Compositions, kits, uses thereof, and methods

Abstract

A composition, kit, use and method thereof. Compared with the prior art, the primer and the probe are higher in sensitivity, and the detection limit of fungi to be detected can be increased to 400 copies / mL (namely 2 copies / reaction). The specificity is good, cross reaction with the human genome DNA is avoided, and the negative control containing the human genome DNA has no amplification signal in 45 cycles. The coverage is wide, about more than 90% of known fungal species can be covered, and nearly 3600 (or subspecies) fungal DNA sequences can be matched.

Description

Technical Field

[0001] The present application generally relates to the field of biotechnology, and more particularly to a composition for fungus detection, a kit, uses thereof, and a method for detecting fungi using qPCR. Background Art

[0002] Cell products mainly refer to living cell products of human origin that are prepared through appropriate in vitro operations (such as separation, culture, amplification, gene modification, etc.) and then infused back into the human body, and approved for marketing as drugs. Cell products are produced under aseptic processes, and subsequent sterilization processes cannot be performed. Moreover, they are easily contaminated by microorganisms due to their biological characteristics. Therefore, microbial contamination inspection is one of the important indicators for product safety quality control. However, this type of product has many particularities, such as small batches, short shelf life, and urgent clinical needs. The current pharmacopoeia's sterility inspection method takes at least 14 days and requires a large amount of sampling, which can hardly meet the needs of intermediate products and release inspections for sterility inspections. Among them, the rapid nucleic acid method represented by the qPCR method will eventually make the method of rapid sterility inspection a possibility, bringing more convenience to scientific research development and drug production. Summary of the invention

[0003] Based on this, the present application provides a composition comprising:

[0004] An upstream bait oligonucleotide and a downstream bait oligonucleotide, wherein the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO: 1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO: 2.

[0005] In another aspect, the present application also provides a kit comprising the composition described herein.

[0006] In another aspect, the present application also provides use of the composition described herein or the kit described herein in fungal detection.

[0007] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting fungi using a qPCR method.

[0008] In another aspect, the present application also provides a method for detecting fungi using qPCR, comprising:

[0009] The composition described herein or the kit described herein is used to perform qPCR on the sample to be tested on a qPCR instrument, and the presence or absence of fungi in the sample is determined based on the result of qPCR.

[0010] Compared with the prior art, this application has the following technical advantages:

[0011] 1. Higher sensitivity, the detection limit of the fungi to be tested can be increased to 400 copies / mL (i.e. 2 copies / reaction).

[0012] 2. Good specificity, no cross reaction with human genomic DNA, and the negative control containing human genomic DNA had no amplification signal in 45 cycles.

[0013] 3. It has a wide coverage, covering more than 90% of known fungal species and matching nearly 3,600 species (or subspecies) of fungal DNA sequences.

[0014] Other features and advantages of the present application will be described in the following description, and partly become apparent from the description, or be understood by implementing the present application. Other advantages of the present application can be realized and obtained by the schemes described in the description and the drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] The accompanying drawings are used to provide an understanding of the technical solution of the present application and constitute a part of the specification. Together with the embodiments of the present application, they are used to explain the technical solution of the present application and do not constitute a limitation on the technical solution of the present application.

[0016] Figure 1 The NCBI MSA Viewer alignment result after Blast of the Aspergillus niger 18S rRNA gene sequence (Gene Bank: NG_065763.1) in the examples of the present application, wherein 3600 alignment sequences were selected.

[0017] Figure 2 These are the results of matching analysis between each set of primers in Example 1 of the present application and human genomic DNA.

[0018] Figure 3 It is the negative and positive sample test results of combination 1-3 in Example 2 of the present application. Among them, the red in combination 1 is a positive sample (high concentration and low concentration from left to right), and the yellow is a negative sample (water). The blue in combination 2 is a positive sample (high concentration and low concentration from left to right), and the yellow is a negative sample (water). The green in combination 3 is a positive sample (high concentration and low concentration from left to right), and the yellow is a negative sample (water).

[0019] Figure 4The negative and positive sample test results of combination 4-5 in Example 2 of the present application. Among them, the black in combination 4 is a positive sample (high concentration and low concentration from left to right), and the yellow is a negative sample (water). The red in combination 5 is a positive sample (high concentration and low concentration from left to right), and the yellow is a negative sample (water).

[0020] Figure 5 This is the background human genomic DNA interference verification of combination 3-5 in Example 2 of this application. Among them, all three lines are negative samples, and the same concentration of human genomic DNA is added to them. The three lines of each combination test represent three parallel repetitions. DETAILED DESCRIPTION

[0021] Unless otherwise stated, the technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the application belongs. When a certain amount, concentration or other value or parameter is expressed in the form of a range, a preferred range, or a preferred upper numerical limit and a preferred lower numerical limit, it should be understood that it is equivalent to specifically revealing any range by combining any pair of upper range limits or preferred numerical values ​​with any lower range limit or preferred numerical value, regardless of whether the range is specifically disclosed. Unless otherwise stated, the numerical ranges listed herein are intended to include the endpoints of the range and all integers and fractions (decimals) within the range.

[0022] The terms "about" and "approximately" when used with a numerical variable generally refer to the value of that variable and all values ​​of that variable are within experimental error (e.g., within a 95% confidence interval of the mean) or within ±10% of the specified value, or a wider range.

[0023] The expression "comprising" or its synonymous similar expressions "including", "containing" and "having" etc. are open-ended and do not exclude additional unrecited elements, steps or ingredients. The expression "consisting of excludes any element, step or ingredient not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps or ingredients, plus the optional elements, steps or ingredients that do not materially affect the basic and novel characteristics of the claimed subject matter. It should be understood that the expression "comprising" encompasses the expressions "consisting essentially of" and "consisting of".

[0024] The expression "at least one" or "one or more" means 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0025] Fungal contamination detection is an important part of sterile release. Currently, most primer and probe sequences for fungal detection are designed within the conservative interval of fungal 18S rRNA to ensure that the detection reagent covers all known fungal genera as much as possible. Sequence studies have found that the fungal 18S rRNA gene sequence is highly similar to the human genome DNA sequence. Therefore, it is very likely that non-specific amplification of human genes will occur when designing primers and probes. In the sterility detection of cell products, there is background interference from human cells, which leads to the appearance of false positive results. Among them, patent CN118064616A judges the test results of Ct≥30 or no Ct value as negative when making result judgments, indicating that its detection reagent has certain non-specific amplification when Ct≥30 to a certain extent, that is, the factor of human genome interference is ignored when designing primers, which in turn affects the detection sensitivity of the entire reagent.

[0026] In response to the problems of low sensitivity and human genome interference of existing products, this application uses the fungal 18S rRNA gene as a template to design primer probes. The primer probe sequence is designed within the conserved region of the gene and spans the variable region of the gene to avoid homology with the human genome sequence. After the primers are designed, the BLAST function in NCBI is used to verify that no human genome sequence will be amplified. The sensitivity is higher and can be increased to 2 copies / reaction. The coverage of various fungal genera is wide, covering more than about 90% of known fungal species, and matching nearly 3,600 species (or subspecies) of fungal DNA sequences.

[0027] In response to the problems of low sensitivity and interference with the human genome of existing products, this application designs primer probes using the fungal 18S rRNA gene as a template. The primer probe sequences are designed within the conserved region of the gene and span the variable region of the gene to avoid homology with the human genome sequence and will not amplify the human genome sequence.

[0028] In one aspect, the present application provides a composition comprising:

[0029] An upstream bait oligonucleotide and a downstream bait oligonucleotide, the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0030] In some embodiments, the upstream decoy oligonucleotide is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0031] In some embodiments, the upstream decoy oligonucleotide is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0032] In some embodiments, the upstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0033] In some embodiments, the upstream decoy oligonucleotide is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:2.

[0034] In some embodiments, the upstream bait oligonucleotide is the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is the sequence shown in SEQ ID NO:2.

[0035] In various aspects disclosed elsewhere herein, the decoy oligonucleotide may be referred to as a "primer," "oligonucleotide primer," or "nucleic acid primer." The primer may be a deoxyribonucleic acid or a ribonucleic acid. The primer may comprise one or more non-natural nucleotides. The non-natural nucleotide may be, for example, deoxyinosine. The primer may be a forward primer. The primer may be a reverse primer. The primer may be about 5 to about 50 nucleotides in length. The primer may be at least 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 or more base pairs in length. The primer may be at most 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, or 5 nucleotides in length. The primer can be about 5, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 base pairs in length.

[0036] A pair of primers may include a forward primer (upstream primer) and a reverse primer (downstream primer). The forward primer may be configured to hybridize with a first region (e.g., 3' end) of a nucleic acid sequence, and the reverse primer may be configured to hybridize with a second region (e.g., 5' end) of the nucleic acid sequence, thereby being configured to amplify the nucleic acid sequence under conditions sufficient for nucleic acid amplification. Different pairs of primers may be configured to amplify different target nucleic acid sequences.

[0037] In some embodiments, the composition further comprises a probe sequence that is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3.

[0038] In some embodiments, the probe sequence is derived from at least 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. In some embodiments, the probe sequence is derived from at least 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3. Preferably, the probe sequence is the sequence shown in SEQ ID NO:3.

[0039] In some embodiments, the present application provides primer and probe combinations as shown in the following table:

[0040] name Sequence (5'-3') Upstream primer FuF5 CGGCACCTTACGAGAAATCAAAG(SEQ ID NO:1) Probe FuP5 TTGGGTTCTGGGGGGAGTATGGTC(SEQ ID NO:3) Downstream primer FuR5 CCTTCCGTCAATTTCTTTAAGTTT(SEQ ID NO:2)

[0041] In some embodiments, the probe sequence is 15-30 bp in length, and its 5' end is not G; the Tm value of the probe sequence is higher than that of the upstream primer and the downstream primer. Preferably, the Tm value of the probe sequence is 68-72° C. In some embodiments, the probe can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30 or more nucleotides in length.

[0042] In this article, "detection probe", "probe" and "oligonucleotide probe" are used interchangeably. The probe can be a nucleic acid (e.g., DNA, RNA, etc.). The probe can include a region complementary to a region of the target nucleic acid. The concentration of the probe can make it excessive relative to other components in the detection mixture. The probe can be a signal generating nucleic acid probe. The signal generating nucleic acid probe can include the characteristics of the probe as described herein, as well as the characteristics of generating a signal after applying a stimulus, modifying the probe or hydrolyzing the probe. For example, the probe can be hydrolyzed by the exonuclease activity of a polymerase, thereby generating a signal. The signal generating nucleic acid probe can generate any signal as described elsewhere in this article. For example, the signal generating probe can generate a fluorescent signal. The signal generating probe can include a signal tag. The signal tag can generate a signal. The signal tag can generate a signal in response to a reaction or stimulus. For example, the signal tag can generate a signal after being degraded by exonuclease activity.

[0043] In some embodiments, a signal can be generated while the probe is hybridized with the nucleic acid region. For example, a probe (e.g., a molecular beacon) can generate a signal (e.g., a fluorescent signal) after hybridizing with a nucleic acid. In some cases, a signal can be generated after the probe is hybridized with the nucleic acid region, after the probe is degraded by a nuclease. In the case where the probe comprises a signal tag, the probe can be degraded when combined with the region of the primer, thereby generating a signal. For example, a probe (e.g., a probe) can generate a signal after the probe is hybridized with a nucleic acid and subsequently degraded by a polymerase (e.g., in an amplification such as a PCR amplification process). The probe can be degraded by the exonuclease activity of a nuclease.

[0044] In some embodiments, both ends of the probe sequence are modified with a fluorescent reporter group and a fluorescent quencher group corresponding to the fluorescent reporter group. The probe modified with a fluorescent reporter group and a fluorescent quencher group at both ends is used to display the relative amount of the synthesized DNA product in qPCR. In the absence of amplification, the fluorescent reporter group and the fluorescent quencher group at both ends of the probe sequence are together, and the fluorescence of the fluorescent reporter group is quenched by the fluorescent quencher group and does not emit fluorescence. When the PCR synthesis begins, the probe sequence is complementary to the target fragment in the genomic DNA and can anneal together. If the target microorganism exists in the sample (i.e., the target fragment exists), the probe sequence can bind to the target fragment. When the PCR reaction starts, if the PCR reaction can occur, the taq enzyme can dissociate the probe sequence bound to the target fragment, thereby separating the fluorescent reporter group from the fluorescent quencher group, and at this time, the fluorescence emitted by the fluorescent reporter group can be detected. As the PCR reaction proceeds, the more DNA amplification products are synthesized, the more fluorescent reporter groups are dissociated. By detecting the fluorescence intensity, the amount of DNA amplification products can be accurately quantified.

[0045] In some embodiments, the fluorescent reporter group and the fluorescent quencher group can be selected from various fluorescent reporter groups and corresponding fluorescent quenchers commonly used by those skilled in the art in qPCR. In some embodiments, the fluorescent reporter group can be selected from FAM, VIC, HEX, ROX or CY5, and correspondingly, the fluorescent quencher group can be selected from BHQ1, BHQ2, BHQ3 or MGB.

[0046] If solid support is used in detection (for example, using probe to capture the amplicon of target nucleic acid), then probe can be connected to solid support in different ways. For example, by connecting the 3' or 5' end nucleotide of probe to solid support, probe can be connected to solid support. More preferably, probe is connected to solid support by playing the joint that separates probe from solid support. Joint is generally the length of at least 15-30 atoms, more preferably, the length of at least 15-50 atoms. The expected length of joint will depend on the specific solid support applied. For example, when using highly cross-linked polystyrene as solid support, 6 atomic joints are usually enough.

[0047] In some embodiments, the length of the fragment amplified by the upstream bait oligonucleotide and the downstream bait oligonucleotide is about 80-250 bp.

[0048] In some embodiments, the upstream bait oligonucleotide and the downstream bait oligonucleotide are distributed in different conserved regions of the fungal 18s rRNA gene.

[0049] In some embodiments, the working concentration of the upstream bait oligonucleotide, the downstream bait oligonucleotide, and the probe sequence is about 5-15 μM; preferably, the working concentration of the upstream bait oligonucleotide, the downstream bait oligonucleotide, and the probe sequence is about 10 μM.

[0050] Numerous joints are known in the art, and they can be used to connect oligonucleotide probes to solid supports. Joints can be formed by any compound that does not significantly interfere with the hybridization of the target sequence and the probe connected to the solid support. Joints can be formed by homopolymeric oligonucleotides that can be easily added to the joint by automatic synthesis. Alternatively, polymers such as functionalized polyethylene glycol can be used as joints. Such polymers are preferred than homopolymeric oligonucleotides because they do not significantly interfere with the hybridization of probes and target oligonucleotides. Polyethylene glycol is particularly preferred. Examples of solid supports of preferred types for fixing oligonucleotide probes include controlled pore glass, glass plates, polystyrene, avidin-coated polystyrene beads, cellulose, nylon, acrylamide gel and activated dextran.

[0051] In certain embodiments, an internal control (IC) or internal standard is added as a control to illustrate that any negative result is not caused by a detection failure. The use of IC enables control of the separation process, amplification process, and detection system, and enables monitoring of detection behavior and quantification of the sample (one or more). The IC can be included at any suitable point, for example, in a lysis buffer. In one embodiment, the IC includes a phage nucleic acid. When a solid support is used in the detection, the solid support can additionally include a probe specific for the internal standard (IC probe) to assist in capture when the IC probe is used. The IC probe can optionally be coupled to a detectable label different from the detectable label of the target sequence. In an embodiment where the detectable label is a fluorophore, the IC can be quantified by spectrophotometry and by limit of detection studies.

[0052] In another aspect, the present application also provides a kit comprising the composition described herein.

[0053] In some embodiments, the kit may include primers (or "bait oligonucleotides") as described herein. Primers may include paired primers. Paired primers may include forward primers and reverse primers. Primers can be configured to amplify a nucleic acid sequence corresponding to a specific target. For example, a forward primer can be configured to hybridize with a first region (e.g., 3' end) of a nucleic acid sequence, and a reverse primer can be configured to hybridize with a second region (e.g., 5' end) of the nucleic acid sequence, thereby being configured to amplify the nucleic acid sequence. Primers configured to amplify nucleic acid molecules can be used in performing the disclosed methods. In some cases, all primers in the kit are lyophilized.

[0054] The kit may include one or more nucleases. The nuclease may be a nucleic acid polymerase. The nucleic acid polymerase may be a deoxyribonucleic acid polymerase (DNA enzyme). The DNA enzyme may be Taq polymerase or a variant thereof. The nuclease may be a ribonucleic acid polymerase (RNA enzyme). The RNA enzyme may be RNA enzyme III. The nuclease may be an endonuclease. The endonuclease may be an endonuclease I. The endonuclease I may be a T7 endonuclease I. The nuclease may be capable of degrading nucleic acids comprising non-natural nucleotides. The nuclease may be an endonuclease V, such as an E. coli endonuclease V. The nuclease may be a polymerase (e.g., a DNA polymerase). The polymerase may be a Taq polymerase or a variant thereof. The non-limiting examples of DNA polymerases include Taq polymerase, Tth polymerase, Tli polymerase, Pfu polymerase, VENT polymerase, DEEPVENT polymerase, EX-Taq polymerase, LA-Taq polymerase, Expand polymerase, Sso polymerase, Poc polymerase, Pab polymerase, Mth polymerase, Pho polymerase, ES4 polymerase, Tru polymerase, Tac polymerase, Tne polymerase, Tma polymerase, Tih polymerase, Tfi polymerase, PlatinumTaq polymerase, Hi-Fi polymerase, Tbr polymerase, Tfl polymerase, Pfutubo polymerase, Pyrobest polymerase, Pwo polymerase, KOD polymerase, Bst polymerase, Sac polymerase, Klenow fragment, and their variants, modified products and derivatives. For a certain hot start polymerase, a denaturation step of 2 minutes to 10 minutes at 94°C-95°C may be required, which may change the thermal curve according to different polymerases. Nucleases can degrade probes under appropriate conditions. For example, the nuclease may be a polymerase and have exolytic activity and degrade the probe, thereby generating a detectable signal. The nuclease may be able to release the quencher from the probe under appropriate conditions.

[0055] The kit may include instructions for using any of the foregoing substances in the methods described herein. Detection reagents, including primers, probes, solid supports with bound probes, and other detection reagents, and appropriate instructions and other required reagents may be provided in the kit to perform the detection as described herein. Typically, the kit contains in separate containers: a combination of primers and probes (either already bound to a solid support; or separately, with reagents to bind them to a matrix), control formulations (positive and / or negative), labeling reagents—when the detection format requires, and signal generating reagents (e.g., enzyme substrates)—if the label does not directly generate a signal. Instructions for performing the detection (e.g., written, tape, VCR, CD-ROM, etc.) are typically included in the kit. Depending on the specific detection used, the kit may also include other packaging reagents and materials (i.e., elution buffer, etc.). Standard detection, such as the detection described herein, can be performed with these kits. The instructions are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate such as paper or plastic. Similarly, the instructions can be present in the kit as a package insert, on a label of a container of the kit or its components (e.g., associated with a package or subpackage), etc. In other embodiments, the instructions are present as an electronically stored data file on a suitable computer-readable storage medium, such as a CD-ROM, disk, etc., including the same medium on which the program is present. The kit can also contain instructions for using the kit to detect BKV in a sample using a method, including a PCR method. Buffers, dNTPs, and controls (e.g., positive and negative control nucleic acids) can also be included in the kit for practicing the method. The primers in the reagent can be detectably labeled or unlabeled.

[0056] In another aspect, the present application also provides use of the composition described herein or the kit described herein in fungal detection.

[0057] In another aspect, the present application also provides use of the composition described herein or the kit described herein in detecting fungi using a qPCR method.

[0058] In another aspect, the present application also provides a method for detecting fungi using qPCR, comprising:

[0059] The composition described herein or the kit described herein is used to perform qPCR on the sample to be tested on a qPCR instrument, and the presence or absence of fungi in the sample is determined based on the result of qPCR.

[0060] In some embodiments, the sample to be tested can be a biological sample. The sample can be derived from a biological sample. The biological sample can be, for example, blood, plasma, serum, urine, saliva, mucosal secretions, sputum, feces or tears. The biological sample can be a fluid sample. The fluid sample can be blood or plasma. The biological sample can include cell-free nucleic acids (e.g., cell-free RNA, cell-free DNA, etc.). In some embodiments, the sample can be a cell product to be tested.

[0061] In some embodiments, the extraction of the sample to be tested can be performed by magnetic bead extraction, column extraction, boiling lysis, etc. In some embodiments, the sample can be processed simultaneously with, before, or after the method of the present disclosure. The sample can be processed to purify or enrich nucleic acids (e.g., purify nucleic acids from a plasma sample). The sample containing nucleic acids can be processed to purify or enrich the target nucleic acid.

[0062] The present application describes multiple embodiments, but the description is exemplary rather than restrictive, and it is obvious to those skilled in the art that there may be more embodiments and implementations within the scope of the embodiments described in the present application. Although many possible feature combinations are shown in the drawings and discussed in the specific embodiments, many other combinations of the disclosed features are also possible. Unless specifically limited, any feature or element of any embodiment may be used in combination with any other feature or element in any other embodiment, or may replace any other feature or element in any other embodiment.

[0063] The present application includes and contemplates combinations of features and elements known to those of ordinary skill in the art. The embodiments, features and elements disclosed in the present application may also be combined with any conventional features or elements to form a unique invention scheme. Any features or elements of any embodiment may also be combined with features or elements from other invention schemes to form another unique invention scheme. Therefore, it should be understood that any feature shown and / or discussed in the present application may be implemented individually or in any appropriate combination. Therefore, except for the limitations made according to the attached claims and their equivalents, the embodiments are not subject to other restrictions. In addition, various modifications and changes may be made within the scope of protection of the attached claims.

[0064] In addition, when describing representative embodiments, the specification may have presented the method and / or process as a specific sequence of steps. However, to the extent that the method or process does not rely on the specific order of the steps described herein, the method or process should not be limited to the steps of the specific order described. As will be understood by those of ordinary skill in the art, other sequences of steps are also possible. Therefore, the specific sequence of the steps set forth in the specification should not be interpreted as a limitation to the claims. In addition, the claims for the method and / or process should not be limited to the steps of performing them in the order written, and those skilled in the art can easily understand that these sequences can be changed and still remain within the spirit and scope of the embodiments of the present application.

[0065] The experimental methods in the following examples without specifying specific conditions are usually measured according to national standards. The experimental materials in the following examples without specifying the source are all commercially available raw materials. The equipment used in each step in the following examples is conventional equipment. If there is no corresponding national standard, it is carried out according to the general international standards, conventional conditions, or according to the conditions recommended by the manufacturer. Unless otherwise defined or specified, all professional and scientific terms used in this application have the same meaning as those familiar to those skilled in the art. In addition, any method and material similar or equal to the recorded content can be applied to the method of this application.

[0066] Example

[0067] Example 1. Design of primer-probe combination

[0068] 1. Primer design

[0069] The Aspergillus niger 18S rRNA gene sequence was found on NCBI (Gene Bank: NG_065763.1). The Run Blast function on the system was then run to select 3600 sequences for comparison. The obtained sequences included but were not limited to the 18S rRNA gene sequences of Aspergillus brasiliensis., Candida albicans, and Aspergillus niger. In the comparison results, NCBI MSA Viewer was selected to perform a graphical analysis of the comparison results. The results are shown in the figure below. Figure 1 shown.

[0070] The conserved region in the alignment result is selected to obtain the conserved sequence of the conserved region.

[0071] During the comparison process, it was found that in the obtained conservative sequence, some bases sometimes appeared in the sequence that were different from the main conservative sequence in the original 18s rRNA. In order to ensure normal detection, degenerate bases were designed (i.e., two or more different bases were designed at the same site). The use of degenerate bases is as follows:

[0072]

[0073] Primers and probes were designed using the conservative sequence as a template. The specific results are shown in Table 1 below:

[0074] Table 1 Sequence information of primers and probes

[0075]

[0076]

[0077] 2. Specificity analysis

[0078] The designed primers were analyzed for specificity using the primer blast function of NCBI, and the template was selected as Homo sapiens. The analysis results are shown in Table 2 below:

[0079] Table 2

[0080] combination 1 2 3 4 5 Match yes no no no no

[0081] The results are as follows Figure 2 As shown, by matching the designed primers with human genomic DNA, it was found that the primer sequence of combination 1 was highly matched with the human genome, and there was a high possibility of specific amplification in subsequent detection.

[0082] Example 2. Primer-probe combination verification screening

[0083] 1. Sample preparation

[0084] The Aspergillus niger 18S rRNA plasmid was diluted to 4 × 10 7 copies / mL (high concentration), 4×10 5 copies / mL (low concentration), stored at -20°C for future use.

[0085] 2. Reagent preparation

[0086] Take out each component reagent, place it on the table, wait until it is balanced to room temperature, shake gently to mix, and then centrifuge instantly. Use the above primers and probes to prepare the corresponding amplification reagents. The specific system preparation is as shown in Table 3:

[0087] Table 3

[0088]

[0089]

[0090] Note: The specific preparation quantity is N+2, "N" is the theoretical verification quantity, and the specific preparation quantity should be based on the actual test number. The number in this experiment is 27.

[0091] Vortex the prepared amplification mix to mix well, dispense 20 μL into eight-tube strips, add 5 μL of prepared samples (high concentration and low concentration) and water (negative sample), cover the tube (check whether it is tight), and centrifuge instantly.

[0092] 3. Amplification detection

[0093] The specific steps are as shown in Table 4:

[0094] Table 4

[0095]

[0096] Place the above eight tubes into real-time fluorescence quantitative PCR and set the amplification channel according to the following parameters: Select the FAM channel.

[0097] 4. Results Analysis

[0098] Amplification results are shown in Figure 3 and Figure 4 , Table 5 below shows the amplification Ct values ​​of positive samples:

[0099] Table 5

[0100] combination High concentration Low concentration 1 20.26 27.71 2 16.07 23.20 3 16.59 24.29 4 14.99 22.20 5 15.83 22.67

[0101] Comprehensive analysis of factors such as amplification efficiency, nonspecificity, and fluorescence increase of the amplification curve revealed that combinations 1 and 2 had nonspecific amplification in negative samples, and combinations 4 and 5 had better amplification efficiency. Therefore, combinations 2, 3, and 4 can be used as alternative combinations for subsequent verification.

[0102] Example 3. Background human genomic DNA interference verification

[0103] Sample preparation

[0104] Human genomic DNA was diluted to 2 ng / μL using enzyme-free water and stored at -20°C for later use.

[0105] The amplification reagents were prepared according to the operating steps of Example 2 and tested. The results are as follows Figure 5 Human genomic DNA was added to the amplification system for verification, and it was found that both combinations 3 and 4 had different degrees of non-specific amplification, and combination 5 still had no amplification signal after 45 cycles of amplification, and could be used for detection.

[0106] Example 4. Sensitivity Verification

[0107] 1. Sample preparation

[0108] DNA standards of Candida albicans, Aspergillus niger and Aspergillus brasiliensis were diluted to 2000 copies / mL (S1), 1000 copies / mL (S2), 400 copies / mL (S3) and 200 copies / mL (S4) respectively using enzyme-free water and stored at -20°C for later use.

[0109] 2. Reagent preparation

[0110] Take out each component reagent, place it on the table, wait until it is balanced to room temperature, shake gently to mix, and then centrifuge instantly. Use the above primers and probes to prepare the corresponding amplification reagents. The specific system preparation is as shown in Table 6:

[0111] Table 6

[0112] Components Dosage / test (μL) 5×qPCR Premix 5 Upstream primer (10 μM) 1 Downstream primer (10 μM) 1 Probe (10 μM) 0.5 Enzyme-free water Make up to 20 μL

[0113] Note: The specific preparation quantity is N+2, "N" is the theoretical verification quantity, and the specific preparation quantity should be based on the actual test number. The number in this experiment is 19.

[0114] Vortex the prepared amplification mix to mix well, dispense 25 μL into eight-tube strips, add 5 μL of the prepared sample, cover the tube (check whether it is tight), and centrifuge instantly.

[0115] 3. Amplification detection

[0116] The specific steps are as shown in Table 7:

[0117] Table 7

[0118]

[0119] Place the above eight tubes into real-time fluorescence quantitative PCR and set the amplification channel according to the following parameters: Select the FAM channel.

[0120] 4. Results Analysis

[0121] The amplification test results are shown in Table 8 below:

[0122] Table 8

[0123] sample Candida albicans Aspergillus niger Aspergillus brasiliensis S1 + + + S2 + + + S3 + + + S4 - - +

[0124] Note: “+” indicates amplification signal, “-” indicates no amplification signal

[0125] The three combinations were verified for Candida albicans, Aspergillus niger and Aspergillus brasiliensis respectively, and the samples with a concentration of more than 400 copies / mL (i.e., 2 copies / reaction) were all able to be detected normally.

[0126] Although the embodiments of the present application have been shown and described above, it can be understood that the above embodiments are exemplary and cannot be understood as limitations on the present application. Ordinary technicians in this field can change, modify, replace and modify the above embodiments within the scope of the present application.

Claims

1. A composition comprising: An upstream bait oligonucleotide and a downstream bait oligonucleotide, wherein the upstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

2.

2. The composition according to claim 1, characterized in that The upstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:1, and the downstream decoy oligonucleotide is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

2.

3. The composition according to claim 2, characterized in that The upstream bait oligonucleotide is the sequence shown in SEQ ID NO:1, and the downstream bait oligonucleotide is the sequence shown in SEQ ID NO:

2.

4. The composition according to any one of claims 1 to 3, characterized in that The composition also comprises a probe sequence that is derived from at least 20%, 25%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:

3.

5. The composition according to claim 4, characterized in that The probe sequence is derived from at least 90%, 95%, 96%, 97%, 98%, 99% or 100% of the sequence shown in SEQ ID NO:3; preferably, the probe sequence is the sequence shown in SEQ ID NO:

3.

6. The composition according to claim 4 or 5, characterized in that Both ends of the probe sequence are modified with a fluorescent reporter group and a fluorescent quencher group corresponding to the fluorescent reporter group; the fluorescent reporter group is FAM, VIC, HEX, ROX or CY5, and the fluorescent quencher group is BHQ1, BHQ2, BHQ3 or MGB.

7. The composition according to any one of claims 1 to 6, characterized in that The length of the fragments amplified by the upstream bait oligonucleotide and the downstream bait oligonucleotide is about 80-250 bp.

8. The composition according to any one of claims 4 to 7, characterized in that The working concentration of the upstream bait oligonucleotide, the downstream bait oligonucleotide and the probe sequence is about 5-15 μM; preferably, the working concentration of the upstream bait oligonucleotide, the downstream bait oligonucleotide and the probe sequence is about 10 μM.

9. A kit comprising the composition of any one of claims 1-8.

10. Use of the composition according to any one of claims 1 to 8 or the kit according to claim 9 in fungal detection.

11. Use of the composition according to any one of claims 1 to 8 or the kit according to claim 9 in detecting fungi using a qPCR method.

12. A method for detecting fungi using qPCR, comprising: qPCR is performed on the sample to be tested using the composition according to any one of claims 1 to 8 or the kit according to claim 9 on a qPCR instrument, and the presence or absence of fungi in the sample is determined based on the result of qPCR.

Images