A primer combination for specific detection of watermelon leaf spot pathogen and its application

Abstract

The present invention relates to the technical field of molecular detection, and particularly to a primer combination for detecting watermelon leaf blight pathogen and an application thereof. The primer combination comprises an upstream primer SEQ1 and a downstream primer SEQ2; wherein the primer sequence of SEQ1 is shown in SEQ ID NO.01, has a sequence length of 19 bp, and a GC content of 74%; the primer sequence of SEQ2 is shown in SEQ ID NO.02, has a sequence length of 21 bp, a melting temperature of 58.3°C, and a GC content of 74%; the primer combination SEQ1 and SEQ2 can effectively distinguish watermelon leaf blight from leaf blight caused by Fusarium, Alternaria, bacteria, and anthracnose, has the ability to specifically detect watermelon leaf blight pathogen, and has high sensitivity. Even in the early stage of the disease, when the number of pathogens is small, the presence of the pathogens can be detected, thereby facilitating timely and accurate prevention and control measures.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular detection, in particular to a watermelon leaf spot pathogen-specific detection primer combination and application thereof. Background Art

[0002] Watermelon is an annual climbing herbaceous plant of the genus Citrullus in the Cucurbitaceae family. It is native to tropical Africa and has a long history of cultivation and a wide distribution area. In my country, due to its short growth cycle, wide adaptability and strong drought resistance, high returns and quick results, watermelon has become one of the important economic crops for rural prosperity. With the continuous domestication of watermelon, the susceptibility of cultivated varieties of watermelon to diseases has become increasingly stronger during the planting process. The leaf spot caused by the genus Cercospora on watermelon is one of them. Investigations and studies have found that it can not only cause diseases on the leaves of watermelon, but also infect vines, cotyledons and fruits, resulting in necrotic spots or even death of cotyledons, leaves and vines, and rot of fruits, which seriously endangers the production, storage and transportation of watermelon. Since the leaf disease symptoms caused by watermelon leaf blight on watermelon are very similar to leaf blight caused by Fusarium, Alternaria, bacteria and anthracnose, it is difficult to distinguish. Watermelon leaf blight and watermelon anthracnose are also difficult to distinguish, and the ordinary isolation and identification methods are relatively slow, which will limit the precise prevention and control of the disease. In view of this, we propose a watermelon leaf blight pathogen-specific detection primer combination and its application. Summary of the Invention

[0003] The purpose of the present invention is to provide a specific detection primer combination for watermelon leaf spot pathogen and its application, so as to solve the problems raised in the above background technology.

[0004] To achieve the above object, the present invention provides a primer combination for specific detection of watermelon leaf spot pathogen, the primer combination comprising an upstream primer SEQ1 and a downstream primer SEQ2;

[0005] Among them, the primer sequence of SEQ1 is GGGCGACCCTGCCGTTTCG (SEQ ID NO. 01), with a sequence length of 19 bp, a melting temperature of 59.7°C, and a GC content of 74%;

[0006] The primer sequence of SEQ2 is GACTTTGAGGCGCGCGGAACA (SEQ ID NO. 02), with a sequence length of 21 bp, a melting temperature of 58.3°C, and a GC content of 74%.

[0007] Preferably, the method for obtaining the specific detection primer combination for watermelon leaf spot is as follows: by analyzing the ribosome internal transcribed spacer region, translation elongation factor gene, histone gene and actin gene sequence of 30 Cercospora fungi and Alternaria, Botrytis, Cladosporium, Bacillus, Botrytis cinerea, Fusarium, and Cercospora fungi, specific primers for watermelon leaf spot detection are designed according to the ITS sequence of Cercospora fungi.

[0008] The ITS sequence of the Cercospora fungus is shown in SEQ ID NO.03, specifically:

[0009] TGGGCTGATGATTCGGGCTCGACCTCCACCCTTTGTGAACACAACTTGTTGCTTCGGGGGCGACCCTGCCGTTTCGACGGCGAGCGCCCCCGGAGGCCTTCAAACACTGCATCTTTGCGTCGGAGTTTAAGTAAATTAAACAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAAT CTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTTCACCACTCAAGCCTCGCTTGGTATTGGGCGCCGGTGTTCCGCGCGCCTCAAAGTCTCCGGCTGAGCTGTCCGTCTCTAAGCGTTGTGATTTCATTAATCGCTTCGGAGCGCGGGCGGTCGCGGCCGTTAAATCTTTCACAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAAC;

[0010] Preferably, the watermelon leaf blight pathogen-specific detection primer combination is used in the early diagnosis and identification of watermelon leaf blight pathogen.

[0011] Preferably, the method for specific detection of watermelon leaf spot pathogen by the primer combination comprises the following specific steps:

[0012] S1: Extract the genomic DNA to be tested as a template;

[0013] S2: using SEQ1 and SEQ2 as primers, adopting PCR amplification method to obtain PCR amplification products, and performing gel electrophoresis detection using electrophoresis detection method;

[0014] S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen.

[0015] Preferably, the CTAB method is used to extract the genomic DNA to be tested, and the specific steps are as follows:

[0016] S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube. Add 600 μL of CTAB extraction buffer to each tube, add two steel beads, and disrupt the sample using a Tissuelyser-192 disruptor at a frequency of 60.00 Hz and a time of 240 s.

[0017] S1.2. After crushing, place in a 65°C water bath for 60 minutes, mixing by inverting every 15 minutes.

[0018] S1.3. After water bathing, add 600 mL of a mixture of chloroform and isoamyl alcohol (volume ratio of chloroform to isoamyl alcohol: 24:1), mix thoroughly, and centrifuge at 12,000 rpm for 10 minutes.

[0019] S1.4. Take 600 μL of the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and then place at -20°C for 30 min.

[0020] S1.5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until the ethanol smell is gone.

[0021] S1.6. Add 200 μL of ddH2O containing 1 μL of 10 mg / mL RNase and incubate in a 65°C water bath for 20 min to obtain genomic DNA.

[0022] Preferably, the PCR reaction system of the PCR amplification method is: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), and 3.2 μL of ddH2O, for a total of 10 μL.

[0023] Preferably, the PCR reaction procedure of the PCR amplification method is: stage 1: pre-denaturation at 94°C for 5 minutes; stage 2: denaturation at 94°C for 30 seconds, annealing at 68-72.5°C for 30 seconds, extension at 72°C for 30 seconds, for a total of 35 cycles; stage 3: extension at 72°C for 5 minutes; stage 4: hold at 4°C.

[0024] Preferably, the electrophoresis detection method is specifically as follows:

[0025] Prepare 1.5% agarose gel with 1×TAE, heat in a microwave oven to completely dissolve, then cool slightly to 45-55°C, add nucleic acid dye at a ratio of 1:10,000 and shake well, then pour into a gel tank with comb teeth inserted. After the gel is completely solidified, remove the comb teeth, take 4μL of PCR amplification product, add 1μL of 10× loading buffer, mix well, and add to the sample wells. Run electrophoresis at 130V for 20 minutes. After the electrophoresis, take pictures with a gel imager and determine the size of the target fragment by comparing with the DL2000 DNA Marker.

[0026] Preferably, the minimum detection limit of the primer combination for watermelon leaf spot pathogen is 100 pg / μL.

[0027] Preferably, the primer combination has a detection rate of 100% for watermelon leaf spot pathogen samples.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The watermelon leaf blight pathogen-specific detection primer combination and its application use use primer combinations SEQ1 and SEQ2 to specifically detect Cercospora strains through common PCR, thereby achieving qualitative detection of the watermelon leaf blight pathogen. Simultaneously, the disease caused by Cercospora in watermelon can be rapidly detected, and the presence of the pathogen can be detected in the early stage of leaf blight inoculation. The detection rate of diseased samples is as high as 100%, and the detection accuracy is high and the specificity is good, which is crucial for timely and accurate prevention and control measures. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 Schematic diagram of primer combination annealing temperature and specific amplification test results;

[0031] Figure 2 Schematic diagram of the primer combination specific amplification detection experimental results;

[0032] Figure 3 Schematic diagram of the primer combination sensitivity detection experimental results;

[0033] Figure 4 This is a schematic diagram of the test results of primer combinations for detecting diseased samples inoculated with watermelon leaf spot pathogen at different times;

[0034] Figure 5 Schematic diagram of photos of watermelon leaves cultured for 1 day, 2 days, and 3 days after inoculation;

[0035] Figure 6 This is a schematic diagram of the symptoms of watermelon leaf spot disease;

[0036] Figure 7 This is the result of microscopic observation of watermelon leaf spot pathogen;

[0037] Figure 8 This is the colony morphology of watermelon leaf spot pathogen.

[0038] Illustration description:

[0039] Figure 1 In the middle, 1: Alternaria; 2: Botrytis cinerea; 3: Cladosporium; 4: Cladosporium; 5: Botrytis cinerea; 6: Fusarium; 7: Cyperus rotundus; 8: Watermelon leaf spot; M: DL2000 DNA Marker;

[0040] Figure 2 Middle, 1: watermelon leaf spot pathogen; 2: healthy diseased leaves of watermelon; N: negative control;

[0041] Figure 3 Medium, stock solution: 15 ng / μL; 5×: 3 ng / μL; 10×: 1.5 ng / μL; 50×: 0.3 ng / μL; 100×: 0.15 ng / μL; 150×: 0.1 ng / μL; 200×: 0.05 ng / μL; N: negative control;

[0042] Figure 4 In the middle, 1-3: 1-day-old diseased leaves; 4-6: 2-day-old diseased leaves; 7-9: 3-day-old diseased leaves; 10, 11: DNA of watermelon leaf spot pathogen; CK1, CK2: healthy watermelon leaves; N: negative control;

[0043] Figure 6 Middle, A: leaf lesions; B: leaf symptoms; CF: fruit symptoms; G: cotyledon symptoms; H, I: vine symptoms;

[0044] Figure 7 Middle, A: conidiophore; BC: conidia DETAILED DESCRIPTION

[0045] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0046] The invention discloses a primer combination for detecting watermelon leaf spot pathogenic fungus, comprising the following components: the primer combination comprises an upstream primer SEQ1 and a downstream primer SEQ2;

[0047] Among them, the primer sequence of SEQ1 is GGGCGACCCTGCCGTTTCG (SEQ ID NO.01), with a sequence length of 19 bp, a melting temperature of 59.7°C, and a GC content of 74%;

[0048] The primer sequence of SEQ2 is GACTTTGAGGCGCGCGGAACA (SEQ ID NO. 02), with a sequence length of 21 bp, a melting temperature of 58.3°C, and a GC content of 74%.

[0049] Example 1: Annealing temperature and specific amplification test of a primer combination for specific detection of watermelon leaf spot pathogen:

[0050] S1: Extract the genomic DNA to be tested as a template, and use the CTAB method to extract the genomic DNA of Alternaria, Botrytis cinerea, Cladosporium, Cladosporium, Botrytis cinerea, Fusarium, Fusarium wilt, and Watermelon leaf spot pathogen respectively. The specific steps of genomic DNA extraction are as follows:

[0051] S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube. Add 600 μL of CTAB extraction buffer to each tube, add two steel beads, and disrupt the sample using a Tissuelyser-192 disruptor at a frequency of 60.00 Hz and a time of 240 s.

[0052] S1.2. After crushing, place in a 65°C water bath for 60 minutes, mixing by inverting every 15 minutes.

[0053] S1.3. After water bathing, add 600 mL of a mixture of chloroform and isoamyl alcohol (volume ratio of chloroform to isoamyl alcohol: 24:1), mix thoroughly, and centrifuge at 12,000 rpm for 10 minutes.

[0054] S1.4. Take 600 μL of the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and then place at -20°C for 30 min.

[0055] S1.5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until the ethanol smell is gone.

[0056] S1.6. Add 200 μL of ddH2O containing 1 μL of 10 mg / mL RNase and incubate in a 65°C water bath for 20 min. Obtain genomic DNA from Alternaria, Botrytis cinerea, Cladosporium sporeans, Cladosporium spp., Botrytis cinerea, Fusarium spp., Psoralea corylifolia, and Psoralea corylifolia. Detect the fungal DNA concentrations using a NanoPhotometer® N50, using a 1 μL sample volume to maintain a consistent fungal DNA concentration.

[0057] S2: Using SEQ1 and SEQ2 as primers, a PCR amplification method was used to obtain PCR amplification products, which were then detected by gel electrophoresis. Six groups of PCR amplification experiments were performed, with annealing temperatures of 65°C, 66.5°C, 68°C, 69.5°C, 71°C, and 72.5°C, respectively.

[0058] The PCR reaction system was as follows: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), and 3.2 μL of ddH2O, for a total of 10 μL. The PCR reaction program was as follows: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 65°C, 66.5°C, 68°C, 69.5°C, 71°C, and 72.5°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C;

[0059] The specific electrophoresis detection method is as follows:

[0060] Prepare a 1.5% agarose gel with 1×TAE. Heat in a microwave to completely dissolve it, then cool it slightly to 45-55°C. Add a nucleic acid dye at a ratio of 1:10,000 and shake well. Pour the gel into a gel tank with a comb inserted. After the gel is completely solidified, remove the comb. Take 4 μL of PCR amplification product and add 1 μL of 10× loading buffer. Mix well and add the gel to the sample wells. Run electrophoresis at 130V for 20 minutes. After the electrophoresis, take a picture with a gel imager and determine the size of the target fragment by comparing it with a DL2000 DNA marker.

[0061] S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen;

[0062] Test results: Figure 1The results showed that when the annealing temperature was in the range of 65-66.5℃, the primer combination had non-specific amplification in the reference strains (Alternaria, Botrytis, Cladosporium, Scoparia, Botrytis cinerea, Fusarium, and Psoralea corylifolia). When the annealing temperature reached above 68℃, the primer combination could only specifically amplify a 300bp fragment in the genomic DNA of Psoralea corylifolia.

[0063] Example 2: Specific amplification detection experiment of a specific detection primer combination of watermelon leaf spot pathogen:

[0064] S1: Extract the genomic DNA to be tested as a template, select watermelon leaves infected with watermelon leaf spot pathogen and healthy watermelon leaves as samples to be extracted, and use the genomic DNA of healthy watermelon leaves as a reference to extract the genomic DNA of the watermelon leaves infected with watermelon leaf spot pathogen and the healthy watermelon leaves using the CTAB method. The specific steps of genomic DNA extraction are as follows:

[0065] S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube. Add 600 μL of CTAB extraction buffer to each tube, add two steel beads, and disrupt the sample using a Tissuelyser-192 disruptor at a frequency of 60.00 Hz and a time of 240 s.

[0066] S1.2. After crushing, place in a 65°C water bath for 60 minutes, mixing by inverting every 15 minutes.

[0067] S1.3. After water bathing, add 600 mL of a mixture of chloroform and isoamyl alcohol (volume ratio of chloroform to isoamyl alcohol: 24:1), mix thoroughly, and centrifuge at 12,000 rpm for 10 minutes.

[0068] S1.4. Take 600 μL of the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and then place at -20°C for 30 min.

[0069] S1.5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until the ethanol smell is gone.

[0070] S1.6. Add 200 μL of ddH2O containing 1 μL of 10 mg / mL RNase and incubate in a 65°C waterbath for 20 min to obtain genomic DNA from watermelon leaves infected with watermelon leaf spot pathogen and healthy watermelon leaves.

[0071] S2: using SEQ1 and SEQ2 as primers, adopting PCR amplification method to obtain PCR amplification products, and performing gel electrophoresis detection using electrophoresis detection method;

[0072] The PCR reaction system was as follows: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), and 3.2 μL of ddH2O, for a total of 10 μL. The PCR reaction program was as follows: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0073] The specific electrophoresis detection method is as follows:

[0074] Prepare a 1.5% agarose gel with 1×TAE. Heat in a microwave to completely dissolve it, then cool it slightly to 45-55°C. Add a nucleic acid dye at a ratio of 1:10,000 and shake well. Pour the gel into a gel tank with a comb inserted. After the gel is completely solidified, remove the comb. Take 4 μL of PCR amplification product and add 1 μL of 10× loading buffer. Mix well and add the gel to the sample wells. Run electrophoresis at 130V for 20 minutes. After the electrophoresis, take a picture with a gel imager and determine the size of the target fragment by comparing it with a DL2000 DNA marker.

[0075] S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen;

[0076] Test results: Figure 2 The results showed that the primer combination could only specifically amplify a 300bp fragment within the genome of the watermelon leaf spot pathogen, but did not amplify any fragment in the host (i.e., healthy diseased leaves of watermelon). Therefore, the primer combination can be used to specifically detect the presence of watermelon leaf spot pathogen in watermelon.

[0077] Example 3: Sensitivity test experiment of a specific primer combination for detecting watermelon leaf spot pathogen:

[0078] S1: Extract the genomic DNA to be tested as a template, select watermelon leaves infected with watermelon leaf spot pathogen as the sample to be extracted, and use the CTAB method to extract genomic DNA from watermelon leaves infected with watermelon leaf spot pathogen and healthy watermelon leaves respectively. The specific steps of genomic DNA extraction are as follows:

[0079] S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube. Add 600 μL of CTAB extraction buffer to each tube, add two steel beads, and disrupt the sample using a Tissuelyser-192 disruptor at a frequency of 60.00 Hz and a time of 240 s.

[0080] S1.2. After crushing, place in a 65°C water bath for 60 minutes, mixing by inverting every 15 minutes.

[0081] S1.3. After water bathing, add 600 mL of a mixture of chloroform and isoamyl alcohol (volume ratio of chloroform to isoamyl alcohol: 24:1), mix thoroughly, and centrifuge at 12,000 rpm for 10 minutes.

[0082] S1.4. Take 600 μL of the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and then place at -20°C for 30 min.

[0083] S1.5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until the ethanol smell is gone.

[0084] S1.6. Add 200 μL of ddH2O containing 1 μL of 10 mg / mL RNase and incubate in a 65°C water bath for 20 min to obtain genomic DNA of P. syringae pv. melonii.

[0085] S2: Take 15 ng / μL of genomic DNA of watermelon leaf spot pathogen, first dilute the genomic DNA of watermelon leaf spot pathogen 5, 10, 50, 100, 150, and 200 times to 3 ng / μL, 1.5 ng / μL, 0.3 ng / μL, 0.15 ng / μL, 0.1 ng / μL, and 0.075 ng / μL, then use SEQ1 and SEQ2 as primers, adopt PCR amplification method, obtain PCR amplification product, and perform gel electrophoresis detection by electrophoresis detection method;

[0086] The PCR reaction system was as follows: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), and 3.2 μL of ddH2O, for a total of 10 μL. The PCR reaction program was as follows: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0087] The specific electrophoresis detection method is as follows:

[0088] Prepare a 1.5% agarose gel with 1×TAE. Heat in a microwave to completely dissolve it, then cool it slightly to 45-55°C. Add a nucleic acid dye at a ratio of 1:10,000 and shake well. Pour the gel into a gel tank with a comb inserted. After the gel is completely solidified, remove the comb. Take 4 μL of PCR amplification product and add 1 μL of 10× loading buffer. Mix well and add the gel to the sample wells. Run electrophoresis at 130V for 20 minutes. After the electrophoresis, take a picture with a gel imager and determine the size of the target fragment by comparing it with a DL2000 DNA marker.

[0089] S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen;

[0090] Test results: Figure 3 The results showed that the primer combination was sensitive to watermelon leaf spot pathogen and could detect DNA samples with a minimum concentration of 100 pg / μL (i.e. 0.1 ng / μL).

[0091] Example 4: Detection experiment of a specific primer combination for watermelon leaf spot pathogen on diseased samples inoculated with watermelon leaf spot pathogen at different times:

[0092] Watermelon leaf spot pathogen was inoculated onto PDA culture medium and cultured at 28°C for 15 days before use. Sterile watermelon seedlings grown in the laboratory were disinfected with 75% alcohol, rinsed three times with sterile water, and then dried with sterile absorbent paper. Watermelon leaves were punctured with a disinfected inoculation needle, and a 6mm thick bacterial cake was taken from the edge of the watermelon leaf spot colony and inoculated into the wound, with the mycelium surface in contact with the leaf wound. The treatment with PDA culture medium was used as a negative control. The inoculated watermelon leaves were placed in a fresh-keeping box for moisturizing culture for 1, 2, and 3 days, and then samples were taken, quickly frozen with liquid nitrogen, and stored at -80°C.

[0093] S1: Extract the genomic DNA to be tested as a template; use the CTAB method to extract DNA from three diseased leaves inoculated with watermelon leaf spot pathogen for one day, labeled as sample 1, sample 2, and sample 3; extract DNA from three diseased leaves inoculated with watermelon leaf spot pathogen for two days, labeled as sample 4, sample 5, and sample 6; extract DNA from three diseased leaves inoculated with watermelon leaf spot pathogen for three days, labeled as sample 7, sample 8, and sample 9; extract DNA from two positive controls inoculated with watermelon leaf spot pathogen on PDA medium, labeled as samples 10 and 11; extract DNA from two healthy watermelon leaves, labeled as samples CK1 and CK2; and extract one blank control as sample N. The specific steps for genomic DNA extraction are as follows:

[0094] S1.1. Scrape 0.5 g of the sample to be extracted into a 2 mL centrifuge tube. Add 600 μL of CTAB extraction buffer to each tube, add two steel beads, and disrupt the sample using a Tissuelyser-192 disruptor at a frequency of 60.00 Hz and a time of 240 s.

[0095] S1.2. After crushing, place in a 65°C water bath for 60 minutes, mixing by inverting every 15 minutes.

[0096] S1.3. After water bathing, add 600 mL of a mixture of chloroform and isoamyl alcohol (volume ratio of chloroform to isoamyl alcohol: 24:1), mix thoroughly, and centrifuge at 12,000 rpm for 10 minutes.

[0097] S1.4. Take 600 μL of the supernatant, add an equal volume of pre-chilled isopropanol, mix well, and then place at -20°C for 30 min.

[0098] S1.5. Centrifuge at 12,000 rpm for 10 min, discard the supernatant, wash the precipitate once with 70% ethanol, and air-dry at room temperature until the ethanol smell is gone.

[0099] S1.6. Add 200 μL of ddH2O containing 1 μL of 10 mg / mL RNase and incubate in a 65°C water bath for 20 min to obtain genomic DNA.

[0100] S2: Samples 1-11, CK1-CK2, and N were amplified by PCR using SEQ1 and SEQ2 as primers to obtain PCR amplification products, which were then detected by gel electrophoresis using an electrophoresis detection method;

[0101] The PCR reaction system was as follows: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of SEQ1 (10 μM), 0.4 μL of SEQ2 (10 μM), and 3.2 μL of ddH2O, for a total of 10 μL. The PCR reaction procedure was as follows: stage 1: pre-denaturation at 94°C for 5 min; stage 2: denaturation at 94°C for 30 s, annealing at 68°C for 30 s, and extension at 72°C for 30 s, for a total of 35 cycles; stage 3: extension at 72°C for 5 min; stage 4: hold at 4°C.

[0102] The specific electrophoresis detection method is as follows:

[0103] Prepare a 1.5% agarose gel with 1×TAE. Heat in a microwave to completely dissolve it, then cool it slightly to 45-55°C. Add a nucleic acid dye at a ratio of 1:10,000 and shake well. Pour the gel into a gel tank with a comb inserted. After the gel is completely solidified, remove the comb. Take 4 μL of PCR amplification product and add 1 μL of 10× loading buffer. Mix well and add the gel to the sample wells. Run electrophoresis at 130V for 20 minutes. After the electrophoresis, take a picture with a gel imager and determine the size of the target fragment by comparing it with a DL2000 DNA marker.

[0104] S3: If a DNA band with a molecular weight of 300 bp is present, it indicates that the sample to be tested contains watermelon leaf spot pathogen;

[0105] Test results: Figure 5 These are photos of watermelon leaves cultured for 1, 2, and 3 days after inoculation. Figure 4 The results showed that the primer combination could reliably detect the presence of watermelon leaf spot pathogen at different time points (1 day, 2 days, and 3 days) after inoculation, and the detection rate of watermelon leaf spot pathogen diseased samples was as high as 100%.

[0106] In summary, by designing the primer combination SEQ1 and SEQ2, it is possible to effectively distinguish watermelon leaf blight from leaf blight caused by Fusarium, Alternaria, bacteria, and anthracnose. It has the ability to specifically detect watermelon leaf blight pathogens with high sensitivity. Even in the early stages of the disease, when the number of pathogens is small, its presence can be detected, which helps to take timely and accurate prevention and control measures.

[0107] The basic principles, main features, and advantages of the present invention are shown and described above. It should be understood by those skilled in the art that the present invention is not limited to the above-described embodiments. The above-described embodiments and descriptions are merely preferred examples of the present invention and are not intended to limit the present invention. Various changes and modifications may be made to the present invention without departing from the spirit and scope of the present invention, and such changes and modifications fall within the scope of the invention claimed.

Claims

1. A primer combination for detecting watermelon leaf spot pathogenic bacteria, characterized in that: The primer combination includes an upstream primer SEQ1 and a downstream primer SEQ2; wherein, the primer sequence of SEQ1 is GGGCGACCCTGCCGTTTCG, the sequence length is 19 bp, the melting temperature is 59.7°C, and the GC content is 74%; the primer sequence of SEQ2 is GACTTTGAGGCGCGCGGAACA, the sequence length is 21 bp, the melting temperature is 58.3°C, and the GC content is 74%; the primer combination is designed for the ITS sequence of Cercospora fungi by comparing and analyzing the internal ribosome transcribed spacer region, translation elongation factor gene, histone gene and actin gene sequence of 30 species of fungi, to ensure specific amplification of Cercospora citrullina, the watermelon leaf spot pathogen, and the amplified product is a 300 bp DNA band.

2. The primer combination for specific detection of watermelon leaf spot pathogen according to claim 1, wherein: The 30 fungi include Cercospora, Alternaria, Botrytis cinerea, Cladosporium, Scoparia, Botrytis cinerea, Fusarium spp. and Cercospora spp.; the primer combination can avoid cross-amplification with the above non-target fungi.

3. The use of the watermelon leaf spot specific detection primer combination according to claim 1 or 2 in the early diagnosis and identification of watermelon leaf spot pathogens, characterized in that: The primer combination can still achieve a 100% disease sample detection rate when the pathogen concentration is as low as 100 pg / μL.

4. The use according to claim 3, characterized in that The following steps are involved: S1: The genomic DNA of the sample to be tested was extracted using the CTAB method and used as a template; S2: SEQ1 and SEQ2 were used as primers to obtain the amplified product by PCR amplification; S3: The amplified product is tested by gel electrophoresis. If a DNA band with a molecular weight of 300 bp is present, it is proved that the sample to be tested contains watermelon leaf spot pathogen.

5. The use according to claim 4, characterized in that: The CTAB method includes the following steps: S1.1: Take 0.5g of sample and put it into a 2mL centrifuge tube, add 600μL CTAB extraction buffer, put in 2 steel balls, and crush it with a Tissuelyser-192 crusher, frequency 60.00Hz, time 240s; S1.2: 65℃ water bath for 60min, mix once every 15min; S1.3: Add 600μL chloroform-isoamyl alcohol mixture; the volume ratio of chloroform to isoamyl alcohol in the mixture is 24:1, and after mixing, centrifuge at 12000rpm for 10min; S1.4: Take 600μL supernatant, add an equal volume of pre-cooled isopropanol, and place at -20℃ for 30min; S1.5: Centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate with 70% ethanol, and air-dry; S1.6: Add 200μL containing 10mg / mL RNase-free ddH2O was added and the mixture was incubated at 65℃ for 20min to obtain genomic DNA.

6. The use according to claim 4, characterized in that: The PCR amplification reaction system was as follows: 1 μL of 50 ng / μL genomic DNA, 5 μL of Taq Mix, 0.4 μL of 10 μM SEQ1, 0.4 μL of 10 μM SEQ2, 3.2 μL of ddH2O, and a total volume of 10 μL.

7. The use according to claim 4, characterized in that: The reaction procedure of the PCR amplification is as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 68-72.5°C for 30 s, extension at 72°C for 30 s, 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

8. The use according to claim 4, characterized in that: The gel electrophoresis detection method is as follows: prepare 1.5% agarose gel, add 1:10000 nucleic acid dye, pour into the gel tank, take 4 μL PCR amplification product and mix with 1 μL 10× loading buffer after solidification, apply sample, perform electrophoresis at 130V for 20 minutes, take pictures with a gel imager, and compare with DL2000 DNA marker to determine the fragment size.

9. The use according to claim 4, characterized in that: The minimum detection limit of the primer combination for watermelon leaf spot pathogen is 100 pg / μL.

10. The use according to claim 4, characterized in that: The detection rate of the primer combination for watermelon leaf spot pathogen samples reached 100%.

Images