Silk material with function of promoting cell proliferation and application thereof

Abstract

The invention discloses a silk material with a function of promoting cell proliferation and application of the silk material. According to the functional material, a human-derived I-type collagen truncated fragment is expressed by a silkworm middle silk gland, and a sericin promoter serving as a tissue-specific promoter can drive an exogenous gene to be specifically expressed in the middle silk gland; finally, the silkworm cocoons are combined with sericin to be secreted in vitro, foreign protein can be separated after certain treatment is carried out on the silkworm cocoons, and the expression product can maintain biological activity. The hydrogel prepared from the silk material has the effect of promoting wound healing, and can be applied to the aspects of promoting skin regeneration and repair, bone transplantation substitutes, cartilage reconstruction, artificial skin and the like.

Description

Technical Field

[0001] The invention relates to the field of materials, in particular to a silk material with a function of promoting cell proliferation, and also to applications of the silk material. Background Art

[0002] Collagen is the most abundant protein in mammalian tissues, accounting for about 30% of the total protein content of the body. It not only forms a bridge between cells, but also provides many important biological functions, such as protection, support, repair and nutrient delivery. It is also an important component of the extracellular matrix (ECM), playing the role of a skeleton in the ECM, helping tissues and organs such as skin, cartilage, tendons, ligaments and internal organs to maintain their structure and shape, and is a coordinator of many biological processes. In addition to its structural role, collagen can also interact with various macromolecules such as integrins, decorative proteins, fibronectin, heparin and matrix metalloproteinases (MMPs), and is very important in regulating tissue regeneration. Fibroblasts, soft cells, osteoblasts, odontoblasts, myoblasts, adipocytes, endothelial cells and some epithelial cells can secrete collagen. It has a special structure, diverse functions, biodegradability, low immunogenicity and the characteristics of promoting cell proliferation and differentiation. It is an ideal biomedical and beauty skin care material. As a biopolymer, collagen can also be mixed with other hydrophilic polymers to form high-quality hydrogels and biodegradable scaffolds. Among them, the preparation of collagen and chitosan blends has become a topic of focus in the scientific community.

[0003] Collagen contains a typical triple helix structure, which is a complex structure composed of three α chains wound into a triple helix. It provides cell adhesion and receptor recognition sites for collagen and is a key factor in the biological activity of collagen. The triple helix structure of collagen originates from the Gly-Xaa-Yaa tripeptide repeat sequence in its primary structure, in which Xaa is often proline and Yaa is often hydroxyproline. In the triple helix domain, three polypeptide (α) chains, each with a left-handed conformation, are intertwined to form a right-handed superhelix. The length of this triple helix domain varies depending on the type of collagen, and can be continuous or interrupted by a non-helical domain. The assembly process of the collagen triple helix is ​​strictly regulated, and the procollagen chains are selectively bound in a type-specific manner. This is of particular significance when different collagens are co-expressed in the same tissue. It is currently known that there are at least 28 different types of collagen in the human body, constituting a highly specialized glycoprotein family.

[0004] Type I collagen is a (α1)2α2 heterotrimeric transmembrane protein, with a full length of α1 chain of 1464AA and a molecular weight of about 138KD. Type I collagen is the most abundant collagen, widely distributed in connective tissues such as skin, bones, ligaments and tendons, and accounts for about 85% of the total collagen content in the skin. Compared with other types of collagen, the fibers of type I collagen are thicker and harder, equivalent to a collagen skeleton, playing a major supporting role, giving the skin toughness and elasticity. Type I collagen participates in cell proliferation, differentiation, migration and signal transmission, and plays an important role in tissue support and repair. It has the function of promoting skin regeneration and repair, maintaining bone integrity and mechanical characteristics, and is used in bone transplant substitutes in tissue engineering, guided tissue regeneration, cartilage reconstruction, artificial skin in dentistry, etc., and in the field of beauty, it is used in filler injections and skin care products.

[0005] The transgenic silk gland bioreactor of Bombyx mori is an expression system for expressing foreign genes in the silk gland of Bombyx mori. The middle silk gland (MSG) of Bombyx mori is mainly responsible for the synthesis and secretion of sericin. As a tissue-specific promoter, sericin promoter can drive the specific expression of foreign genes in the middle silk gland, and finally combine with sericin to be secreted out of the body. After certain treatment of the cocoon, the foreign protein can be separated and purified, and the expression product can maintain biological activity. This study successfully achieved the expression of human type I collagen (ColⅠ) in the middle silk gland of Bombyx mori through transgenic technology and secreted it into the sericin layer of the cocoon. Summary of the invention

[0006] In view of this, one of the objects of the present invention is to provide a silk material with the function of promoting cell proliferation; the second object of the present invention is to provide a method for preparing the ColⅠ / sericin freeze-dried powder with the function of promoting cell proliferation; the third object of the present invention is to provide ColⅠ / sericin freeze-dried powder obtained by the preparation method; the fourth object of the present invention is to provide a method for preparing a material that promotes wound healing, the fifth object of the present invention is to provide a material that promotes wound healing obtained by the preparation method; the sixth object of the present invention is to provide the application of the material.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] 1. A silk material having a cell proliferation promoting function, wherein the silk material is a truncated fragment of human type I collagen expressed in the middle silk gland of the silkworm and secreted into the sericin layer of the cocoon, and the obtained silk has a cell proliferation promoting function; the nucleotides of the truncated fragment of human type I collagen are shown at positions 7 to 1578 in SEQ ID NO.1.

[0009] Preferably, the silk material is obtained by connecting the truncated human type I collagen fragment shown in SEQ ID NO.1 into the BamHI and NotI restriction sites of psl1180[hr3PSer1spRedSer1PA], and then cutting it with AscI and connecting it to the pBac[3xp3DsRedaf] vector that has been cut with the same enzyme, to obtain a vector for microinjection and screening transgenic silkworms. The silk secreted by the transgenic silkworms is the silk with the function of promoting cell proliferation.

[0010] 2. A method for preparing ColⅠ / sericin freeze-dried powder capable of promoting cell proliferation comprises the following steps: crushing silk, adding 1 million to 3 million U / L of subtilisin, and hydrolyzing the powder at 40 to 45°C for at least 3 hours to obtain the powder.

[0011] 3. ColⅠ / sericin freeze-dried powder prepared by the preparation method.

[0012] 4. A method for preparing a material for promoting wound healing, comprising the following steps: crushing silk expressing human type I collagen truncated fragments, extracting sericin containing human type I collagen truncated fragments by urea method, dialyzing to remove urea and inducing gel formation at low temperature to obtain a material for promoting wound healing.

[0013] Preferably, the urea extraction is performed in 8M urea 50mM Tris-HCl solution, in an 80°C water bath for 60min, followed by centrifugation at 13500rpm for 10min to obtain the supernatant.

[0014] Preferably, in the urea extraction, the silk bath ratio is 60-70 mg / mL.

[0015] Preferably, the dialysis is performed using deionized water at 4-25°C for at least 3 days.

[0016] 5. A material for promoting wound healing obtained by the preparation method.

[0017] 6. Use of the ColⅠ / sericin freeze-dried powder or the material in the preparation of materials for promoting skin regeneration and repair, bone transplant substitutes, cartilage reconstruction or artificial skin.

[0018] The beneficial effects of the present invention are as follows: the present invention provides a silk material with the function of promoting cell proliferation. The functional material is expressed by the middle silk gland of the silkworm. The human type I collagen truncated fragment, as a tissue-specific promoter, can drive the exogenous gene to be specifically expressed in the middle silk gland, and finally combined with the sericin protein to be secreted out of the body. After a certain treatment of the silk cocoon, the exogenous protein can be separated and purified, and the expression product can mostly maintain biological activity. The hydrogel made of silk material has the function of promoting wound healing, so it can be used as a function of promoting skin regeneration and repair, maintaining the integrity and mechanical characteristics of bones, and is applied to bone transplant substitutes in tissue engineering, guided tissue regeneration, cartilage reconstruction, artificial skin, etc. in dentistry, and in the field of beauty, it is applied to filling injections and skin care products, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0020] Figure 1 This is the structure diagram of the recombinant ColⅠ expression vector;

[0021] Figure 2 Screening for recombinant ColⅠ-positive silkworms;

[0022] Figure 3 Screening for recombinant ColⅠ-positive silkworms;

[0023] Figure 4 For Col Ⅰ Western Blot detection;

[0024] Figure 5 For ColⅠ expression detection;

[0025] Figure 6 It is ColⅠ / sericin hydrogel;

[0026] Figure 7 The wound healing status of mice;

[0027] Figure 8 HE staining and Masson staining of mouse wound skin on day 14;

[0028] Fig. 9 The subtilisin is used to hydrolyze the silkworm cocoon sericin;

[0029] Fig.10 It is ColⅠ / sericin freeze-dried powder;

[0030] Fig.11 This is the effect of ColⅠ / sericin on cell survival rate. DETAILED DESCRIPTION

[0031] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0032] Example 1. Selection of ColⅠ fragment

[0033] The full length of the ColⅠ collagen α1 chain contains 1464 amino acids, of which 179-1192AA is the helical region, which is the main functional region of type Ⅰ collagen. The 228-751AA region in the helical region contains multiple motifs with high affinity for integrins, such as DGEA, RGD, GER, and KGD, which are predicted to play an important role in the biological function of type Ⅰ collagen.

[0034] Example 2: Obtaining Type I collagen transgenic silkworm strains

[0035] The amino acid sequence of human type I collagen NP_000079.2 was obtained from Uniprot. According to the codon preference in the silkworm translation process, the base sequence was optimized, and a Bam HI restriction site was added to the N-terminus of the sequence, and a 6×His tag and a Not I restriction site were added to the C-terminus to facilitate the construction of an expression vector and subsequent detection. A recombinant type I collagen gene with a 6×His tag was artificially synthesized, and its sequence is shown in SEQ ID NO.1.

[0036] GGATCC AAAAACGGAGACGATGGCGAAGCTGGAAAGCCGGGAAGACCCGGCG

[0037] AAAGAGGTCCCTCCAGGACCGCAAGGCGCCAGAGGTCTGCCAGGAACAGCTGGC

[0038] TTGCCGGGTATGAAAGGACACAGAGGCTTCTCAGGTCTCGACGGAGCTAAAGG

[0039] CGATGCTGGTCCTGCCGGACCAAAGGGCGAACCGGGTTCTCCCGGAGAAAATG

[0040] GCGCCCCAGGACAGATGGGACCAAGAGGCCTGCCTGGTGAAAGAGGAAGACCT

[0041] GGCGCTCCTGGTCCAGCTGGAGCTAGAGGCAATGATGGTGCTACAGGAGCTGCT

[0042] GGTCCTCCTGGACCTACTGGACCAGCTGGCCCTCCAGGTTTCCCGGGAGCTGTT

[0043] GGTGCTAAAGGTGAAGCTGGACCTCCAAGGACCAAGAGGTTCGGAAGGACCTCA

[0044] GGGCGTCAGAGGTGAACCTGGACCGCCCGGACCTGCTGGTGCTGCTGGACCAG

[0045] CTGGAAACCCTGGTGCTGATGGACAACCAGGCCTAAAGGTGCCAATGGAGCT

[0046] CCTGGCATCGCTGGTGCCCCTGGATTCCCAGGTGCTAGAGGTCCTTCTGGACCA

[0047] CAGGGACCTGGTGGACCTCCAGGTCCTAAGGGAAATAGCGGCGAACCAGGTGC

[0048] CCCGGGTTCAAAAGGCGATACTGGTGCTAAGGGAGAACCGGGCCCCGTTGGTG

[0049] TTCAAGGACCGCCCGGTCCTGCAGGTGAAGAAGGAAAAAGAGGCGCTAGAGGT

[0050] GAACCTGGACCAACCGGCTTGCCAGGTCCTCCAGGAGAAAGGGCGGTCCCGG

[0051] CTCAAGAGGTTTCCCTGGAGCCGATGGTGTTGCTGGTCCAAAGGACCAGCTGG

[0052] TGAAAGAGGTTCGCCTGGACCAGCTGGACCAAAGGGTAGTCCTGGAGAAGCTG

[0053] GAAGACCAGGTGAAGCTGACTCCCTGGCGCTAAAGGTCTGACCGGATCACCT

[0054] GGCTCTCCTGGTCCAGACGGAAAGACAGGTCCTCCTGGACCTGCTGGACAAGAT

[0055] GGTCGCCCTGGTCCTCCAGGACCGCCCGGAGCCCGTGGTCAGGCTGGAGTGATG

[0056] GGATTCCCTGGTCCAAAAGGAGCTGCTGGTGAACCAGGAAAGGCTGGAGAAAG

[0057] AGGCGTCCCTGGTCCTCCAGGAGCTGTGGGACCTGCTGGTAAAGACGGAGAAG

[0058] CTGGTGCTCAGGGTCCGCCCGGACCAGCTGGACCGGCTGGTGAAAGAGGAGAA

[0059] CAAGGTCCTGCTGGTAGCCCTGGATTCCAAGGATTGCCAGGTCCAGCTGGACCT

[0060] CCAGGTGAGGCTGGAAAGCCCGGAGAACAAGGTGTTCCAGGTGATCTGGGAGC

[0061] CCCGGGACCATCTGGTGCTAGAGGAGAAAGAGGCTTCCCAGGTGAAAGAGGAG

[0062] TTCAGGGTCCTCCTGGTCCTGCTGGACCTAGAGGCGCCAACGGTGCTCCGGGAA

[0063] ATGATGGTGCTAAAGGTGATGCTGGAGCCCCAGGTGCCCCGGGTTCACAAGGTG

[0064] CTCCAGGATTGCAGGGTATGCCGGGAGAAAGAGGTGCTGCCGGATTGCCAGGT

[0065] CCAAAAGGAGACAGAGGTGATGCTGGACCAAAGCACCACCACCACCACCACTA

[0066] A GCGGCCGC

[0067] The synthesized sequence was linked to the BamHI and NotI restriction sites of sl1180[hr3PSer1spRedSer1PA], and then digested with AscI and linked to the pBac[3xp3DsRedaf] vector digested with the same enzymes, referred to as pBac[3xp3DsRed-ColⅠ-S]. The results of nucleic acid electrophoresis after AscI digestion showed that the expression vector was successfully constructed. Its structure is shown in the figure below. Figure 1 As shown. Wild-type (WT) silkworm eggs of the non-diapause Dazao strain were microinjected, and positive individuals were obtained by fluorescence screening; recombinant type I collagen was extracted from the positive silkworm silk obtained by fluorescence screening, and specific bands were observed by Western blot detection, and the successful expression of recombinant type I collagen was further detected by mass spectrometry.

[0068] Example 3: Screening of recombinant Col Ⅰ positive silkworms

[0069] Before microinjection, auxiliary plasmid pHA3PIG needs to be added to the pBac[3xp3DsRed-ColⅠ-S] plasmid, and the two plasmids are mixed at a mass ratio of 1:1, and the silkworm eggs freshly laid by the female moth are fixed on a glass slide; the silkworm eggs are injected using a microinjector, and the silkworm eggs need to be fresh silkworm eggs that have been laid no more than two hours ago to increase the success rate of genetic modification. Each injected silkworm egg needs to be sealed with non-toxic glue to seal the injection hole; the injected silkworm eggs are placed in a 26°C environment for development, and the G0 generation larvae hatch after about 10 days, which are raised to the cocoon; the G0 generation moths are mated with each other or with wild-type moths to obtain F1 generation silkworm eggs; when the F1 generation silkworm eggs are hatched to the seventh day, the larvae in the eggs can be observed under a fluorescence microscope, and they are screened under excitation light. The eyes of the transgenic silkworms that have successfully been transferred into the sericin expression system emit specific red fluorescence under the excitation light; the hatched transgenic silkworm larvae and moths also maintain this characteristic ( Figure 2 ).

[0070] Example 4: Recombinant expression and identification of ColⅠ in silkworm

[0071] Extraction of ColⅠ silkworm cocoon sericin: clean silkworm cocoons were placed in liquid nitrogen for quick freezing and then crushed into powder ( Figure 3 , A). Weigh an appropriate amount of silkworm cocoon powder, immerse it in 8M urea, 50mM Tris-HCl solution at a bath ratio of 20mg / mL, extract it in a water bath at 80℃ for 45min, centrifuge it at 13500rpm for 10min, and carefully aspirate the supernatant to obtain a sericin sample containing recombinant protein ( Figure 3 , B).

[0072] Western Blot experiments were performed using the ColⅠ sericin solution extracted above, with WT silkworm cocoon sericin as control, and incubated with HIS antibody. The results are as follows Figure 4 As shown. The results showed that ColⅠ silkworm sericin had an obvious specific band at about 70KD, indicating that the recombinant ColⅠ silkworm successfully expressed type I collagen and secreted it into the cocoon sericin. After the above-extracted ColⅠ sericin extract was subjected to mass spectrometry pretreatment, the protein types and amino acid sequences contained in the extract were detected and identified on the machine. The results are shown in Table 1. The mass spectrometry results showed that the sericin extract contained type I collagen, and 10 characteristic peptides of type I collagen were identified, further verifying that the transgenic silkworm successfully expressed type I collagen and could be extracted from the cocoon. The ColⅠ sericin solution was subjected to SDS-PAGE experiment with standard concentration of BSA, and the standard curve was made using standard concentration of BSA. Grayscale analysis detected that each gram of cocoon contained approximately 16.13 mg of type 1 collagen. The results are shown in Figure 5 shown.

[0073] Table 1. ColⅠ characteristic peptides identified by mass spectrometry in samples

[0074]

[0075] Example 5. Preparation of ColⅠ / sericin hydrogel

[0076] In order to verify the activity and function of recombinant ColⅠ, ColⅠ / sericin hydrogel was prepared and its effect on wound healing was investigated. The specific method was as follows: the clean cocoons were crushed and immersed in 8M urea 50mM Tris-HCl solution, extracted in an 80℃ water bath for 60min, centrifuged at 13500rpm for 10min, and the supernatant was taken. The sericin solution was dialyzed with deionized water at 4-25℃ for 3 days to remove urea, and then placed at 4℃ to induce gel formation.

[0077] In order to explore the effect of different amounts of silkworm cocoon addition on the formation of sericin hydrogel, 20 mg / ml, 30 mg / ml, 40 mg / ml, 50 mg / ml, 60 mg / ml and 70 mg / ml were selected to prepare Col 1 / sericin hydrogel. The results are shown in Figure 6 The results show that solid sericin hydrogel can be obtained by selecting a bath ratio of 60 mg / ml and 70 mg / ml. The Col1 / sericin hydrogel prepared at a bath ratio of 70 mg / ml was selected for subsequent experiments.

[0078] Example 6: ColⅠ / sericin hydrogel promotes wound healing in mice

[0079] On day 0, full-thickness skin wounds were made on the backs of mice and divided into 3 groups, 3 mice in each group. The model group received no treatment; the sericin group and ColⅠ / sericin group were treated with sericin hydrogel prepared from WT silkworm cocoons and ColⅠ / sericin hydrogel respectively every day from day 1. Wound healing was observed by taking photos on days 0, 1, 5, 7, and 14. On day 14, skin from the wound was taken for histochemical analysis ( Figure 7 ).

[0080] From the fifth day on, the wound area of ​​the ColⅠ / sericin group was significantly smaller than that of the model group and the sericin group, and the healing speed was faster. On the 14th day, the results of HE staining of the wound skin showed that granulation tissue that promoted the formation of new skin appeared in the wound sites of the three groups. The sericin group and the ColⅠ / sericin group had more granulation tissue than the model group, and the newly formed tissue cells in the ColⅠ / sericin wound were arranged more tightly and orderly, and more new blood vessels were generated under the skin. The results of Masson staining showed that the content of newly formed collagen in the wound of the ColⅠ / sericin group was higher than that of the sericin group and the model group, and the arrangement was more tightly and orderly ( Figure 8 ). The above results show that ColⅠ / sericin has a good effect in promoting tissue repair.

[0081] Example 7. Production of recombinant Col Ⅰ

[0082] ColⅠwas obtained from silkworm cocoons by enzymatic hydrolysis-freeze drying. BIOPEP-UWM enzymatic hydrolysis simulation analysis showed that subtilisin can retain all 16 functional sites of ColⅠ, including DGEA, RGD, GER, and KGD, after hydrolysis, thus retaining the efficacy of ColⅠ to the maximum extent. Therefore, 1 million to 3 million U / L subtilisin was used for hydrolysis at 40 to 45°C for at least 3 hours. Fig. 9 The sericin containing ColⅠ was extracted from the silkworm cocoon by enzymatic hydrolysis, and the sericin solution was freeze-dried to obtain ColⅠ / sericin freeze-dried powder. Fig.10 shown.

[0083] Example 8, ColⅠ / sericin CCK8 assay

[0084] The ColⅠ / sericin freeze-dried powder was dissolved in water to prepare ColⅠ / sericin solutions of different concentrations. The WT sericin solution was used as a control. After co-culture with Hacat cells for 24 hours, CCK8 experiments were performed to detect its effect on cell survival rate. The results are as follows: Fig.11 As shown. The results showed that ColⅠ / sericin promoted cell proliferation at a concentration of 0.125%-0.0625%. When the concentration was 0.0625%, the cell survival rate was 187%, which was significantly higher than that of the WT group. This showed that ColⅠ / sericin powder had no cytotoxicity, good biocompatibility and cell proliferation activity, which was consistent with the above results of ColⅠ promoting wound healing in mice.

[0085] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. A silk material having a cell proliferation promoting function, characterized in that: The silk material is a truncated fragment of human type I collagen expressed in the middle silk gland of the silkworm and secreted into the sericin layer of the cocoon. The obtained silk has the function of promoting cell proliferation; the nucleotides of the truncated fragment of human type I collagen are shown at positions 7 to 1578 in SEQ ID NO.

1.

2. The silk material having the function of promoting cell proliferation according to claim 1, characterized in that: The silk material is prepared by connecting the human type I collagen truncated fragment shown in SEQ ID NO.1 into the BamHI and NotI restriction sites of psl1180[hr3PSer1spRedSer1PA], and then cutting it with AscI and connecting it into the pBac[3xp3DsRedaf] vector that has been cut with the same enzyme, so as to obtain a vector for microinjection and screen transgenic silkworms. The silk secreted by the transgenic silkworms is the silk with the function of promoting cell proliferation.

3. A method for preparing a ColⅠ / sericin freeze-dried powder having the function of promoting cell proliferation, characterized in that: The method comprises the following steps: crushing silk, adding 1 million to 3 million U / L of subtilisin, and hydrolyzing at 40 to 45 DEG C for at least 3 hours to obtain the product.

4. ColⅠ / sericin freeze-dried powder prepared by the preparation method of claim 3.

5. A method for preparing a material for promoting wound healing, characterized in that: The method comprises the following steps: crushing silk expressing human type I collagen truncated fragments, extracting sericin containing human type I collagen truncated fragments by urea method, removing urea by dialysis and inducing gel formation at low temperature to obtain a material that promotes wound healing.

6. The method for preparing the material for promoting wound healing according to claim 4, characterized in that: The urea extraction was carried out in 8M urea 50mM Tris-HCl solution, in a water bath at 80°C for 60min, followed by centrifugation at 13500rpm for 10min to obtain the supernatant.

7. The method for preparing the material for promoting wound healing according to claim 4 or 5, characterized in that: The silk bath ratio in the urea extraction is 60-70 mg / mL.

8. The method for preparing the material for promoting wound healing according to claim 4, characterized in that: The dialysis is performed using deionized water at 4-25°C for at least 3 days.

9. A material for promoting wound healing obtained by the preparation method according to any one of claims 5 to 7.

10. Use of the ColⅠ / sericin freeze-dried powder according to claim 4 or the material according to claim 8 in the preparation of materials for promoting skin regeneration and repair, bone transplant substitutes, cartilage reconstruction or artificial skin.

Images