TRNA m1A modification detection method based on methylation-sensitive ribozyme and application of tRNA m1A modification detection method

Abstract

The invention belongs to the technical field of RNA methylation level detection, and particularly relates to a tRNA m1A modification detection method based on methylation-sensitive ribozyme and application. The invention provides an application of methylated ribozyme VMC10 in preparation of a product for detecting m1A modification. The methylation ribozyme VMC10 is found to have m1A sensitivity, and when a tRNA m1A site is taken as a cutting target, m1A modification can hinder tRNA cutting by the VMC10, so that modification detection is carried out on the site. Furthermore, the invention provides a mutant VMC10, the 20th bit A of the mutant VMC10 is mutated into G, and the recognition capability of the mutant VMC10 is higher.

Description

Technical Field

[0001] The present invention belongs to the technical field of RNA methylation level detection, and specifically relates to a tRNA m 1 A modification detection methods and applications. Background Art

[0002] tRNA plays an important role in the translation process. In addition to tRNA abundance, chemical modifications on tRNA can affect the translation process by stabilizing the tRNA structure and helping tRNA to recognize codons. 1 A) is an important modification of RNA after transcription, formed by adding a methyl group to the N1 position of adenylate. 1 A is the most abundant and conservative modification on tRNA, located at positions 9, 14, and 58 of tRNA, and plays an important role in maintaining the secondary structure and stability of tRNA. 1 A is modified by the TRMT6 / TRMT61A complex, tRNA-m 1 A modification can enhance translation initiation and elongation; removal of m on tRNA 1 A modification can promote the degradation of tRNA into tRNA fragments. 1 There is a lack of accurate quantitative and qualitative analysis technology for A modification, which can achieve specific m on specific tRNA. 1 Modification detection at the A site is currently a technical difficulty.

[0003] VMC10 is a functional ribozyme (DNAzyme) with cleavage activity. Previous studies have shown that if N6-methyladenine (m 6 A) The modification will hinder the cleavage of VMC10. Therefore, VMC10 can be used to detect RNA m 6 A modification. However, there is no prior art showing that VMC10 has m 1 A modification detection capability. Summary of the invention

[0004] The first aspect of the present invention aims to provide a method for preparing a methylation ribozyme VMC10 for detecting m 1 A. Application of modified RNA products.

[0005] The second aspect of the present invention aims to provide a mutant methylation-sensitive ribozyme VMC10.

[0006] The third aspect of the present invention is to provide a method for detecting m 1 A modified kit.

[0007] The fourth aspect of the present invention is to provide a method for detecting RNA m 1 A modification method.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] In a first aspect of the present invention, a methylation-sensitive ribozyme VMC10 is provided for preparing a method for detecting m 1 A modification product application.

[0010] The enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is: 5`-GGGTCTCCAGCTGGACGTTA-3` (SEQ ID NO: 1).

[0011] In some embodiments of the present invention, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to G, and the sequence is: 5`-GGGTCTCCAGCTGGACGTTG-3` (SEQ ID NO: 2).

[0012] In some embodiments of the present invention, the 20th position A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to C, and the sequence is: 5`-GGGTCTCCAGCTGGACGTTC-3` (SEQ ID NO: 3).

[0013] In some embodiments of the present invention, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to T, and the sequence is: 5`-GGGTCTCCAGCTGGACGTTT-3` (SEQ ID NO: 4).

[0014] In some embodiments of the present invention, the 20th A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is deleted, and the sequence is: 5`-GGGTCTCCAGCTGGACGTT-3` (SEQ ID NO: 5).

[0015] In some embodiments of the present invention, the methylation-sensitive ribozyme VMC10 further includes two complementary arms, the enzyme activity sequence is located between the two complementary arms, the complementary arms at both ends are complementary to the target RNA sequence, and the length of a single arm is generally 8nt to 20nt. The structural schematic diagram is as shown in Figure 1 shown.

[0016] In some embodiments of the present invention, the product is used to detect RNA m 1 A modification.

[0017] In some embodiments of the present invention, the RNA includes at least one of linear RNA and circular RNA.

[0018] Preferably, the RNA is tRNA.

[0019] Preferably, when the RNA is linear RNA, the methylation-sensitive ribozyme having a sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5 is used for detection;

[0020] Preferably, when the RNA is tRNA, a methylation-sensitive ribozyme having a sequence as shown in SEQ ID NO: 1 or 2 is used for detection.

[0021] In some embodiments of the present invention, the product includes a reagent or a kit.

[0022] The second aspect of the present invention provides a mutant methylation-sensitive ribozyme VMC10.

[0023] In some embodiments of the present invention, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to G, and the sequence is shown in SEQ ID NO:2.

[0024] In some embodiments of the present invention, the 20th position A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to C, and the sequence is shown in SEQ ID NO:3.

[0025] In some embodiments of the present invention, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to T, and the sequence is shown in SEQ ID NO:4.

[0026] In some embodiments of the present invention, the 20th A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is deleted, and the sequence is shown in SEQ ID NO:5.

[0027] The third aspect of the present invention provides a method for detecting m 1 A modified kit, the kit comprising methylation-sensitive ribozyme VMC10; the nucleic acid sequence of the methylation-sensitive ribozyme VMC10 is shown in any one of SEQ ID NOs: 1-5.

[0028] In some embodiments of the present invention, the kit further comprises at least one of a buffer, magnesium ions, a positive control, and a negative control.

[0029] A fourth aspect of the present invention provides a method for detecting RNA m 1 A modification method, comprising the step of using the kit described in the third aspect of the present invention to perform detection.

[0030] The beneficial effects of the present invention are:

[0031] The present invention provides a methylation-sensitive ribozyme VMC10 for preparing a method for detecting m 1A modified product. The present invention found that the methylation-sensitive ribozyme VMC10 has m 1 A sensitivity, when the target RNA m 1 When site A is the cleavage target, m 1 The A modification will hinder the cleavage of RNA by VMC10, thereby detecting the modification of the site. Further, the present invention provides a mutant VMC10, wherein the 20th A of the mutant VMC10 is mutated to G, and its modification to tRNA m 1 A modification has stronger recognition ability. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0033] Figure 1 Schematic diagram of the structure of the methylation-sensitive ribozyme VMC10.

[0034] Figure 2 VMC10 and its mutants in detecting linear RNA m 1 A modified gel electrophoresis results.

[0035] Figure 3 VMC10 and its mutants in detecting linear RNA m 1 A Modified RT-qPCR results.

[0036] Figure 4 is the m of tRNA by different VMC10 mutants 1 A modified detection results.

[0037] Figure 5 VMC10(A20G) oligo tRNA eMet 58 position for tRNA m 1 A modifies the qualitative test results.

[0038] Figure 6 VMC10(A20G) oligo tRNA eMet tRNAm 1 A Modification quantitative detection results.

[0039] Figure 7 VMC10(A20G) for linear RNA m 1 A Schematic diagram of the principle of modification detection.

[0040] Figure 8 VMC10(A20G) for tRNAm 1 A Schematic diagram of the principle of modification detection.

[0041] Fig. 9VMC10(A20G) regulates intracellular tRNA eMet tRNAm 1 A modifies the qualitative test results.

[0042] Fig.10 tRNA eMet The 52nd position was used as an internal reference, and VMC10 (A20G) was used to measure the intracellular tRNA eMet tRNAm 1 A modifies the qualitative test results. DETAILED DESCRIPTION

[0043] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0044] Example 1 VMC10 to m 1 A is sensitive

[0045] 1. Experimental Materials and Methods

[0046] Substrate RNA Oligo-A or Oligo-m 1 A and the corresponding designed ribozyme (the active sequence remains unchanged, but the complementary arms at both ends are changed).

[0047] The sequences are shown in Table 1.

[0048] Table 1

[0049]

[0050] The underlined part indicates the enzyme activity sequence.

[0051] DNAzyme VMC10-1 (10 pmol), substrate RNAOligo-A or Oligo-m 1 A (1 pmol) was mixed with water to a final volume of 7 μL. The mixture was placed at 95°C for 5 min and then at 25°C for 15 min. To initiate the digestion reaction, Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2 (20 mM) buffer were added, and the reaction mixture was incubated at 37°C for 10 hours. After digestion, 7 M urea denaturing PAGE analysis was performed, and after SYBR Gold staining, the PAGE gel was imaged on an ultra-high sensitivity chemiluminescent imaging system.

[0052] Experimental results:

[0053] PAGE gel results showed that VMC10-1 produced a corresponding enzyme fragment band (23 nt) after treating Oligo-A, indicating that VMC10 can successfully recognize and cleave unmethylated Oligo-A, while Oligo-m 1 Only a complete band (42 nt) was detected for A, indicating that the methylated A (m 1 A) will hinder VMC10 from cleaving Oligo-A ( Figure 2 ). Therefore, the experiment proves that VMC10 has good 1 A is also sensitive.

[0054] Example 2 Effects of VMC10 mutants on linear RNA m 1 A modified identification results

[0055] Since VMC10 can simultaneously identify m 6 A and m 1 A, in order to make VMC10 have better m 1 A specificity, this example further mutated the A20 position of the enzymatic activity center of VMC10 and detected its ability to distinguish tRNAm 1 A. Effect. This example was first tested in linear RNA.

[0056] Mutation type groups include: A20 (original sequence), A20G (position 20 changed from A to G), A20C (position 20 changed from A to C), A20T (position 20 changed from A to T), △A20 (deletion of position 20 A).

[0057] The sequences are shown in Table 2.

[0058] Table 2

[0059]

[0060] The underlined part indicates the enzyme activity sequence.

[0061] Testing process:

[0062] Detection of linear RNA cleavage: The gel detection experimental method is the same as in Example 1.

[0063] Further, 2 μL of the digested product was taken, and a specific reverse transcription primer RT-oligo-23nt (SEQ ID NO: 13) was added to perform stem-loop reverse transcription. After generating cDNA, primers q-oligo-23nt-F and q-oligo-23nt-R (SEQ ID NO: 14, 15) were added to perform real-time fluorescence quantitative PCR to determine the content of the generated digested fragments.

[0064] The primer sequences are shown in Table 3.

[0065] Table 3

[0066]

[0067] VMC10 and all its mutants have cleavage activity for linear RNA.

[0068] PAGE gel results showed that after VMC10 mutant treatment, Oligo-A produced a band of the corresponding enzyme cleavage fragment (23 nt), indicating that VMC10 mutant can successfully recognize and cleave unmethylated Oligo-A, while Oligo-m 1 A only detected a complete band (42 nt), indicating that the methylated A (m 1 A) will hinder the cleavage of Oligo-A by VMC10 mutants ( Figure 2 ). Therefore, the experiment proved that the VMC10 mutant has an important effect on the m 1 A is also sensitive.

[0069] The results of RT-qPCR were consistent with those of PAGE gel: Oligo-m 1 Compared with A, Oligo-A has a lower Ct value, indicating that more enzyme-digested fragments are generated ( Figure 3 ).

[0070] Example 3 VMC10 mutants affect tRNAm 1 A modified identification results

[0071] The tRNAoligo target RNA sequences and the corresponding ribozyme sequences are shown in Table 4.

[0072] Table 4

[0073]

[0074] The underlined part indicates the enzyme activity sequence.

[0075] tRNA cleavage detection:

[0076] DNAzyme VMC10 and its mutants (10 pmol), substrate Oligo tRNA eMet -m 1 A. Oligo tRNA eMet-A (1 pmol) and water were mixed to a final volume of 7 μL. The mixture was placed at 95°C for 5 min and then at 25°C for 15 min. To initiate the digestion reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2 (20 mM) were added, and the reaction mixture was incubated at 37°C for 12 hours. After the digestion was completed, 1 μL of the digestion product was taken and a specific reverse transcription primer RT-Met-57nt (SEQ ID NO: 23) was added for stem-loop reverse transcription. After generating cDNA, primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) were added for real-time fluorescence quantitative PCR to determine the content of the generated digestion fragments. The primer sequences are shown in Table 5.

[0077] Table 5

[0078]

[0079] The results of tRNA cleavage are shown in the figure: VMC10 has m 1 As for the mutant, when the A20 position of VMC10 is guanine, it has better m 1 A recognition effect ( Figure 4 ). The remaining mutants did not work well.

[0080] VMC10(A20G) will be used as tRNA m 1 A recognition tool, and the reaction conditions were optimized. The optimal reaction conditions finally obtained were: ① VMC10 (A20G) hybridized with tRNA oligo, the reaction conditions were 95℃5min; 25℃15min or room temperature cooling for 10min; ② VMC10 (A20G) enzyme digestion: the reaction system was incubated at 37℃ for 12 hours under the conditions of buffer Tris-HCl (50mM, pH7.5), NaCl (150mM) and MgCl2 (50mM). ③ Result detection and analysis: 7M urea denaturing PAGE analysis or RT-qPCR detection of amplification product differences.

[0081] Example 4 VMC10 (A20G) to tRNA Met 58 bits m 1 Qualitative detection results of A modification

[0082] 1. Experimental Materials

[0083] Substrate RNAoligo-tRNA eMet -A or oligo-tRNA eMet -m 1 A

[0084] 2. Experimental methods:

[0085] DNAzyme VMC10(A20G) (50 pmol), substrate RNA oligo-tRNA eMet -A or oligo-tRNA eMet -m 1 A (1pmol) and water were mixed to a final volume of 7μL. The mixture was placed at 95℃ for 5min and then at 25℃ for 15min. To start the enzyme cleavage reaction, buffer Tris-HCl (50mM, pH 7.5), NaCl (150mM) and MgCl2 (50mM) were added, and the reaction mixture was incubated at 37℃ for 12 hours. After the enzyme cleavage was completed, 7M urea denaturing PAGE analysis was used, and after SYBR Gold staining, the PAGE gel was imaged on an ultra-high sensitivity chemiluminescent imaging system.

[0086] 3. Experimental results

[0087] The results showed that oligo-tRNA treated with VMC10(A20G) eMet -A produced a band of the corresponding enzyme cleavage fragment (57 nt), indicating that VMC10 (A20G) can successfully recognize and cleave the unmethylated oligo-tRNA eMet -A. After VMC10 (A20G) treatment, oligo-tRNA eMet -m 1 A only detected a complete band of 76 nt, indicating that the methylated A (m 1 A) It will hinder VMC10(A20G) from activating oligo-tRNA eMet -m 1 A's cutting ( Figure 5 ).

[0088] Example 5 VMC10 A20G tRNA Met 58 bits m 1 Quantitative detection results of A modification

[0089] 1. Experimental Materials

[0090] Same as Example 3.

[0091] The remaining materials include reverse transcription primer RT-Met-57nt; PCR primers q-Met-57nt-F and q-Met-57nt-R; the sequences are shown in Tables 4 and 5.

[0092] 2. Experimental methods

[0093] DNAzyme VMC10(A20G) (50 pmol) and substrate RNA oligo-tRNAeMet -A or oligo-tRNA eMet -m 1 A (1pmol) was mixed with water to a final volume of 7μL. The mixture was heated to 95℃ for 5min and then 25℃ for 15min. To initiate the digestion reaction, Tris-HCl (50mM, pH 7.5), NaCl (150mM) and MgCl2 (50mM) buffer were added, and the reaction mixture was incubated at 37℃ for 12 hours. After the digestion was completed, the generated digestion fragments were quantified using RT-qPCR technology. Take 1μL of the digestion product, add the reverse transcription primer RT-Met-57nt (SEQ ID NO: 23) for stem-loop reverse transcription, and after generating cDNA, add the primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) for real-time fluorescence quantitative PCR to determine the content of the generated digestion fragments.

[0094] 3. Experimental results

[0095] The PAGE gel results in Example 3 are consistent with the oligo-tRNA treated with VMC10 (A20G). eMet -m 1 Compared with A, oligo-tRNA after VMC10(A20G) treatment eMet -A has a lower Ct value, indicating that more enzyme-cleaved fragments are produced, further proving that VMC10(A20G) can effectively cleave unmethylated oligo-tRNA eMet -A, and can be quantified by RT-qPCR ( Figure 6 ).

[0096] Example 6 VMC10 (A20G) on intracellular tRNA Met tRNAm 1 A modification qualitative detection

[0097] 1. Experimental Materials

[0098] Same as the embodiment

[0099] The remaining materials include HEK-293T, Dynabeads TM M-280 Streptavidin, Qubit TM RNA HS Quantification Kit, Biotinylated Probe tRNA eMetCAT(Sequence: 5'biotin-TGCCCCGTGTGAGGATCGAACTCAC GACCT; SEQ ID NO: 25) Reverse transcription primer RT-Met-57nt; PCR primers q-Met-57nt-F, q-Met-57nt-R; sequences are shown in Tables 4 and 5.

[0100] 2. Experimental Methods

[0101] 2.1 Isolation and purification of specific tRNA:

[0102] HEK-293T cells were cultured in a high-glucose DMEM medium containing 10% fetal bovine serum in a constant temperature incubator at 37° C. and 5% CO 2 until the cells reached a desired growth density.

[0103] Total RNA was extracted from cells using Trizol reagent. 30 μL of M-280 streptavidin magnetic beads were washed three times with binding / washing buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) to remove possible impurities. The washed magnetic beads were mixed with biotinylated probe tRNA eMetCAT Mix and incubate at 4°C for 2 hours. After incubation, wash the magnetic beads 4 times with binding / washing buffer to remove unbound biotinylated probes. The magnetic beads were then equilibrated in a 6×SSC solution (0.9M NaCl, 0.09M sodium citrate, pH 7.0). The magnetic beads and the SSC solution containing total RNA were incubated at 75°C for 10 minutes respectively, and then the two were mixed and incubated at 75°C for 10 minutes to allow tRNA to bind to the biotinylated probe on the magnetic beads. The magnetic beads bound to tRNA were incubated at room temperature for 4 hours to ensure that tRNA was fully bound to the magnetic beads. After incubation at room temperature, the magnetic beads were washed 3 times with 3×SSC solution to remove unbound RNA and other impurities. Then, they were washed twice with 1×SSC solution and once with 0.1×SSC solution. Finally, the tRNA on the magnetic beads was eluted with 10μL of RNase-free water at 70°C for 5 minutes. Use Qubit TM RNA HS Quantification Kit tRNA assay on 3.0 Fluorometer eMetCAT concentration.

[0104] 2.2 DNAzyme VMC10(A20G) (50 pmol) and isolated and purified tRNA eMetCATand water to a final volume of 14 μL. The mixture was placed at 95°C for 5 min and then at 25°C for 15 min. To initiate the digestion reaction, Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2 (50 mM) buffers were added, and the reaction mixture was incubated at 37°C for 12 hours. After the digestion was completed, the generated digestion fragments were quantified using RT-qPCR technology. Take 2 μL of the digestion product and add the reverse transcription primer RT-Met-57nt (SEQ ID NO: 23) for stem-loop reverse transcription. After generating cDNA, primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) were added for real-time fluorescence quantitative PCR to determine the content of the generated digestion fragments. 3. Experimental results: The results showed that compared with the control group, tRNA after VMC10 (A20G) treatment eMet The lower Ct value and more enzyme fragments were produced, which proved that VMC10(A20G) had an effect on intracellular tRNA. eMet 58 position for tRNA m 1 A modification qualitative detection ( Fig. 9 ).

[0105] Example 7

[0106] Intracellular tRNA eMet The 52nd position was used as an internal reference, and VMC10 (A20G) was used to measure the intracellular tRNA eMet tRNAm 1 A modifies the qualitative test results.

[0107] 1. Experimental Materials

[0108] Same as Example 6.

[0109] The remaining material contains tRNA eMetCAT The corresponding ribozyme sequence and primer sequence at position 52 of tRNA are shown in Table 6; eMetCAT The corresponding ribozyme sequence and primer sequence at position 58 are shown in Tables 4 and 5.

[0110] Table 6

[0111]

[0112] 2. Experimental Methods

[0113] (1) Isolation and purification of specific tRNA: Same as Example 6. Set up HEK-293T WT control group and overexpression m 1 A demethylase ALKBH3 group.

[0114] The expression sequence of ALKBH3 is shown in SEQ ID NO: 29: ATGGAGGAAAAAAGACGGC GAGCCCGAGTTCAGGGAGCCTGGGCTGCCCCTGTTAAAAGCCAGGCCATTGCTCAGCCAGCTACCACTGCTAAGAGCCATCTCCACCAGAAGCCTGGCCAGACCTGGAAGAACAAAGAGCATCATCTCTCTGACAGAGAGTTTGTGTTCAAAGAACCTCAGCAGGTAGTACGTAGAGCTCCTGAGCCACGAGTGATTGACAGAGAGGGTGTGTATGAAATCAGCCTGTCACCCACAGGTGTATCTAGGGTCTGTTTGTATCCTGGCTTTGTTGACGTGAAAGAAGCTGACTGGATATTGGAACAGCTTTGTCAAGATGTTCCCTGGAAACAGAGGACCGGCATCAGAGAGGATATAACTTATCAGCAACCAAGACTTACAGCATGGTATGGAGAACTTCCTTACACTTATTCAAGAATCACTATGGAACCAAATCCTCACTGGCACCCTGTGCTGCGCACACTAAAGAACCGCATTGAAGAGAACACTGGCCACACCTTCAACTCCTTACTCTGCAATCTTTATCGCAATGAGAAGGACAGCGTGGACTGGCACAGTGATGATGAACCCTCACTAGGGAGGTGCCCCATTATTGCTTCACTAAGTTTTGGTGCCACACGCACATTTGAGATGAGAAAGAAGCCACCACCAGAAGAGAATGGAGACTACACATATGTGGAAAGAGTGAAGATACCCTTGGATCATGGGACCTTGTTAATCATGGAAGGAGCGACACAAGCTGACTGGCAGCATCGAGTGCCCAAAGAATACCACTCTAGAGAACCGAGAGTGAACCTGACCTTTCGGACAGTCTATCCAGACCCTCGAGGGGCACCCTGGTGA。

[0115] This sequence was inserted into the PPB vector to construct an overexpression vector.

[0116] (2) For tRNA eMetThe deoxyribozyme VMC10 (50 pmol) designed at position 52 or targeting tRNA eMet The deoxyribozyme VMC10 (A20G) (50 pmol) designed at position 58 and the tRNA isolated and purified eMetCAT and water to a final volume of 14 μL. The mixture was placed at 95°C for 5 min and then at 25°C for 15 min. To initiate the digestion reaction, buffer Tris-HCl (50 mM, pH 7.5), NaCl (150 mM) and MgCl2 (50 mM) were added, and the reaction mixture was incubated at 37°C for 12 hours. After the digestion was completed, the generated digestion fragments were quantified using RT-qPCR technology. Take 2 μL of the digestion product, add reverse transcription primers RT-Met-57nt (SEQ ID NO: 23) and RT-Met-51nt (SEQ ID NO: 27) for stem-loop reverse transcription, and after generating cDNA, add primers q-Met-57nt-F and q-Met-57nt-R (SEQ ID NO: 24, 15) and q-Met-51nt-F and q-Met-51nt-R (SEQ ID NO: 28, 15) for real-time fluorescence quantitative PCR to determine the content of the generated digestion fragments.

[0117] 3. The experimental results showed that compared with the control group of HEK-293T cells WT group and oe ALKBH3 group, tRNA eMet It has a lower Ct value and produces more enzyme-cut fragments. eMet As the internal reference, the ΔCt value of the WT group of HEK-293T cells was lower than that of the oe ALKBH3 group, indicating that the enzyme fragments produced after oe ALKBH3 were less than those in the WT group, that is, after overexpression of ALKBH3, tRNA eMet m 1 A modification level decreased ( Fig.10 ).

Claims

1. Preparation of methylation-sensitive ribozyme VMC10 for detecting m 1 A modification product application.

2. The use according to claim 1, characterized in that: The enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is shown in SEQ ID NO:

1.

3. The use according to claim 2, characterized in that: The methylation-sensitive ribozyme VMC10 has an enzyme activity sequence in which the A at position 20 is mutated to G, and the sequence is shown in SEQ ID NO: 2; Or, the 20th position A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to C, and the sequence is shown in SEQ ID NO: 3; Or, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to T, and the sequence is shown in SEQ ID NO: 4; Alternatively, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is deleted, and the sequence is shown in SEQ ID NO:

5.

4. The product according to claim 1, characterized in that: The product is used to detect RNA m 1 A modification.

5. The product according to claim 4, characterized in that: The RNA includes at least one of ribosomal RNA, linear RNA, and circular RNA; Preferably, when the RNA is linear RNA, the methylation-sensitive ribozyme having a sequence as shown in SEQ ID NO: 1, 2, 3, 4, 5 is used for detection; Preferably, when the RNA is tRNA, a methylation-sensitive ribozyme having a sequence as shown in SEQ ID NO: 1 or 2 is used for detection.

6. The product according to claim 1, characterized in that: The products include reagents and test kits.

7. A mutant methylation-sensitive ribozyme VMC10, characterized in that: The methylation-sensitive ribozyme VMC10 has an enzyme activity sequence in which the A at position 20 is mutated to G, and the sequence is shown in SEQ ID NO: 2; Or, the 20th position A of the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to C, and the sequence is shown in SEQ ID NO: 3; Or, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is mutated to T, and the sequence is shown in SEQ ID NO: 4; Alternatively, the 20th A in the enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is deleted, and the sequence is shown in SEQ ID NO:

5.

8. A method for detecting m 1 A modified kit, characterized in that: The kit includes methylation-sensitive ribozyme VMC10; The enzymatic activity sequence of the methylation-sensitive ribozyme VMC10 is shown in any one of SEQ ID NOs: 1-5.

9. The kit according to claim 8, characterized in that: The kit further comprises at least one of a buffer, magnesium ions, a positive control, and a negative control.

10. A method for detecting RNAm 1 A modification method, comprising the step of using the kit according to any one of claims 8 to 9 for detection.

Images