Faraday cage type aptamer sensor based on MOF nano-film and method for detecting staphylococcus aureus by using Faraday cage type aptamer sensor

Abstract

The invention relates to a Faraday cage type aptamer sensor based on an MOF (Metal Organic Framework) nano film and a method for detecting staphylococcus aureus by using the Faraday cage type aptamer sensor. The Zr-based MOF nano-films with different hafnium doping proportions are synthesized by taking ferrocene dicarboxylic acid as a ligand and zirconium / hafnium as a central atom and adopting a method from bottom to top. The large-size Zr / Hf-MOF nano-film with excellent conductivity is selected as a two-dimensional signal probe and is used for constructing an aptamer sensor of a Faraday cage, when staphylococcus aureus exists, the Zr / Hf-MOF nano-film is attached to the surface of an electrode to form a Faraday cage sensing interface, an outer Helmholtz plane layer is expanded on the interface, and the surface of the Faraday cage sensing interface is used for sensing the staphylococcus aureus. Direct transmission of electrons between the electrode and the signal probe is caused, so that the staphylococcus aureus is detected through an electrochemical workstation. According to the detection method, detection of a large target can be achieved according to the requirements for the size and conductivity of the MOF nano-film, effective amplification of an electric signal is achieved through a Faraday cage structure, and excellent detection specificity and sensitivity are achieved.

Description

Technical Field

[0001] The invention relates to the technical field of functional materials and biosensors, and in particular to a MOF nanofilm-based Faraday cage aptamer sensor and a method for detecting Staphylococcus aureus thereof. Background Art

[0002] Staphylococcus aureus (S. aureus) is a life-threatening pathogen that poses a significant risk to food safety and public health. Infections caused by S. aureus can range from mild gastroenteritis to severe organ dysfunction and sepsis, making the detection of S. aureus critical in food safety and medical diagnosis. Traditional methods for S. aureus detection are widely used, including microbial culture, enzyme-linked immunosorbent assay, and polymerase chain reaction (PCR). However, the long testing time, low sensitivity, cumbersome steps, and the need for expensive equipment make these methods less suitable for rapid detection needs. These limitations have stimulated the development of alternative technologies that aim to address the shortcomings of traditional methods while maintaining or improving accuracy and reliability.

[0003] Conventional sandwich electrochemical aptamer sensors are three-layer structures consisting of a pair of aptamers as biorecognition elements and a signal probe as signal output. However, this model encounters significant steric hindrance after capturing large targets, resulting in the captured signal probes being mostly distributed outside the outer Helmholtz plane (OHP). This means that the electron transport required for detection is difficult to occur, affecting the generation of signals and making it challenging to detect large targets. Faraday cage-based sensors have been constructed to address this challenge, which use conductive two-dimensional (2D) nanomaterials as signal probes and fixed recognition elements to construct signal units. After the target is specifically captured on the electrode surface, a sandwich structure of recognition unit-target unit-signal unit is formed. Due to the large area of ​​2D nanomaterials, they can become part of the electrode, which is equivalent to stretching the OHP layer and forming an electron transmission channel between the electrode and the signal unit. In addition, due to its large specific surface area, the 2D material itself carries more signal molecules than traditional sandwich sensors. However, most Faraday cage sensing platforms are built on carbon-based 2D materials. The dual loading of recognition probes and signal probes on their surfaces often compete with each other, limiting further signal enhancement.

[0004] Metal-organic frameworks (MOFs) are composed of organic ligands and metal ion subunits according to topological rules and have been successfully applied in the fields of gas storage and separation, sensing and catalysis. Compared with three-dimensional MOFs, two-dimensional MOF nanomaterials have a larger specific surface area, more active sites and faster electron transfer. Therefore, the application of conductive two-dimensional MOF nanomaterials as signal carriers not only expands the OHP layer and improves the electron transfer rate, but also is easy to load metal ions due to its high vacancy rate. These reasons simultaneously realize the in-situ modification of the recognition probe and the signal probe on the same carrier. It has been reported that Zr-MOF is a two-dimensional material with high conductivity, and the carboxyl group helps to improve its conductivity. In addition, it has been noted that the doping of metal atoms can further improve the conductivity of the material.

[0005] Therefore, there is an urgent need to provide a method for constructing an electrochemical Faraday cage immunosensor for detecting Staphylococcus aureus with good specificity, high sensitivity, fast detection speed, accurate and reliable results, and low cost, as well as to realize the detection of Staphylococcus aureus by electrochemical catalysis of ferrocene dicarboxylic acid and constructing a Faraday cage sensor using a nanomembrane. Summary of the invention

[0006] To solve the above technical problems, the present invention provides a Faraday cage type aptamer sensor based on MOF nanofilm and a method for detecting Staphylococcus aureus. The present invention constructs a Faraday cage based aptamer sensor based on a conductive two-dimensional Zr / Hf-MOF nanofilm for whole-cell detection of Staphylococcus aureus. The detection method of the present invention uses ferrocene dicarboxylic acid as a ligand and zirconium / hafnium as a central atom to synthesize a series of Zr-based MOF nanofilms with different hafnium doping ratios in a bottom-up method. AuNPs and Apt are modified on the nanofilm, and the in-situ grown AuNPs improve the conductivity of the two-dimensional MOF nanofilm and help Apt to be modified to the material through Au-S bonds to form a signal unit (Zr / Hf-MOF / AuNPs / Apt). When Staphylococcus aureus is present, the large surface area and highly conductive Zr / Hf-MOF is attached to the electrode surface to form multiple Faraday cage structures. In this way, the electron transfer in the aptamer sensor for whole-cell detection of Staphylococcus aureus is no longer hindered by the large target volume. Electrons can be directly transferred between the ferrocene (Fc) signal probe in the cage and the electrode surface, greatly improving the detection signal. The detection method of the Faraday cage sensor of the present invention can detect large targets, and the present invention realizes effective amplification of electrical signals through the Faraday cage structure system, and has excellent detection specificity and sensitivity.

[0007] The present invention is achieved through the following technical solutions:

[0008] The purpose of the present invention is to provide a method for detecting Staphylococcus aureus using a Faraday cage aptamer sensor based on MOF nanofilm, comprising the following steps:

[0009] S1, adding HAuCl4 and a reducing agent to the aqueous solution of the Zr / Hf-MOF nanomembrane to react, thereby obtaining a Zr / Hf-MOF nanomembrane loaded with AuNPs; adding an activated aptamer and an electron blocker to the aqueous solution of the obtained Zr / Hf-MOF nanomembrane loaded with AuNPs to react, thereby obtaining a signal unit Zr / Hf-MOF / AuNPs / Apt;

[0010] S2, drop-coating the activated aptamer on the surface of the gold electrode and incubating to obtain an AuR / Apt electrode; inserting the obtained AuR / Apt electrode into an electron blocker solution and incubating to obtain an AuR / Apt electrode with blocked nonspecific binding sites;

[0011] S3. Add the solution containing Staphylococcus aureus to the surface of the AuR / Apt electrode with blocked nonspecific binding sites obtained in step S2, and incubate it. Then, drop-coat the signal unit Zr / Hf-MOF / AuNPs / Apt obtained in step S1. After incubation at room temperature, detect the electrochemical differential pulse voltammetry signal of the obtained solution to perform qualitative or quantitative analysis of Staphylococcus aureus.

[0012] In one embodiment of the present invention, in step S1, the doping amount of hafnium in the Zr / Hf-MOF nanofilm is 1%-5%.

[0013] In one embodiment of the present invention, in step S1, the Zr / Hf-MOF nanofilm is prepared by the following method:

[0014] The zirconium salt, the hafnium salt and the redox mediator are dissolved in a mixed solution of an organic solvent and HAC, and heated to obtain a Zr / Hf-MOF nanofilm.

[0015] In one embodiment of the present invention, the zirconium salt is selected from ZrCl4;

[0016] And / or, the hafnium salt is selected from HfCl4;

[0017] And / or, the molar ratio of the zirconium salt to the hafnium salt is 9.0-9.9:0.1-0.5; preferably 9.5:0.5.

[0018] In one embodiment of the present invention, the redox mediator is selected from 1,1′-ferrocene carboxylic acid;

[0019] And / or, the organic solvent is selected from DMF.

[0020] In one embodiment of the present invention, in steps S1 and S2, the nucleotide sequence of the activated aptamer is as shown in SEQ ID NO.1.

[0021] In one embodiment of the present invention, in steps S1 and S2, the electron blocker includes 6-mercaptohexanol.

[0022] In one embodiment of the present invention, in step S2, the activated aptamer is obtained by dissolving the aptamer in a buffer solution and adding a TCEP solution to react at room temperature.

[0023] In one embodiment of the present invention, the buffer solution is selected from PBS buffer solution.

[0024] In one embodiment of the present invention, in step S3, the concentration of the solution containing Staphylococcus aureus is 10 1 CFU·mL -1 ~10 7 CFU·mL -1 .

[0025] The second object of the present invention is to provide a Faraday cage aptamer sensor based on MOF nanofilm, comprising a signal unit Zr / Hf-MOF / AuNPs / Apt, an aptamer and an electrode;

[0026] The Zr / Hf-MOF nanomembrane in the signal unit is modified with a redox mediator and an electron blocker.

[0027] The above technical solution of the present invention has the following advantages compared with the prior art:

[0028] (1) The present invention provides a Faraday cage type aptamer sensor based on MOF nanofilm and a method for detecting Staphylococcus aureus. The present invention uses ferrocenyl dicarboxylic acid as a ligand and zirconium / hafnium as a central atom, and adopts a bottom-up method to synthesize a series of Zr-based MOF nanofilms with different hafnium doping ratios. Ferrocyl dicarboxylic acid not only serves as an electrochemical signal molecule, but can also be used to in situ reduce gold nanoparticles (AuNPs) to provide a fixed site for the aptamer (Apt). The conductivity of the two-dimensional MOF nanofilm is improved by doping hafnium and in situ growing AuNPs. When Staphylococcus aureus is present, the two-dimensional Zr / Hf-MOF / AuNPs / Apt nanofilm as a signal unit is attached to the electrode surface to form a Faraday cage structure due to its large surface area and high conductivity. In this way, the electron transfer in the aptamer sensor for whole-cell detection of Staphylococcus aureus is no longer hindered by its large volume. Electrons can be directly transferred between the signal probe in the cage and the electrode surface, greatly improving the detection signal.

[0029] (2) The present invention designs and prepares the Staphylococcus aureus response unit Zr / 0.05Hf-MOF / AuNPs / Apt, which generates electrochemical signal changes that are recognized by the specificity of the Staphylococcus aureus site, and uses AuR to connect with Zr / 0.05Hf-MOF / AuNPs / Apt to form a Faraday cage structure, so that the electrochemical signal is greatly increased to detect Staphylococcus aureus. Compared with traditional detection methods, the present invention has the advantages of high specificity and high sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein:

[0031] Figure 1 It is a schematic diagram of the electrochemical method for detecting whole-cell Staphylococcus aureus using a Faraday cage-type aptamer sensor based on a two-dimensional high-conductivity Zr / 0.05Hf-MOF nanomembrane of the present invention;

[0032] Figure 2 is the signal response and detection standard curve of the Faraday cage biosensor of the present invention to Staphylococcus aureus of different concentrations, and af represents the following concentrations: 0 CFU·mL -1 , 10 1 CFU·mL -1 , 10 2 CFU·mL -1 , 10 3 CFU·mL -1 , 10 4 CFU·mL -1 , 10 5 CFU·mL -1 , 10 6 CFU·mL -1 , 10 7 CFU·mL -1 .

[0033] Figure 3 1 is the size of different MOFs tested under the atomic force microscope of the present invention; wherein A is Zr-MOF, B is Zr / 0.01Hf-MOF, C is Zr / 0.05Hf-MOF, D is Zr / 0.10Hf-MOF, and E is Zr / 0.20Hf-MOF; F is the height analysis profile of different MOFs: Zr-mof (a), Zr / 0.01Hf-MOF (b), Zr / 0.05Hf-MOF (c), Zr / 0.10Hf-MOF (d), and Zr / 0.20Hf-MOF (e);

[0034] Figure 4The present invention is an analysis of the conductivity and signal quantity of different MOFs; wherein A is the differential pulse voltammetry curve of different Zr / Hf-MOFs; B is the peak current of different Zr / Hf-MOFs; C is the electrochemical impedance spectrum of different Zr / Hf-MOFs; D is the electron transfer resistance value of different Zr / Hf-MOFs; in A and C: Zr-mof (a), Zr / 0.01Hf-MOF (b), Zr / 0.05Hf-MOF (c), Zr / 0.10Hf-MOF (d), Zr / 0.20Hf-MOF (e);

[0035] Figure 5 It is the specificity detection and stability detection of the Faraday cage sensor of the present invention; wherein A is the DPV current value diagram of the Faraday cage type ligand sensor for different bacteria; B is the stability result diagram of the Faraday cage aptamer sensor. DETAILED DESCRIPTION

[0036] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0037] The present invention provides an electrochemical method for detecting whole-cell Staphylococcus aureus using a Faraday cage aptamer sensor based on a Zr / 0.05Hf-MOF nanofilm, comprising the following steps:

[0038] S1. Add ZrCl4, HfCl4 in different proportions and 1,1′-ferrocenecarboxylic acid to DMF and HAC solutions, add the mixed suspension to a stainless steel autoclave and heat it to obtain a Zr / Hf-MOF nanomembrane. Select a high-conductivity, large-area Hf-doped Zr / Hf-MOF nanomembrane (Zr / Hf-MOF) by morphological and electrochemical characterization. Add HAuCl4 to the nanomembrane solution to react and obtain a Zr / Hf-MOF nanomembrane loaded with AuNPs. Centrifuge and purify for later use. Add the aptamer and MCH to the nanomembrane solution and react at room temperature to obtain a Zr / Hf-MOF / AuNPs / Apt complex as a signal unit.

[0039] S2. Preparation of AuR / Apt: Dissolve the aptamer in PBS buffer solution, add TCEP solution to react at room temperature, apply the reaction solution dropwise on the surface of the gold electrode and incubate. Then apply MCH solution dropwise on the AuR / Apt and incubate. MCH fills the vacancies to avoid nonspecific adsorption.

[0040] S3. Preparation of electrochemical Faraday cage sensor: Take Staphylococcus aureus and place it on the gold electrode surface of S2 for incubation, then drop the signal unit of S1 on the electrode surface and incubate at room temperature, then place the prepared sensor in PBS buffer solution for electrochemical differential pulse voltammetry (DPV) detection.

[0041] Furthermore, the selection method of the Zr / Hf-MOF nanofilm is as follows:

[0042] AFM confirmed that the Zr-MOF doped with less than or equal to 5% Hf was intact and thin. Then, Nafion reagent diluted to 0.5% was added to Zr / Hf-MOF with different Hf ratios to form a concentration of 1 mg mL -1 8 μL of the suspension was dropped on a 3 mm gold electrode and dried at room temperature to fix the Zr / Hf-MOF. Electrochemical DPV and EIS detections showed that the electrochemical signal of the Zr-MOF nanofilm with 0.05 Hf was the best.

[0043] Furthermore, the aptamer sequence aptamer needs to be activated by TCEP, a thiol activator, to avoid the formation of disulfide bonds between aptamers, which is beneficial to the formation of Au-S bonds.

[0044] Furthermore, the 5' end of the aptamer sequence is modified with a thiol group. The aptamer is modified on the electrode and the Zr / Hf-MOF / AuNPs nanofilm via an Au-S bond.

[0045] Furthermore, the aptamer sequence is as follows:

[0046] Apt:5′-SH-GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCG CTCGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-3′

[0047] Furthermore, the aptamer specifically binds to the cell wall of Staphylococcus aureus, which is beneficial to the specificity and sensitivity of the detection.

[0048] Furthermore, the detection system also includes a redox mediator and an electron blocker modified on the Zr / Hf-MOF signal unit.

[0049] Furthermore, the redox mediator includes ferrocene dicarboxylic acid, and the electron blocker includes 6-mercaptohexanol. The electron blocker can block the electron transfer between the electrode surface and the ions in the solution, so that the electron transfer can only be carried out through the ferrocene on the nanofilm, thereby achieving the amplification of the electrical signal.

[0050] Furthermore, the detection method is used in the preparation of Staphylococcus aureus detection products.

[0051] Furthermore, when detecting Staphylococcus aureus, the aptamer on the nanomembrane formed a Faraday cage structure on the gold electrode by specifically recognizing the target.

[0052] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0053] Example 1

[0054] This embodiment provides a Faraday cage aptamer sensor based on MOF nanofilm and a method for detecting Staphylococcus aureus (schematic diagram as shown in FIG. Figure 1 ), as follows:

[0055] (1) Preparation of Zr / 0.05Hf-MOF nanomembrane: 393.8 mg of ZrCl4, 28.3 mg of HfCl4 and 493.8 mg of 1,1′-ferrocene carboxylic acid were added to 60 mL of DMF and 3.4 mL of HAC, and ultrasonicated at 25°C for 30 min until completely dissolved. The mixed suspension was added to a 100 mL stainless steel autoclave and heated at 120°C for 12 h. After cooling to room temperature, centrifuged at 7000 rpm for 15 min to remove unreacted substances, and washed with fresh DMF and deionized water three times to obtain a black precipitated Zr / 0.05Hf-MOF nanomembrane, i.e., a 5% Hf-doped Zr / Hf-MOF nanomembrane. After freezing at -80°C for 12 h, the material was placed in a freeze dryer and dried for use.

[0056] (2) Preparation of signal unit: 100 mg Zr / 0.05Hf-MOF was dispersed in 100 mL deionized water by ultrasonic method for 30 min. 1 mL of 10 mg / mL -1 HAuCl4 solution was stirred at 30℃ for 30min. Under continuous stirring, a new NaBH4 (1mL, 0.1M) solution was added and reacted for 10min. The Zr / Hf-MOF / AuNPs nanomembrane precipitate was obtained and dispersed with 5mL deionized water. The Zr / Hf-MOF / AuNPs nanomembrane was added to PBS buffer containing 12μM aptamer and incubated in the dark at 25℃. 5μL of 11mM MCH solution was added to the mixture for 1h to block nonspecific sites. After centrifugation at 7000rpm for 15min, the free aptamer was removed, and then the mixture was resuspended in 100μL DNA hybridization buffer (10mMPBS, 1M NaCl, pH 7.4) after washing, and finally the signal unit Zr / 0.05Hf-MOF / AuNPs / Apt was obtained.

[0057] The sequence of the aptamer Apt is as follows:

[0058] 5′-SH-GCAATGGGTACGGTACTTCCTCGGCACGTTCTCAGTAGCGCT CGCTGGTCATCCCACAGCTACGTCAAAAGTGCACGCTACTTTGCTAA-3′

[0059] (3) Electrode cleaning and activation: The gold electrode (AuR) was polished with alumina polishing powder, and then ultrasonically cleaned in n-propanol, anhydrous ethanol, and deionized water for 5 min. The AuR was chemically cleaned using platinum as the auxiliary electrode and Ag / AgCl as the reference electrode. First, the AuR was cleaned in 0.5 mol·L - 1 The samples were cleaned in NaOH solution by CV program (voltage scanned from -1.5 V to -0.35 V, 500 scans at a scan rate of 4 V / s). -1 The electrode was cleaned by acid cleaning in H2SO4 solution using a CV program (voltage scanned from -0.35 V to 1.5 V, 100 scans at a scan rate of 1 V / s).

[0060] (4) Modification of electrochemical sensing interface: 2 μL 10 μmol L -1 The modified Apt was added to 16 μL PBS buffer and heated at 95°C for 5 min, then slowly cooled to room temperature to form the correct DNA structure. Subsequently, 2 μL 10 mmol·L - 1 TCEP, let stand at 25℃ for 1h to reduce disulfide bonds and form thiol groups. Add 200μL incubation solution, then incubate with AuR at 25℃ overnight to obtain AuR / Apt electrode, and wash the AuR / Apt electrode with 3mL PBS buffer and 3mL deionized water respectively. Insert the AuR / Apt electrode into a 200μL 0.5mmol·L -1 The electrodes were incubated in MCH solution at 25 °C for 1 h, and then washed with 6 mL of PBS buffer and 6 mL of deionized water, respectively, to block nonspecific binding sites with MCH.

[0061] (5) Electrochemical detection of Staphylococcus aureus: Under the optimal electrochemical analysis conditions, the sensitivity of the constructed electrochemical biosensor was analyzed. Staphylococcus aureus (10 1 CFU·mL -1 , 10 2CFU·mL -1 , 10 3 CFU·mL -1 , 10 4 CFU·mL -1 , 10 5 CFU·mL -1 , 10 6 CFU·mL -1 , 10 7 CFU·mL -1 ) were placed on the gold electrode surface of step (4) for incubation, and then the signal unit of step (2) was drop-coated on the electrode surface and incubated at room temperature. The prepared sensor was then placed in PBS (0.1 M, pH 7.0) for electrochemical differential pulse voltammetry (DPV) detection ( Figure 2 ). Through analysis, it was found that there was an obvious linear relationship between the logarithmic value of the Staphylococcus aureus concentration and the current change (ΔI) of the current response produced by it. The corresponding logarithmic linear regression equation is y = 172.30lg C S.aureus +55.98,(R 2 =0.992)(where the letter y represents the current change ΔI, C S.aureus represents the concentration of Staphylococcus aureus), and the detection limit (LOD) was calculated by the 3σ / slope rule to be 1.8 CFU·mL -1 (where σ is the standard deviation).

[0062] Example 2

[0063] This embodiment provides a Faraday cage-type aptamer sensor based on MOF nanomembrane and a method for detecting Staphylococcus aureus, which is similar to Example 1, except that the molar ratio of ZrCl4 to HfCl4 is 9.9:0.1, and a 1% Hf-doped Zr / Hf-MOF nanomembrane (Zr / 0.01Hf-MOF) is obtained.

[0064] Comparative Example 1

[0065] This comparative example provides a Faraday cage aptamer sensor based on MOF nanomembrane and a method for detecting Staphylococcus aureus thereof, which is similar to Example 1, except that: HfCl4 is not added to obtain a Zr / MOF nanomembrane.

[0066] Comparative Example 2

[0067] This comparative example provides a Faraday cage type aptamer sensor based on MOF nanomembrane and a method for detecting Staphylococcus aureus thereof, which is similar to Example 1, except that the molar ratio of ZrCl4 to HfCl4 is 9:1, and a 10% f-doped Zr / Hf-MOF nanomembrane (Zr / 0.1Hf-MOF) is obtained.

[0068] Comparative Example 3

[0069] This comparative example provides a Faraday cage type aptamer sensor based on MOF nanomembrane and a method for detecting Staphylococcus aureus thereof, which is similar to Example 1, except that the molar ratio of ZrCl4 to HfCl4 is 8:2, and a 20% f-doped Zr / Hf-MOF nanomembrane (Zr / 0.2Hf-MOF) is obtained.

[0070] Test Example 1 Selection of Zr / Hf-MOF Nanofilm

[0071] AFM confirmed that the Zr-MOF doped with 5% or less Hf was larger and thinner ( Figure 3 ). Then Nafion reagent diluted to 0.5% was added to 1 mg of Zr / Hf-MOF with different Hf ratios to form 1 mg mL -1 8 μL of the suspension was dropped onto a 3 mm gold electrode and dried at room temperature to fix the Zr / Hf-MOF. The results were detected by electrochemical differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS). Figure 4 As shown, it was determined that the electrochemical signal of the Zr-MOF nanofilm with 5% Hf was the best.

[0072] Test Example 2 Specificity and stability detection of Staphylococcus aureus

[0073] The selectivity of the Faraday cage ligand sensor was evaluated by five control experiments: blank, Bacillus subtilis, Salmonella typhi, Escherichia coli, and Staphylococcus aureus. Figure 5 A As can be seen, a significant DPV current is generated when S. aureus is present. No significant current was observed when identifying other bacteria, which is equivalent to the blank sample. These results indicate that the Faraday cage-based aptamer sensor has a high specificity for S. aureus. In order to investigate the stability of the Faraday cage-based aptamer sensor, five sets of electrodes were prepared and stored at 4 °C for subsequent use. S. aureus was tested every four days over a period of 16 days. Figure 5 As shown in Figure B, the detection percentages remained at 94.1%, 97.3%, 94.1% and 93.1% of the original values. The results show that the sensor has good stability.

[0074] Test Example 3 Practical Application and Reliability Analysis of Faraday Cage Fit Sensor

[0075] In order to further verify the practical application and analytical reliability of the Faraday cage-based aptamer sensor, serum and milk were selected for actual sample analysis. The analytical ability of the aptamer sensor for actual samples was evaluated by the standard addition method, and each sample was tested three times. The results are shown in Table 1:

[0076] Table 1 Staphylococcus aureus test results

[0077]

[0078] According to the results in Table 1, the recovery rates of serum samples were 91.6% to 97.7%, the recovery rates of milk samples were 101.9% to 109.4%, the RSDs of serum samples were 0.3% to 6.6%, and the RSDs of milk samples were 0.3% to 6.8%. The above results indicate that the electrochemical biosensor has great potential for clinical detection of Staphylococcus aureus.

[0079] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A method for detecting Staphylococcus aureus using a MOF nanofilm-based Faraday cage aptamer sensor, characterized in that: The following steps are involved: S1, adding HAuCl4 and a reducing agent to the aqueous solution of the Zr / Hf-MOF nanomembrane to react, thereby obtaining a Zr / Hf-MOF nanomembrane loaded with AuNPs; adding an activated aptamer and an electron blocker to the aqueous solution of the obtained Zr / Hf-MOF nanomembrane loaded with AuNPs to react, thereby obtaining a signal unit Zr / Hf-MOF / AuNPs / Apt; S2, drop-coating the activated aptamer on the surface of the gold electrode and incubating to obtain an AuR / Apt electrode; inserting the obtained AuR / Apt electrode into an electron blocker solution and incubating to obtain an AuR / Apt electrode with blocked nonspecific binding sites; S3. Add the solution containing Staphylococcus aureus to the surface of the AuR / Apt electrode with blocked nonspecific binding sites obtained in step S2, and incubate it. Then, drop-coat the signal unit Zr / Hf-MOF / AuNPs / Apt obtained in step S1. After incubation at room temperature, detect the electrochemical differential pulse voltammetry signal of the obtained solution to perform qualitative or quantitative analysis of Staphylococcus aureus.

2. The method according to claim 1, characterized in that In step S1, the doping amount of hafnium element in the Zr / Hf-MOF nanofilm is 1%-5%.

3. The method according to claim 1, characterized in that In step S1, the Zr / Hf-MOF nanofilm is prepared by the following method: The zirconium salt, the hafnium salt and the redox mediator are dissolved in a mixed solution of an organic solvent and HAC, and heated to obtain a Zr / Hf-MOF nanofilm.

4. The method according to claim 3, characterized in that The zirconium salt is selected from ZrCl4; And / or, the hafnium salt is selected from HfCl4; And / or, the molar ratio of the zirconium salt to the hafnium salt is 9.0-9.9:0.1-0.

5.

5. The method according to claim 3, characterized in that: The redox mediator is selected from 1,1′-ferrocene carboxylic acid; And / or, the organic solvent is selected from DMF.

6. The method according to claim 1, characterized in that In steps S1 and S2, the nucleotide sequence of the activated aptamer is shown in SEQ ID NO.

1.

7. The method according to claim 1, characterized in that In steps S1 and S2, the electron blocker includes 6-mercaptohexanol.

8. The method according to claim 1, characterized in that: In step S2, the activated aptamer is obtained by dissolving the aptamer in a buffer solution and adding a TCEP solution to react at room temperature.

9. The method according to claim 1, characterized in that: In step S3, the concentration of the solution containing Staphylococcus aureus is 10 1 CFU·mL -1 ~10 7 CFU·mL -1 .

10. A Faraday cage aptamer sensor based on MOF nanofilm, characterized in that: It includes signal unit Zr / Hf-MOF / AuNPs / Apt, aptamer and electrode; The Zr / Hf-MOF nanomembrane in the signal unit is modified with a redox mediator and an electron blocker.

Images