). It indicates that the designed pegRNA and target adapter primers are applicable to TP309 and the next experiment can be carried out.

[0067] The sequence of Xa-KZ-F4 is: 5‘-GCTCTTAATTTCAGAGCCTT-3’ (SEQ ID NO:6).

[0068] The Xa-KZ-R4 sequence is: 5'-CCGTCATAGACTAATCACAT-3' (SEQ ID NO:7).

[0069] The nucleic acid sequence of the pegRNA is: TCAAGTTCTTGTCCAGTTTGATAAGGTATCTACTT (SEQ ID NO:8).

[0070] Example 3 Genetic transformation of rice materials, positive detection of T0 generation transgenic plants and analysis of mutation types

[0071] 1. Genetic transformation of rice materials

[0072] Select pCAMBIA1300-Ubi-Cas9 as the single-site editing vector backbone, pCAMBIA1300-OsU6-Cas9 as the two-site editing vector backbone, and PE2-MCP3 as the PE editing vector backbone. Insert the sgRNA and pegRNA into the corresponding vector backbones respectively, and then introduce them into the parent TP309 through the Agrobacterium-mediated genetic transformation method. Rice seeds are treated to induce callus from mature embryos. When the callus reaches more than 95%, the callus is screened through Agrobacterium infection and co-culture. The well-growing resistant callus obtained after screening is induced to differentiate and root ( Figure 3 ). Through the tissue culture and genetic transformation of the mature embryos of the parent TP309, resistant transformed seedlings were obtained.

[0073] 2. Positive detection of T0 generation transgenic plants edited by CRISPR / Cas9 technology and analysis of mutation types

[0074] Among the obtained transgenic seedlings, there may be false positive transgenic seedlings. To exclude this possibility, the DNA of young leaves of transgenic seedlings was extracted, and the hygromycin resistance marker primers HYG-YF (5'-ATGAAAAAGCCTGAACTCACC-3', SEQ ID NO:9) / HYG-YR (5'-CTATTTCTTTGCCCTCGGAC-3', SEQ ID NO:10) and the Cas9 vector detection primers Cas9-jc-F3 (5'-CAGAAAGAGCGAGGAAACCA-3', SEQ ID NO:11) / Cas9-jc-R3 (5'-CCTCAAACAGTGTCAGGGTCA-3', SEQ ID NO:12) were used to perform PCR amplification on the DNA of transgenic seedlings of the dual-target system to screen for foreign genes. The results showed that among the transgenic seedlings of the dual-target system, 13 plants amplified bands with target fragment lengths of 1026 bp and 485 bp, and they were transgenic positive plants; the primers Xa5T-F (5'-GCTCGCGTTCGTTCGTTAAC-3', SEQ ID NO:13) and Xa5T-R (5'-TGCTCTTGACTTGGTTCTCC-3', SEQ ID NO:14) were used to perform PCR amplification on the DNA of transgenic seedlings of the single-target system to screen for foreign genes. Among the transgenic seedlings, 36 plants amplified a band with a target fragment length of 419 bp, and they were transgenic positive plants (Figure 4).

[0075] Target site mutation analysis was performed on the successfully edited transgenic positive rice plants. The results showed that among the obtained T0 generation mutant plants, four mutation types appeared, namely homozygous mutant, double allelic mutant, heterozygous mutant, and wild-type mutant. Among the 13 positive transgenic plants in the T0 generation of transgenic seedlings of the dual-target system, mutations occurred in all of them, and the total mutation rate was 100%. Among them, 6 plants had heterozygous mutations at the target site, and the mutation rate was 46.2%; 7 plants had double allelic mutations, and the mutation rate was 53.8%; among the 36 positive transgenic plants in the T0 generation of transgenic seedlings of the single-target system, 14 plants had mutations, and the total mutation rate was 38.9%. Among them, 4 plants had homozygous mutations at the target site, and the mutation rate was 11.1%; 10 plants had heterozygous mutations, and the mutation rate was 27.8%.

[0076] Table 1 Analysis of target site mutations in the T0 generation

[0077]

[0078] 3. Positive Detection and Mutation Type Analysis of T0 Generation Transgenic Plants Edited by PE Technology

[0079] Extract the DNA of the young leaves of the transformed seedlings, and use the hygromycin resistance marker primers OS35SHYG1-F3 (5’-CCCACTATCCTTCGCAAGACC-3’, SEQ ID NO:15) / R3 (5’-GATCGCATCCATAGCCTCCG-3’, SEQ ID NO:16) and the PE vector detection primers Cas9 H840A-hjc-F1 (5’-cgacctcgacaatctcctcg-3’, SEQ ID NO:17) / R1 (5’-gtagtacgggatgcggaagg-3’, SEQ ID NO:18) to perform PCR amplification on the DNA of the transgenic seedlings to screen for foreign genes. The results showed that among the TC-AG transgenic seedlings, 3 plants amplified bands with the target fragment lengths of 500 bp and 535 bp, which were transgenic positive plants; among the T-A transgenic seedlings, 14 plants amplified bands with the target fragment lengths of 500 bp and 535 bp, which were transgenic positive plants (Figure 5).

[0080] Perform target site mutation analysis on the transgenic positive rice plants. The results showed that among the obtained T0 generation mutant plants, mutations of T-A and TC-AG occurred ( Figure 6 ). Among the 13 positive transgenic plants of the T0 generation of the T-A transgenic positive seedlings, 7 were T-A homozygous mutant plants, and the mutation rate was 53.8%; among the 3 positive transgenic plants of the T0 generation of the TC-AG transgenic positive seedlings, all occurred TC-AG homozygous mutations, and the mutation rate was 100%.

[0081] Example 4: T-DNA-free Detection of T1 Generation Transgenic Plants

[0082] 1. T-DNA-free Detection of Transgenic Plants Edited by CRISPR / Cas9 Technology

[0083] Analysis was carried out on the target sequence mutation types of four homozygous mutant strains in the T0 generation of the single-target system transformed seedlings. It was found that the targets of all mutant plants showed the form of base insertion, the number of base deletions was 1 bp, and the mutation form was single (+T, +G) (A in Figure 7). Subsequently, 30 representative plants were selected from each of the T1 generation lines of the homozygous mutant plants obtained by screening for T-DNA-free detection. Genomic DNA of the mutant plants was extracted from young rice leaves, and the DNA of the double-target system transformed seedlings was PCR amplified using the Cas9 vector detection primers Cas9-jc-F3 (5'-CAGAAAGAGCGAGGAAACCA-3', SEQ ID NO:11) / Cas9-jc-R3 (5'-CCTCAAACAGTGTCAGGGTCA-3', SEQ ID NO:12), and the DNA of the single-target system transformed seedlings was PCR amplified using the primers Xa5T-F (5'-GCTCGCGTTCGTTCGTTAAC-3', SEQ ID NO:13) and Xa5T-R (5'-TGCTCTTGACTTGGTTCTCC-3', SEQ ID NO:14). The obtained PCR products were electrophoretically detected using 1.5% agarose gel. T-DNA-free plants had no vector-specific bands. The results were as follows: In the T1 generation line (+G mutation type, Cas9- Xa5 -1), 14 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 46.7% (A in Figure 8); in the T1 generation line (+T mutation type, Cas9- Xa5 -2), 13 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 43.3% ( Figure 8 B). At the same time, the sequencing results showed that all the plants screened for no exogenous T-DNA were homozygous mutants. Two representative plants were selected from the T0 generation of the heterozygous mutant type of the T0 generation of the double-target system transformed seedlings, and four representative plants were selected from the T0 generation of the double-allele mutant type to obtain their T1 generation lines (Cas9- Xa5 -3 to 8), and 22 representative plants were selected from each for T-DNA-free detection. The results were as follows: In the T1 generation line of the double-allele mutant type, 15 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 17%; in the T1 generation line of the heterozygous mutant type, 9 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 20.5% ( Figure 8(C-H). Analysis of the target sequence mutation types of the T1 generation of the double-target system mutant plants found various mutation forms, including deletions of 2-3 bp bases (-AA, -AAG) and double allelic mutations of deletions and insertions (-A+T, -AA+G) ( Figure 7 in B).

[0084] The specific mutation types are as follows:

[0085] SEQ ID NO:19 (original Xa5 sequence):

[0086] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA.

[0087] SEQ ID NO:20 (insertion of a T base at position 123):

[0088] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA.

[0089] SEQ ID NO:21 (insertion of a G base at position 123):

[0090] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGTCCAGTTGTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0091] SEQ ID NO:22 (missing the three bases AAG at positions 107 - 109 of the original sequence):

[0092] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0093] SEQ ID NO:23 (missing the two bases AA at positions 107 - 108 of the original sequence):

[0094] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0095] SEQ ID NO:24 (Insert a G base at position 96, delete two AA bases at positions 107 and 108 of the original sequence):

[0096] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGGCTCGCCATTCGTTCTTGTCCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0097] SEQ ID NO:25 (TC at positions 116 - 117 of the original sequence is mutated to AG):

[0098] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGAGCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0099] SEQ ID NO:26 (The T at the 116th position of the original sequence is mutated to A):

[0100] ATGGCCACCTTCGAGCTCTACCGGAGGTCCACCATTGGCATGTGCCTCACTGAGACGCTCGACGAGATGGTCTCCAGCGGCACCCTCAGCCCGGAGCTCGCCATTCAAGTTCTTGACCAGTTTGATAAGTCTATGACGGAAGCCTTGGAGAACCAAGTCAAGAGCAAGGTTTCTATCAAGGGCCACCTGCACACTTACAGGTTCTGTGACAATGTATGGACATTCATCTTGACTGAAGCATCATTCAAGAACGAGGAGACTACAGAACAAGTTGGCAAGGTGAAGATTGTGGCCTGTGATTCCAAACTACTCAGCCAATAA。

[0101] 2. Detection of T-DNA-free in transgenic plants based on the PE system

[0102] Two lines were selected from each of the homozygous plants (T-A, TC-AG) of different mutant types generated from the PE system in the T0 generation to grow the T1 generation. From each T1 generation line, 30 representative plants were selected for T-DNA-free detection. Genomic DNA of the mutant plants was extracted from young rice leaves, and PCR amplification was performed using the PE vector detection primers Cas9 H840A-hjc-F1 (5’-cgacctcgacaatctcctcg-3’, SEQ ID NO:17) / R1 (5’-gtagtacgggatgcggaagg-3’, SEQ ID NO:18). The PCR products obtained were electrophoretically detected using 1.5% agarose gel. T-DNA-free plants showed no vector-specific bands. The results were as follows: In the T1 generation line (PE- Xa5 -1) of the T-A mutant type, 11 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 36.7% ( Figure 9 in A); in the T1 generation line (PE- Xa5 -2) of the T-A mutant type, 9 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 30% ( Figure 9 in B); in the T1 generation line (PE- Xa5 -3) of the TC-AG mutant type, 8 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 26.7% ( Figure 9 in C); in the T1 generation line (PE-Xa5-4) of the TC-AG mutant type, 10 did not amplify the corresponding fragment, being T-DNA-free lines, accounting for 33.3% ( Figure 9 in D). Meanwhile, the sequencing results showed that the homozygous mutants screened were all plants without exogenous T-DNA, including 9 plants of PE-Xa5-1, 7 plants of PE-Xa5-2, 3 plants of PE-Xa5-3, and 10 plants of PE-Xa5-4.

[0103] Example 5: Analysis of the resistance of T1 generation transgenic plants to bacterial blight

[0104] The resistance of homozygous lines of different editing types in the T1 generation to bacterial blight was identified. Three representative transgenic lines were selected for each editing type, with 9 plants planted for each line, and the parental line TP309 with the same genetic background was selected as the wild-type control and sown simultaneously. At the tillering stage of rice, the inoculation method of cutting leaves (PXO99A, PXO86, Xoo4) was used, and their disease conditions were counted 14 days later.

[0105] The resistance identification results showed that among the seven different mutant type strains, the +T and +G homozygous strains generated based on the single-target system, and the TC-AG and T-A homozygous strains generated based on the PE system had significantly improved resistance to bacterial blight compared with the wild type.

[0106] Among them, the lesion lengths of the +T mutant type strains were significantly decreased by 71.6% and 74.9% respectively compared with the wild type after inoculation with Xoo4 and PXO99A; the lesion lengths of the +G mutant type strains were significantly decreased by 69.8% and 75.9% respectively compared with the wild type after inoculation with Xoo4 and PXO99A; in addition, the TC-AG and T-A mutant types could significantly improve the disease resistance to XOO4 and PXO86. After inoculation with XOO4, the lesion lengths of the TC-AG and T-A mutant type plants were decreased by 81.6% and 73.2% respectively compared with the wild type. After inoculation with PXO86, the lesion lengths of the TC-AG and T-A mutant type plants were decreased by 74.9% and 59.4% respectively compared with the wild type ( Figure 10 ). Therefore, it was indicated that the edited rice had resistance to bacterial blight.

Claims

1. A rice bacterial blight resistance Xa5 allele, characterized in that: The Xa5 allele is shown in any one of SEQ ID NOs: 20 and 21.

2. Use of the allele according to claim 1 in rice breeding for resistance to bacterial blight.

3. A method for cultivating rice resistant to bacterial blight, comprising the following steps: Editing the Xa5 gene of rice using the CRISPR / Cas9 system, and screening to obtain rice having the Xa5 allele of claim 1; The CRISPR / Cas9 system includes sgRNA; The sgRNA sequence is shown in SEQ ID NO: 1; The rice plant having the Xa5 allele according to claim 1 has improved resistance to bacterial blight compared to the wild type.

4. The method according to claim 3, characterized in that: Homozygous mutant plants are selected from rice having the Xa5 allele according to claim 1 to cultivate T1 generation strains.

Images