Application of miR-31-5p simulant in enhancing killing effect of metarhizium anisopliae on bemisia tabaci

Abstract

The invention discloses application of miR-31-5p simulant in enhancing killing effect of metarhizium anisopliae on bemisia tabaci, and belongs to the technical field of biological control of bemisia tabaci. The miR-31-5p simulant synthesized by the bemisia tabaci is fed, the expression of genes related to immunity, metabolism and redox pathways of the bemisia tabaci is reversely regulated and controlled, the killing effect of metarhizium anisopliae on the bemisia tabaci is enhanced by weakening the immune system and metabolic capacity of the bemisia tabaci, and a new effective strategy is provided for biological prevention and control of the bemisia tabaci under natural conditions; when the miR-31-5p simulant provided by the invention is fed, the survival rate of bemisia tabaci infected with metarhizium anisopliae can be remarkably reduced, and the survival rate of infected bemisia tabaci fed with the miR-31-5p antagonist is remarkably increased, so that the miR-31-5p simulant provided by the invention can remarkably enhance the killing effect of metarhizium anisopliae on bemisia tabaci.

Description

Technical Field

[0001] The invention relates to the technical field of biological control of Bemisia tabaci, and in particular to the application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci. Background Art

[0002] Bemisia tabaci is a global agricultural pest that is highly invasive and damages plants by sucking plant sap, secreting honeydew and spreading plant viruses. The current control of whiteflies mainly relies on chemical pesticides, but the repeated exposure of whiteflies to pesticides and the differences in biotypes have led to the rapid development of pesticide resistance. Once whiteflies break out, they are now difficult to control. This increases the cost of manual control and the amount of pesticides used, while increasing the resistance of whiteflies while controlling them. Therefore, it is urgent to seek new green control methods to control whiteflies and reduce dependence on pesticides.

[0003] Entomogenous fungi are an important part of biological control, such as Beauveria bassiana, Metarhizium anisopliae, Paecilomyces pyrifera, Verticillium brevifolium, etc., which not only promote the sustainable development of agriculture, but also play an important role in the prevention and control of agricultural pests. Laboratory experiments have shown that Metarhizium anisopliae has a killing effect on whiteflies, especially for whiteflies carrying cucurbit yellow flower chlorosis virus (CCYV), the mortality rate is higher, and Metarhizium anisopliae can affect the composition of the symbiotic bacterial community in whiteflies. However, due to the complexity and diversity of the natural environment, as well as the special innate immune structure of the waxy powder layer on the surface of whiteflies, Metarhizium anisopliae has a poor control effect on whiteflies under natural conditions. Therefore, improving the control ability of Metarhizium anisopliae is the key to using Metarhizium anisopliae for biological control of whiteflies under natural conditions.

[0004] miRNAs are a type of small RNA (sRNA) with a length of about 19-25 nucleotides that regulate gene expression at the post-transcriptional level and are widely involved in biological processes such as development, immunity, and host-pathogen interaction. After miRNAs form a RISC complex with the target gene, they bind to the target gene through complementary base pairing, and after being cut by two Dicer 1 and Dicer 2, they lead to target gene degradation or inhibit translation to regulate the expression of the target gene. Summary of the invention

[0005] The purpose of the present invention is to provide an application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, so as to solve the problem that the control effect of Metarhizium anisopliae on Bemisia tabaci is poor under natural conditions.

[0006] To achieve the above object, the present invention provides the use of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci. The RNA sequence of the miR-31-5p mimics is shown in SEQ ID NO.6.

[0007] Preferably, the working concentration of the miR-31-5p mimic is 0.2 μg / μL, and the working concentration of Metarhizium anisopliae is 10 7 -10 8 Spores / mL.

[0008] Preferably, the preparation method of the miR-31-5p mimic is:

[0009] S1. Design four single-stranded DNAs based on the DNA sequence of miRNA-31-5 of Bemisia tabaci, and name them as sense strand 1, sense strand 2, antisense strand 1, and antisense strand 2;

[0010] S2, performing PCR amplification with a mixture of sense strand 1 and antisense strand 1 to obtain template 1; performing PCR amplification with a mixture of sense strand 2 and antisense strand 2 to obtain template 2;

[0011] S3, performing PCR amplification with a mixture of template 1 and template 2, and performing in vitro transcription on the amplified product;

[0012] S4. Add enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution and chloroform solution to the in vitro transcription product in sequence, mix well and centrifuge to obtain the supernatant, add anhydrous ethanol at -20°C overnight, then centrifuge to obtain the supernatant, wash the precipitate with 75% alcohol, and dry aseptically to obtain the miR-31-5p mimic.

[0013] Preferably, the DNA sequence of Bemisia tabaci miRNA-31-5 is shown as SEQ ID NO.1, the sequence of sense strand 1 is shown as SEQ ID NO.2, the sequence of sense strand 2 is shown as SEQ ID NO.3, the sequence of antisense strand 1 is shown as SEQ ID NO.4, and the sequence of antisense strand 2 is shown as SEQ ID NO.5.

[0014] Preferably, the PCR amplification program for amplification template 1 in S2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min; and the PCR amplification program for amplification template 2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min.

[0015] Preferably, the PCR amplification program in S3 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min.

[0016] Preferably, in S4, the volume ratio of the in vitro transcription product: enzyme-free water: sodium acetate solution: water-saturated phenol solution: chloroform solution is 1:10:1:5:5.

[0017] A use of the whitefly miRNA-31-5 as described above in enhancing the killing effect of Metarhizium anisopliae on whitefly.

[0018] A whitefly control agent, comprising the miR-31-5p mimic and Metarhizium anisopliae.

[0019] A method for controlling whiteflies, comprising feeding whiteflies with the miR-31-5p mimics, and then feeding or spraying whiteflies with a concentration of 10 7 -10 8 Spores / mL of Metarhizium anisopliae.

[0020] Therefore, the specific technical effects of the application of the miR-31-5p mimic provided by the present invention in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci are as follows:

[0021] (1) The present invention reversely regulates the expression of genes related to the immunity, metabolism, and redox pathways of Bemisia whiteflies by feeding them miR-31-5p mimics synthesized by Bemisia whiteflies, thereby weakening the immune system and metabolic capacity of Bemisia whiteflies and enhancing the killing effect of Metarhizium anisopliae on Bemisia whiteflies, thereby providing a new and effective strategy for biological control of Bemisia whiteflies under natural conditions;

[0022] (2) Feeding the miR-31-5p mimic provided by the present invention can significantly reduce the survival rate of whiteflies infected with Metarhizium muscardine, while the survival rate of whiteflies infected with the miR-31-5p antagonist is significantly increased, indicating that the miR-31-5p mimic provided by the present invention can significantly enhance the killing effect of Metarhizium muscardine on whiteflies. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0024] Figure 1The statistical results of miR-31-5p expression in the treatment group and the control group of Example 2 of the present invention on days 1-5 after infection with the bacteria (A), the gel image of miR-31-5p mimics and siGFP (B), the statistical results of miR-31-5p expression in the body of the whiteflies after feeding the mimics (C), and the statistical results of the survival rate of the whiteflies infected with the bacteria 1-7 days after upregulation of miR-31-5p (D);

[0025] Figure 2 The statistical results of miR-31-5p expression in the treatment group and the control group of Bemisia tabaci in Example 3 of the present invention (A) and the statistical results of the survival rate of the treatment group and the control group 1-7 days after infection (B);

[0026] Figure 3 is the statistical result of the mRNAs changes in the body of Bemisia tabaci after feeding the miR-31-5p mimic in Example 4 of the present invention;

[0027] Figure 4 These are the statistical results of changes in the expression levels of genes related to drug metabolism after feeding the miR-31-5p mimic in Example 4 of the present invention (A); the statistical results of changes in the expression levels of starch and sucrose genes (B); the statistical results of changes in the expression levels of genes related to antigen presentation and processing (C); and the statistical results of changes in the expression levels of NOD receptor genes (D). DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0029] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0030] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels. The preparation method and components of the artificial liquid feed used in the examples and the collection and culture method of the Metarhizium muscardine used in the examples can be found in Wang Donghuai and Zhu Chaoqiang's 2023 master's thesis at Henan Agricultural University; the microworm cages used in the examples are all modified plastic boxes with a top diameter of 5 cm, a bottom diameter of 3 cm, and a height of 3 cm; the operating methods not described in detail in the examples are conventional technical means in the art.

[0031] Embodiment 1

[0032] The specific steps for preparing miR-31-5p mimics are as follows:

[0033] S11. According to the DNA sequence of miRNA-31-5 of Bemisia tabaci (shown in SEQ ID NO.1), four single-stranded DNAs were designed, and they were named sense strand 1 (sequence shown in SEQ ID NO.2), sense strand 2 (sequence shown in SEQ ID NO.3), antisense strand 1 (sequence shown in SEQ ID NO.4), and antisense strand 2 (sequence shown in SEQ ID NO.5). The sequence information was sent to the company for sequence synthesis.

[0034] SEQ ID NO.1:AGGCAAGATGTCGGCATAGCTGA

[0035] SEQ ID NO.2:

[0036] GATCACTAATACGACTCACTATAGGGAGGCAAGATGTCGGCATAGCTGATT

[0037] SEQ ID NO.3:

[0038] GATCACTAATACGACTCACTATAGGGTCAGCTATGCCGACATCTTGCCTTT

[0039] SEQ ID NO.4:

[0040] AATCAGCTATGCCGACATCTTGCCTCCCTATAGTGAGTCGTATTAGTGATC

[0041] SEQ ID NO.5:

[0042] AAAGGCAAGATGTCGGCATAGCTGACCCTATAGTGAGTCGTATTAGTGATC

[0043] S12. Add the received sequences into corresponding volumes of sterile ddH2O according to the attached instructions to prepare solutions with a concentration of 100 μM.

[0044] Use 2 μL of the evenly mixed sense chain 1 and 2 μL of the antisense chain 1 as template 1, mix evenly and then perform PCR. The PCR conditions are: denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min. The PCR product is miR-31-5p template 1.

[0045] Use 2 μL of the evenly mixed sense chain 2 and 2 μL of the antisense chain 2 as templates, mix evenly and then perform PCR. The PCR conditions are: denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min. The PCR product is miR-31-5p template 2.

[0046] S13. Use 2.5 μL of the mixture of miR-31-5p template 1 prepared in step S12 and 2.5 μL of template 2 to prepare a reaction system according to the instructions attached to the T7 High Yield RNA Synthesis Kit enzyme for PCR. The PCR amplification program is 37° C. for 4 h.

[0047] 300 μL of enzyme-free water, 30 μL of 3M sodium acetate solution, 150 μL of water-saturated phenol solution and 150 μL of chloroform solution were added to the in vitro transcription product, centrifuged at 13200 rpm for 15 minutes, and the supernatant was taken. 600 μL of anhydrous ethanol was added to the supernatant, stored in a -20°C refrigerator overnight, and then centrifuged again at 13200 rpm for 15 minutes, and the supernatant was discarded. The precipitate was washed with 75% alcohol and dried on a sterile workbench to obtain the miRNA-31-5p mimic. The RNA sequence of the miRNA-31-5p mimic is shown in SEQ ID NO.6.

[0048] SEQ ID NO.6:AGGCAAGAUGUCGGCAUAGCUGA

[0049] Embodiment 2

[0050] The effect of feeding the miR-31-5p mimic prepared in Example 1 on the survival rate of whiteflies was investigated, and the specific steps were as follows:

[0051] S21. Dissolve 30 μg of the miR-31-5p mimic prepared in Example 1 in 300 μL of artificial liquid feed and feed 100 3rd-day-old adult whiteflies using a membrane. After 2 days of feeding, randomly place the whiteflies into 5 micro-insect cages (20 whiteflies in each micro-insect cage) as the treatment group. Feed the same concentration of GFP protein (19 bp, the electrophoresis diagram of miR-31-5p mimic and GFP protein) with a fragment size similar to that of the miR-31-5p mimic is shown in Figure 2. Figure 1 The control group was 100 whiteflies fed with artificial liquid diet for 2 days as blank control group, and the whiteflies in the blank control group were randomly placed in 5 micro-insect cages (20 whiteflies in each micro-insect cage).

[0052] Select cucumber seedlings with about 3-5 true leaves and spray 10 7 spores / mL of Metarhizium anisopliae. After there was no obvious water stain on the leaf surface, the micro-insect cages of the treatment group, control group and blank control group were fixed on the back of cucumber leaves sprayed with Metarhizium anisopliae, and one micro-insect cage of the control group and one micro-insect cage of the treatment group were fixed on each leaf at the same distance from the edge.

[0053] Three replicates were randomly selected from the micro-insect cages of the treatment group and the control group on the 1st, 2nd, 3rd, 4th, and 5th day after fixation, with 30 whiteflies in each replicate. RNA was extracted using an RNA extraction kit, and reverse transcription was performed using the stem-loop method with the primers shown in SEQ ID NO.7. The RT-PCR reaction program was 25℃5min; 50℃15min; 85℃5min. qPCR was performed using the primers shown in SEQ ID NO.8, and the qPCR program was 95℃ pre-denaturation for 5min; 95℃10s, 60℃30s, 40 cycles; melting curve 95℃15s, 60℃60s, 95℃15s. The results are shown in Figure 1 As shown in A, compared with the control group and the blank control group, the expression level of miR-31-5p in the infected whitefly was significantly downregulated during the observation period, indicating that the fungus can cause the whitefly to downregulate its own miR-31-5p, reduce the degradation of immune target genes, and enhance the ability to resist fungal infection.

[0054] SEQ ID NO.7:

[0055] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAGGAG

[0056] SEQ ID NO.8:TGGGAGTTGTGGCGCG

[0057] S22. The membrane feeding method was adopted. The treated group was fed with the miR-31-5p mimic of Bemisia tabaci, and the control group was fed with the siGFP mimic of Bemisia tabaci. After 2 days, RNA was extracted using an RNA extraction kit, and reverse transcription was performed using the stem-loop method. The sequence shown in SEQ ID NO.7 was used as a primer for reverse transcription. The RT-PCR reaction program was 25℃5min; 50℃15min; 85℃5min. The sequence shown in SEQ ID NO.8 was used as a primer for qPCR. The qPCR program was 95℃ pre-denaturation for 5min; 95℃10s, 60℃30s, 40 cycles; melting curve 95℃15s, 60℃60s, 95℃15s. The results are shown in Figure 1As shown in C, compared with the control group, the mimic successfully upregulated the expression level of miR-31-5p in whitefly.

[0058] S23, using the same treatment method as step S21, randomly fix the obtained micro-insect cages of the treatment group, control group and blank control group on the sprayed 8 Spores / mL on the underside of cucumber leaves grown in the greenhouse with Metarhizium anisopliae.

[0059] A micro-insect cage was randomly selected on the 1st, 2nd, 3rd, 4th, 5th, 6th, and 7th day after fixation, and the survival rate was calculated using the following formula: Survival rate (%) = number of live whiteflies / 20 × 100%. Figure 1 As shown in D, the survival rate of whiteflies infected with fungi was significantly reduced after feeding with miR-31-5p mimics.

[0060] Embodiment 3

[0061] The effect of feeding miR-31-5p antagonist on the mortality of whiteflies was investigated. The specific steps were as follows:

[0062] S31. The sequence information of miR-31-5p was sent to the company to synthesize the antagonist of miR-31-5p. 23 μg of miR-31-5p (Antagomir) antagonist was dissolved in 230 μL of artificial liquid feed and fed to 100 3rd-day adult whiteflies using a membrane. After 2 days of feeding, the whiteflies were randomly placed into 5 micro-insect cages (20 whiteflies in each micro-insect cage) as the treatment group.

[0063] After RNA was extracted using an RNA extraction kit, reverse transcription was performed using the sequence shown in SEQ ID NO.7 as a primer. The RT-PCR reaction program was 25℃5min; 50℃15min; 85℃5min. qPCR was performed using the sequence shown in SEQ ID NO.8 as a primer. The qPCR program was 95℃ pre-denaturation for 5min; 95℃10s, 60℃30s, 40 cycles; melting curve 95℃15s, 60℃60s, 95℃15s. The results are shown in Figure 2 As shown in A, the expression level of miR-31-5p was significantly decreased after feeding the miR-31-5p antagonist (Antagomir), and the expression level of miR-31-5p was significantly increased after feeding the miR-31-5p mimic.

[0064] S32, 23 μg miR-31-5p (Antagomir) antagonist was dissolved in 230 μL artificial liquid feed, and 100 whiteflies on the third day of adulthood were fed with membranes. After 2 days of feeding, the whiteflies were randomly placed in 5 micro-insect cages (20 whiteflies in each micro-insect cage) as the treatment group. In the same way, the negative control (NC-Inhibitor) was fed with 100 whiteflies on the third day of adulthood with membranes. After 2 days of feeding, the whiteflies were randomly placed in 5 micro-insect cages (20 whiteflies in each micro-insect cage) as the control group.

[0065] The obtained micro-insect cages of the treatment group and the control group were randomly fixed on the 8 Spores / mL of Metarhizium anisopliae were placed on the back of cucumber leaves. A micro-insect cage was randomly selected on the 1st, 2nd, 3rd, 4th, 5th, 6th, and 7th day after fixation, and the survival rate was calculated using the following formula: Survival rate (%) = number of live whiteflies / 20×100%. The results are shown in Figure 2 As shown in B, after inhibiting the expression of miR-31-5p, the survival rate of whiteflies under the infection of Metarhizium anisopliae showed an upward trend compared with the control group, and there was a significant difference.

[0066] Embodiment 4

[0067] To investigate the changes in immune-related mRNAs after feeding miR-31-5p mimics, the specific steps are as follows:

[0068] The same treatment method as in Example 2 was used to feed miR-31-5p mimics to the 3rd day adult whiteflies. The 2nd day after feeding, whiteflies were sent to the company for transcriptome sequencing. The transcriptome of whiteflies published at https: / / doi.org / 10.5524 / 100286 was used as a control for analysis. The statistical results are as follows: Figure 3 As shown in the figure, a total of 1460 mRNAs changed significantly. After target site prediction, 721 target site-matched mRNAs were found among the 1460 differentially expressed genes, among which the main functions of differentially expressed genes were enriched in immune pathways. Figure 4 The genes in the four pathways shown were significantly downregulated. Feeding miR-31-5p mimics overexpressed the expression of miR-31-5p. miR-31-5p combined with related target genes to silence target genes, weakened the immune system of whiteflies, and led to a decrease in survival rate. This shows that miR-31-5p mimics can participate in regulating the expression of target genes of the whitefly immune system and enhance the killing ability of Metarhizium muscardine against whiteflies.

[0069] Therefore, the present invention reversely regulates the expression of genes related to the immunity, metabolism, and redox pathways of Bemisia whiteflies by feeding the miR-31-5p mimics synthesized by Bemisia whiteflies, and enhances the killing effect of Metarhizium anisopliae on Bemisia whiteflies by weakening the immune system and metabolic capacity of Bemisia whiteflies, thereby providing a new and effective strategy for the biological control of Bemisia whiteflies under natural conditions; feeding the miR-31-5p mimics provided by the present invention can significantly reduce the survival rate of Bemisia whiteflies infected with Metarhizium anisopliae, while the survival rate of infected Bemisia whiteflies fed with miR-31-5p antagonists is significantly increased, indicating that the miR-31-5p mimics provided by the present invention can significantly enhance the killing effect of Metarhizium anisopliae on Bemisia whiteflies.

[0070] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. Application of miR-31-5p mimics in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The RNA sequence of the miR-31-5p mimic is shown in SEQ ID NO.

6.

2. The use of the miR-31-5p mimic according to claim 1 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The working concentration of the miR-31-5p mimic was 0.2 μg / μL, and the working concentration of Metarhizium anisopliae was 10 7 -10 8 Spores / mL.

3. The use of the miR-31-5p mimic according to claim 1 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The preparation method of the miR-31-5p mimic is: S1. Design four single-stranded DNAs based on the DNA sequence of miRNA-31-5 of Bemisia tabaci, and name them as sense strand 1, sense strand 2, antisense strand 1, and antisense strand 2; S2, using a mixture of sense strand 1 and antisense strand 1 as a template to perform PCR amplification to obtain template 1; using a mixture of sense strand 2 and antisense strand 2 as a template to perform PCR amplification to obtain template 2; S3, performing PCR amplification with a mixture of template 1 and template 2, and performing in vitro transcription on the amplified product; S4. Add enzyme-free water, 3M sodium acetate solution, water-saturated phenol solution and chloroform solution to the in vitro transcription product in sequence, mix well and centrifuge to obtain the supernatant, add anhydrous ethanol at -20°C overnight, then centrifuge to obtain the supernatant, wash the precipitate with 75% alcohol, and dry aseptically to obtain the miR-31-5p mimic.

4. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The DNA sequence of Bemisia tabaci miRNA-31-5 is shown in SEQ ID NO.1, the sequence of sense strand 1 is shown in SEQ ID NO.2, the sequence of sense strand 2 is shown in SEQ ID NO.3, the sequence of antisense strand 1 is shown in SEQ ID NO.4, and the sequence of antisense strand 2 is shown in SEQ ID NO.

5.

5. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The PCR amplification program for amplification template 1 in S2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min; and the PCR amplification program for amplification template 2 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; annealing at 10°C for 10 min.

6. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The PCR amplification program in S3 is denaturation at 95°C for 4 min; annealing at 70°C for 10 min; annealing at 55°C for 10 min; annealing at 40°C for 10 min; annealing at 25°C for 10 min; and annealing at 10°C for 10 min.

7. The use of the miR-31-5p mimic according to claim 3 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci, characterized in that: The volume ratio of the in vitro transcription product in the S4: enzyme-free water: sodium acetate solution: water-saturated phenol solution: chloroform solution is 1:10:1:5:

5.

8. Use of the Bemisia tabaci miRNA-31-5 as claimed in claim 4 in enhancing the killing effect of Metarhizium anisopliae on Bemisia tabaci.

9. A whitefly control agent, characterized in that: The agent includes the miR-31-5p mimic described in any one of claims 1-7 and Metarhizium anisopliae.

10. A method for controlling Bemisia tabaci, characterized in that: First feed the whitefly with the miR-31-5p mimics according to any one of claims 1 to 7, and then feed or spray the whitefly with a concentration of 10 7 -10 8 Spores / mL of Metarhizium anisopliae.

Images