Double-report plasmid system and construction method and application thereof

Abstract

The invention discloses a double-report plasmid system and a construction method and application thereof. The double-report plasmid system comprises a translation report plasmid and an error folding response plasmid; the translation reporter plasmid comprises a target protein gene sequence, an mRNA secondary structure sequence and a luciferase gene sequence; the misfolding response plasmid comprises a heat shock pressure promoter and a fluorescent protein gene. The double-report plasmid system can quantitatively and visually detect translation characteristics and wrong folding conditions of the recombinant protein, the whole operation process is carried out based on a 96-well plate, the double-report plasmid system has the characteristics of low cost, high timeliness, high flux and the like, and the recombinant protein can be rapidly and efficiently soluble (positive: complete soluble; negative: completely insoluble; and in an intermediate state, the solubility is relatively poor), so that the efficiency of recombinant protein expression research is greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to a double-reporter plasmid system and a construction method and application thereof. Background Art

[0002] Recombinant proteins are widely used in drug development and screening, cell biology, protein structure and function, vaccine development and other fields, and have important research value. Among recombinant protein expression systems, the E. coli expression system is widely used due to its advantages of low cost, strong timeliness and high yield.

[0003] At present, the biggest limitation of recombinant protein expression using the E. coli expression system is the formation of inclusion bodies. There are some improvement strategies for this problem. On the one hand, recombinant protein expression can be optimized by changing the vector, optimizing the gene sequence, co-expressing with molecular chaperones, optimizing culture parameters, replacing fusion expression tags, etc.; on the other hand, the inclusion body recombinant protein can be reversed by screening suitable inclusion body renaturation conditions to promote its dissolution into a soluble form. Under unfavorable conditions for recombinant protein expression, blind screening of the above-mentioned multiple expression conditions often results in poor timeliness and high costs, which seriously limits the advantages of the E. coli expression system.

[0004] The expression of recombinant proteins is closely related to the protein translation rate in the host cell and the utilization efficiency of the protein folding system of the host cell. In E. coli, the key to controlling the folding of recombinant proteins is the DnaK molecular chaperone system, which mainly includes three important proteins: DnaK (core protein), DnaJ (member of the Hsp40s family) and GrpE (nucleotide exchange factor). If the translation speed of recombinant proteins in E. coli is too fast, the DnaK molecular chaperone system will not have time to respond to the newly generated large number of protein polypeptides, resulting in the misfolding of recombinant proteins, which is an important reason for the formation of recombinant protein inclusion bodies. Therefore, in the E. coli expression system, if the translation characteristics of recombinant proteins can be monitored in real time, and the occurrence of protein misfolding can be monitored in real time, it will help us to timely understand the generation and folding changes of recombinant proteins in cells, adjust expression parameters in time, speed up the acquisition of conditions conducive to the excellent expression of recombinant proteins, and continue to give play to the advantages of the strong timeliness of the E. coli expression system.

[0005] At present, the detection method of recombinant protein translation characteristics is mainly achieved through high-throughput sequencing technology. For example, ribosome analysis (Ribo-Seq), polysome profiling, and translation ribosome affinity purification (TARP-Seq) technology. These methods are often difficult to meet the test requirements due to the large demand for starting materials. In addition, the high cost of sequencing and the easy generation of experimental artifacts by sequencing are not conducive to promotion and utilization. The methods used to detect the misfolding of recombinant proteins, such as optical detection, nuclear magnetic resonance technology, mass spectrometry, cryo-electron microscopy, etc., are often limited in application due to difficulties in sample preparation, complex operations, and high instrument costs.

[0006] In E. coli, there is a phenomenon of translation coupling. Simply put, this process is determined by the secondary structure of messenger RNA (mRNA), which inhibits the binding of mRNA to ribosomal RNA (rRNA) at the 3' end of the RNA sequence. Only when the translation of the 5' end of the structure is initiated, the ribosomal helicase will dissolve the secondary structure of the mRNA, promote the formation of mRNA: rRNA pairing, and initiate the protein translation at the 3' end. Based on the above principle, if such an mRNA secondary structure (similar to a hairpin structure) is deliberately introduced at the rear end of the gene expressing the target recombinant protein, and a luciferase reporter gene is introduced at the rear end of the secondary structure, the translation of the target protein can be directly quantified by real-time monitoring of the activity changes of luciferase over time. In addition, in E. coli, there is a Sigma32 (RpoH) transcription factor. When there is no protein misfolding, RpoH binds to the DnaK protein in the molecular chaperone system to limit the activity of the DnaK protein; on the contrary, when there is protein misfolding in the cell, DnaK will bind to the misfolded protein at the first time and release the RpoH transcription factor. Free RpoH binds to RNA polymerase, and then recognizes heat shock promoter (such as lbpA), inducing the expression of promoter-linked genes. If a fluorescent protein reporter gene is integrated after the lbpA promoter, the presence and intensity of fluorescent protein luminescence can be used to visualize and monitor the occurrence of recombinant protein misfolding in cells in real time.

[0007] Therefore, there is an urgent need to provide a dual-reporter plasmid monitoring system for exogenous protein expression suitable for the Escherichia coli expression system to achieve real-time quantitative monitoring of the translation of exogenous recombinant proteins and real-time monitoring of the misfolding of recombinant proteins. Summary of the invention

[0008] In view of the deficiencies in the prior art and actual needs, the present invention provides a method based on two important working principles of the Escherichia coli expression system (translation coupling and RpoH heat shock pressure initiation), using molecular biology technology, aiming to construct a recombinant protein translation feature monitoring plasmid and a recombinant protein misfolding monitoring plasmid, and ultimately achieve the goal of real-time and accurate reflection of the recombinant protein expression status inside bacteria through in vitro biochemical quantitative means combined with fluorescence microscopy visualization observation methods, so as to better utilize the Escherichia coli expression system to produce exogenous proteins with excellent performance.

[0009] In order to achieve the purpose of the invention, the present invention adopts the following technical solutions:

[0010] In the first aspect, the present invention provides a dual reporter plasmid system, which includes a translation reporter plasmid and an error folding response plasmid; the translation reporter plasmid includes a target protein gene sequence, an mRNA secondary structure sequence, and a luciferase gene sequence; the error folding response plasmid includes a heat shock stress promoter and a fluorescent protein gene.

[0011] The dual-reporter plasmid system of the present invention can reflect the expression of recombinant proteins in bacteria in real time and accurately, and can better utilize the E. coli expression system to produce foreign proteins with excellent performance.

[0012] The secondary hairpin structure of mRNA in the present invention mainly consists of three parts: 6 histidine tags at the C-terminus of the target protein gene, the termination codon of the target protein, and the ribosome binding site (RBS) of the downstream luciferase reporter gene.

[0013] Preferably, the fluorescent protein gene includes a green fluorescent protein gene.

[0014] Preferably, the starting plasmid of the translation reporter plasmid includes at least one of the pET series plasmids or IPTG-induced series plasmids.

[0015] Preferably, the starting plasmid of the misfolding response plasmid includes at least one of pSEVA631, a series of plasmids containing the pBBR1 replication origin, or a series of plasmids containing the CoIE1 replication origin.

[0016] Preferably, the mRNA secondary structure sequence includes the sequence shown in SEQ ID NO.1.

[0017] Preferably, the luciferase gene sequence includes the sequence shown in SEQ ID NO.2.

[0018] Preferably, the heat shock stress promoter comprises lbpAP.

[0019] Preferably, the nucleic acid sequence of the lbpAP includes the sequence shown in SEQ ID NO.3.

[0020] Preferably, the nucleic acid sequence of the green fluorescent protein gene includes the sequence shown in SEQ ID NO.4.

[0021] SEQ ID NO.1:

[0022] CATCATCACCACCCATCATTAGGATGGTGGTGATGATA.

[0023] SEQ ID NO.2:

[0024]

[0025] SEQ ID NO.3:

[0026] AATTCCATCTGTTGATCGTGGGTGTTGGCCCGATGAGTTATAGCGATCCCTTGCTGAAAAATAACATCATCATTACGTCGCACTGTGGCGGCTATCGCACTTTAACGTTTCGTGCTGCCCCCTCGTCTATGCAATAGACCATAAACTGCAAAAAAAATCCGCTGATAAGGCTTGAAAAGTTCATTTCCAGACCCATTTTTACATCGTAGCCGATGAGGACGCGCCTGATGGGTGTTCTGGCTACCTGACCTGTCCATTGTGGAAGGTCTTACATTCTCGCTGATTTCAGGAGCTA。

[0027] SEQ ID NO.4:

[0028] .

[0029] In a second aspect, the present invention provides a method for constructing the dual reporter plasmid system described in the first aspect, the method comprising the following steps:

[0030] (1) Amplifying the target protein gene sequence, mRNA secondary structure sequence and luciferase gene sequence by PCR method;

[0031] (2) Insert the target protein gene sequence, mRNA secondary structure sequence and luciferase gene sequence amplified in step (1) into pET28 +The vector was cloned and sequenced to obtain the correct recombinant plasmid.

[0032] (3) Amplify the green fluorescent protein gene using PCR;

[0033] (4) The green fluorescent protein gene amplified in step (3) was inserted into the pSEVA631 vector containing the heat shock stress promoter, and sequencing analysis was performed to obtain a recombinant plasmid that was verified to be correct.

[0034] In a third aspect, the present invention provides a kit for detecting protein expression, wherein the kit contains the dual reporter plasmid system described in the first aspect.

[0035] In a fourth aspect, the present invention provides the use of the dual reporter plasmid system described in the first aspect in detecting soluble protein expression.

[0036] In a fifth aspect, the present invention provides the use of the dual reporter plasmid system described in the first aspect in detecting protein misfolding and / or protein aggregates.

[0037] Compared with the prior art, the present invention has the following beneficial effects:

[0038] (1) The present invention is a demonstration of a dual-reporter plasmid system for detecting soluble protein expression based on a novel detection principle. It is the first attempt to indirectly detect the translation rate of the target protein based on the luciferase reporter gene and to respond to protein misfolding based on the inclusion body small heat shock protein promoter IbpAP, and is highly innovative.

[0039] (2) The construction principle of the dual reporter plasmid system for detecting soluble protein expression is innovative. The translation reporter plasmid is constructed by coupling the luciferase reporter gene to the target protein gene through the secondary hairpin structure of mRNA. When the target protein is correctly translated, the secondary hairpin structure of mRNA unfolds under the action of ribosomal helicase activity, thereby exposing the ribosome binding site (RBS) of the downstream luciferase reporter gene to RNA polymerase, promoting the transcriptional expression of luciferase. The real-time quantitative detection of luciferase expression level can indirectly reflect the translation rate of the target protein. Secondly, the misfolding response plasmid is constructed by inserting the inclusion body small heat shock protein promoter IbpAP before GFP. When the intracellular recombinant protein is misfolded, the sigama factor in Escherichia coli will bind to the misfolded protein, promoting the further release of the sigama factor, and the sigama factor level will increase, thereby allowing the sigama factor to bind to RNA polymerase to form a full enzyme complex, recognize the IbpAP promoter, and initiate the expression of GFP protein.

[0040] (3) The application of the dual reporter plasmid system for detecting protein soluble expression has high sensitivity. The recombinant proteins TEV, IL10, and IL1β with different soluble expression conditions were used as research objects. It was found that the translation rate and protein misfolding detected by the dual reporter plasmid system for protein soluble expression were highly correlated with the protein soluble expression conditions. There was a negative correlation between the translation rate and protein solubility, and the real-time misfolding situation was consistent with the translation rate.

[0041] (4) The detection method of the dual reporter plasmid system for detecting protein soluble expression is simple and low-cost. The translation reporter plasmid can be used for micro-volume and high-throughput detection in a 96-well plate, ensuring that the protein translation kinetics can be obtained within about 3 hours of the induced expression process, and the protein expression can be quickly predicted based on the kinetic curve. In terms of experimental methods, only 1×10 7 The cold luminescence value produced by the reaction of luciferase in each cell with the substrate luciferin can be used. The misfolding response plasmid is used to co-express the recombinant protein with the misfolding response plasmid, and the GFP fluorescence can be detected by fluorescence microscopy or flow cytometry analysis at different time points. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1A Schematic diagram of the translation reporter plasmid structure;

[0043] Figure 1B Schematic diagram of misfolding reporter plasmid;

[0044] Figure 1C The figure shows the DNA gel electrophoresis verification of the dual reporter plasmid construction;

[0045] Figure 2A Figure 1 is the result of sensitivity test of translation reporter plasmid;

[0046] Figure 2B Results diagram to support the sensitivity test of the translation reporter plasmid;

[0047] Figure 2C Results of sensitivity test of misfolding reporter plasmid (scale bar on the figure is 100 μm);

[0048] Figure 3A This is a result diagram of the expression of TEV and luciferase proteins in the translation reporter plasmid (pET28a-TEV-hairpin-luciferase);

[0049] Figure 3B This is the result diagram of the expression of IL10 and luciferase proteins in the translation reporter plasmid (pET28a-IL10-hairpin-luciferase);

[0050] Figure 3C This is the result diagram of the expression of IL1β and luciferase proteins in the translation reporter plasmid (pET28a-IL1β-hairpin-luciferase);

[0051] Figure 3D This is the result diagram of the original expression of TEV, IL10, and IL1β;

[0052] Figure 4A The result diagram of the detection of TEV translation rate by translation reporter plasmid (pET28a-TEV-hairpin-luciferase);

[0053] Figure 4B This is a graph showing the results of detecting the translation rate of IL10 using a translation reporter plasmid (pET28a-IL10-hairpin-luciferase);

[0054] Figure 4C The result diagram of the translation reporter plasmid (pET28a-IL1β-hairpin-luciferase) detecting the translation rate of IL1β;

[0055] Figure 4D The result diagram supporting the TEV translation rate;

[0056] Figure 4E The result diagram supporting the translation rate of IL10;

[0057] Figure 4F The result diagram supporting the translation rate of IL1β;

[0058] Figure 5 This is the fluorescence microscopy result of using the misfolding reporter plasmid to detect the misfolding of recombinant proteins (the scale bar on the figure is 100 μm);

[0059] Figure 6 This is a flow cytometry test result diagram of the misfolding reporter plasmid used to detect the misfolding of recombinant proteins;

[0060] Figure 7 This is a diagram illustrating the application of the dual reporter plasmid system of the present invention. DETAILED DESCRIPTION

[0061] To further illustrate the technical means and effects of the present invention, the present invention is further described below in conjunction with the embodiments and drawings. It should be understood that the specific implementation methods described herein are only used to explain the present invention, rather than to limit the present invention.

[0062] If no specific techniques or conditions are specified in the examples, the techniques or conditions described in the literature in the field or the product instructions are used. If no manufacturer is specified for the reagents or instruments used, they are all conventional products that can be purchased through regular channels.

[0063] Example 1

[0064] Construction of a dual reporter plasmid system for soluble protein expression.

[0065] Experimental materials: Buffer and enzyme involved in the enzyme digestion system: all purchased from New England Biolabs; buffer, dNTP, PrimeSTAR involved in the PCR system: all purchased from TAKARA; plasmid extraction kit: TIANGEN, DP103-03, China; gel recovery kit: Bio-Tech, D0056, China.

[0066] 1. Translation reporter plasmid construction method: Using two oligonucleotides as templates, obtain the hairpin structure with the correct sequence through PCR, PCR verification, gel recovery, and product sequencing. Then, after obtaining the target fragment and vector containing the corresponding restriction sites through enzyme digestion, connect the target fragment and the vector through multi-step enzyme ligation. The connection conditions are all 16°C and overnight connection. After the connection is completed, a large number of transformants are obtained through amplification and transformation, and the successfully connected transformants are selected through plasmid extraction, enzyme verification, and plasmid sequencing. The restriction sites of each inserted target sequence and vector are as follows: target protein gene sequence (NdeⅠ / BamHⅠ), mRNA secondary structure sequence (BamHⅠ / HindⅢ), luciferase gene sequence (HindⅢ / XhoI), pET28a+(NdeⅠ / XhoI) as Figure 1A , Figure 1C shown.

[0067] 2. Construction of misfolding response plasmid: By enzyme digestion, the pSEVA631 vector sequence containing IbpAP and the GFP target protein sequence were obtained from the plasmids pSEVA631-IbpAP-mCherry and pET21a-SV gene-GFP, respectively. The corresponding enzyme digestion sites were BamHI and HindⅢ, respectively. Subsequently, the single clones with correct connection were screened out by connection, transformation, plasmid extraction, enzyme digestion verification, and plasmid sequencing. Figure 1B , Figure 1C). Based on the action mechanism of Sigma32 (RpoH) transcription factor in Escherichia coli, when there is protein misfolding in the cell, DnaK will immediately bind to it and release the RpoH transcription factor. The free RpoH then binds to RNA polymerase, recognizes the heat shock stress promoter, and induces the expression of GFP fluorescent protein behind the promoter. The presence and intensity of GFP fluorescent protein luminescence can be used to visualize and monitor the occurrence of recombinant protein misfolding in the cell in real time.

[0068] Example 2

[0069] Protein expression dual reporter plasmid performance testing.

[0070] Experimental materials: Luciferase activity detection kit: Promega, E1500, Promega (Beijing) Biotechnology Co., Ltd.; cell lysis buffer: 1×CCLR, 1.25mg / mL lysozyme, 2.5mg / mL BSA; 5mg / mL lysozyme: 1 volume of 1M K2HP04 (pH 7.8), 20mM EDTA added to 9 volumes of water, and then add an appropriate amount of lysozyme to make the final concentration of 5mg / mL; staining solution (1L): 250mL anhydrous ethanol, 80mL acetic acid, 1.25mg Coomassie brilliant blue, dilute to 1L with ddH2O; decolorization solution (1L): 95mL anhydrous ethanol, 50mL glacial acetic acid, dilute to 1L with ddH2O.

[0071] 1. Translation reporter plasmid performance test method: After the translation reporter plasmid is transformed into BL21 (DE3) to obtain transformants, 2-3 transformants are inoculated and cultured overnight at 37°C, 200rpm. The next day, fresh bacterial liquid is inoculated at a ratio of 100× and cultured to 100mL, and cultured at 37°C, 200rpm until OD 600 When the concentration of IPTG was about 0.7, the corresponding working concentration of IPTG was added to induce expression in a 96-well plate. At different time points of induced expression, 1×10 7 Each cell was mixed with 10 μL 1MK2HP04 (pH 7.8), 20 mM EDTA, quickly frozen in liquid nitrogen and equilibrated to room temperature, then 300 μL of freshly prepared lysis mixture was added and incubated at room temperature for 10 min. Finally, 20 μL of the above cell lysate was reacted with 100 μL luciferase substrate in a 96-well plate (Thermo, 176037, Denmark), and the cold luminescence generated was detected by Cytation 3 (BioTek) multifunctional microplate reader (Benteng Instrument Co., Ltd., China), and the data were plotted and analyzed in GraphPad PRISM 7.0.

[0072] 2. SDS-PAGE detection system: The sample preparation process is the same as above. Centrifuge the sample at 8000rpm for 5min and remove the supernatant. Then, at every 0.1 OD 600 Add 10 μL 1× SDS loading buffer to resuspend the sample, heat at 95°C for 5 min to fully lyse the cells, load 8 μL per well, and set the electrophoresis conditions to 200V, 45 min. Finally, stain and decolorize to analyze the protein expression at different time points.

[0073] 3. Misfolding response plasmid performance detection: The misfolding response plasmid was transformed into BL21 (DE3) to obtain transformants, and the subsequent cell culture was the same as the above conditions. The difference was that the temperature was set to 45°C for heat shock culture during the induction process. Samples were taken at 0min, 10min, 20min, 40min, and 60min of heat shock. After the above-mentioned retained bacteria were fully washed with PBS, they were observed using the blue channel (470 / 490) of a fluorescence microscope with a magnification of 400 times.

[0074] Luciferase activity assay to quantitatively analyze the expression dynamics of luciferase (such as Figure 2A ). The results showed that when the IPTG concentration remained unchanged (1mM), the protein translation rate would increase with the increase in temperature. At 37°C, it reached the plateau phase at about 60min, at 30°C, it reached the plateau phase at about 100min, and at 16°C, the protein translation rate was the slowest. In addition, when the induction expression temperature was kept unchanged (30°C) and the IPTG concentration was reduced to 0.1mM, the protein translation rate decreased and reached the plateau phase at about 180min. This fully demonstrates that changes in luciferase kinetics can indeed reflect changes in protein translation speed. The results of the translation reporter plasmid detection were consistent with the analysis results of sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (such as Figure 2B ) have high consistency. In summary, it is believed that the translation reporter plasmid has high sensitivity and excellent performance.

[0075] In order to identify the performance of the protein misfolding reporter plasmid, the E. coli containing the misfolding response plasmid was heat-shocked to cause the protein to misfold, and then test whether the misfolding response plasmid could be expressed. The results showed (eg Figure 2C ), heat shock causes misfolding of intracellular proteins, and GFP fluorescent protein is expressed. It is believed that the misfolding reporter plasmid has excellent performance.

[0076] Example 3

[0077] The usability of the translation reporter plasmid was tested with different recombinant proteins.

[0078] Experimental materials: Transfer solution (1 L): 1.875 g SDS, 14.5 g glycine, 29 g Tris, fixed to 1 L with ddH2O, and the remaining materials are the same as those in Examples 1 and 2.

[0079] 1. Cell preparation: The corresponding transformants were induced to express in the same manner as in Example 1 and Example 2. After 4.5 hours of induction expression, the fermentation broth was centrifuged at 4°C, 8000rpm for 5 minutes, the supernatant was removed, the bacterial precipitate was resuspended with a certain volume of PBS and then centrifuged under the above conditions, and the supernatant was removed. Then, the bacterial precipitate containing the recombinant protein was resuspended to 25mL with 2×PBS, cocktail (MCE, HY-K0011, China) and 200μL 200mM PMSF (Biyuntian, ST2573, China) were added, and the cells were broken with a medicine spoon until there was no obvious flocculent precipitation, 200μL 200mM PMSF and 150μL 1mg / mL lysozyme were added, and the cells were placed on ice for 20 minutes. Then, the cells were fully lysed using a Biosafer ultrasonic disruptor, and the ultrasonic conditions were: No. 3 probe, 50% power, ultrasonic 3s, stop 6s, and the total ultrasonic time was 7min. The lysate was sampled and then centrifuged at 4°C, 12000 rpm for 40 min to separate the supernatant and precipitate, and the precipitate was resuspended in 25 mL 2× PBS and sampled together with the supernatant. Finally, the sample was tested by SDS-PAGE and WB.

[0080] 2. The SDS-PAGE detection system is the same as that in Example 2.

[0081] 3. WB detection system: The preliminary sample preparation process and sample preparation process are the same as the above-mentioned SDS-PAGE detection system. The difference is that the protein gel is run with a sample volume of 4 μL per well, and the electrophoresis conditions are 80V and 120min. Then, transfer the membrane under 100V conditions, and the transfer time needs to be set according to the molecular weight of the protein to be analyzed. Block with 5% skim milk powder overnight, and incubate with the primary antibody Mouse anti His-Tag mAB (ABClonal, AE003, China) and the secondary antibody Goat anti mouse IgG (ABClonal, AS003, China) the next day. Finally, use the ultrasensitive ECL chemiluminescence kit (New Saimei Biotechnology Co., Ltd., P10100, China) to perform imaging analysis in the Amersham Imager 600 (GE healthcare) gel imager. It should be noted that the membrane needs to be fully washed with 1×TBST before each operation.

[0082] The expression of the target protein gene alone (such as Figure 3D ) and the expression of the target protein gene in the translation reporter plasmid (e.g. Figure 3A , Figure 3B , Figure 3C ) were compared and analyzed. The results showed that the mRNA secondary hairpin structure and luciferase gene in the translation reporter plasmid would not affect the original expression of the target protein gene. Specifically, TEV (such as Figure 3A , 3D), IL10 (such as Figure 3B , Figure 3D ) still showed very low solubility (IL10 had the worst soluble expression), while IL1β (such as Figure 3C , Figure 3D ) still showed excellent solubility. It was also found that the soluble expression of the luciferase gene was consistent with the expression of the target protein gene, which further illustrates the feasibility of the translation reporter plasmid in the present invention for detecting protein translation rate and further for detecting protein expression.

[0083] Example 4

[0084] The experimental materials, luciferase translation rate detection system, SDS-PAGE detection system, and WB detection system are all the same as those in Example 1 and Example 2.

[0085] Based on the translation reporter plasmid constructed in Example 1, the translation characteristics of three recombinant proteins with different expression conditions in E. coli were detected by detecting the cold luminescence values ​​of the reaction between luciferase and substrate at different time points. The results showed that TEV (such as Figure 4A ), IL10 (such as Figure 4B ) reaches the translation plateau relative to IL1β (e.g. Figure 4C ) is much faster. Specifically, TEV reaches the plateau phase of translation rate at about 40min, IL10 reaches the plateau phase at about 120min, and IL1β slowly reaches the plateau phase at 360min, which is extremely slow. The translation level of IL1β (from the value of cold luminescence) is much higher than that of TEV and IL10. The translation levels of TEV and IL10 are both less than 1 million, while the translation level of IL1β can reach more than 4 million. Combined with the fact that IL1β is very easy to express in a soluble form relative to TEV and IL10, the above results fully illustrate the use of the constructed translation reporter plasmid to identify the translation characteristics of unknown recombinant proteins, and can provide highly sensitive indications of their soluble expression. This reporter plasmid has the development potential for rapid detection of the solubility of unknown proteins during the expression of recombinant proteins.

[0086] In order to further verify the accuracy of the detection results of the translation reporter plasmids for the translation characteristics of the three recombinant proteins, the above results were confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and protein blotting (WB) analysis. Figure 4D , Figure 4E , Figure 4F ), SDS-PAGE and WB results were highly consistent with the results of using the constructed translation reporter plasmid to detect the translation characteristics of the recombinant protein. The above experimental results fully demonstrate the sensitivity of using the constructed translation reporter plasmid to detect the translation characteristics of the recombinant protein and make a preliminary indication of the expression of the recombinant protein.

[0087] Example 5

[0088] Application of misfolding response plasmids.

[0089] The target protein expression plasmid to be studied and the misfolding reporter plasmid were co-transformed into BL21 at a ratio of 1:1 to obtain transformants. The pre-induction preparation was performed as described above. Samples were taken at 0min, 10min, 20min, 40min, 60min, 120min, and 180min of induced expression. The above-mentioned sampled bacteria were then fully washed with PBS and finally dissolved in a certain volume of PBS solution. A certain volume of bacterial solution was drawn onto a glass slide, covered with a coverslip, and observed using the blue channel (470 / 490) of a fluorescence microscope, with a magnification of 400 times. At the same time, flow cytometry was performed on the same batch of samples, and the FITC channel was selected, with the voltage set to 407V.

[0090] Based on the protein misfolding response plasmid constructed in Example 1, three recombinant proteins with different expression conditions were used as research objects to identify their sensitivity. First, the sensitivity of the misfolding response plasmid was qualitatively detected by fluorescence microscopy. The results showed (as shown in Figure 5 ), the time and degree of expression of green fluorescent protein (GFP) in Escherichia coli can largely reflect the misfolding of different recombinant proteins, and are very consistent with the soluble expression characteristics of recombinant proteins. Specifically, in Escherichia coli co-expressed with TEV, the GFP expression level showed a certain upward trend and reached a peak at 60 minutes. In IL10, whose soluble expression characteristics are worse than TEV, GFP will show a significant high level of expression in the initial stage and last for a long time. In Escherichia coli co-expressed with IL1β, the GFP expression level is extremely low, and almost no green fluorescence is observed. This result is completely consistent with the characteristic that IL1β is easily expressed in a soluble form.

[0091] Secondly, the sensitivity of the misfolding response plasmid was verified by quantitatively detecting the expression of green fluorescent protein at different time points using flow cytometry. The results showed (e.g. Figure 6 ), the results of flow cytometry analysis were consistent with those of fluorescence microscopy observation, which fully demonstrated that the application of misfolding response plasmids had good sensitivity.

[0092] Example 6

[0093] Illustration of the dual reporter plasmid system application.

[0094] Based on the experimental data support of Example 1 and Example 5, an application description system of the dual reporter plasmid system is constructed ( Figure 7 ). The dual reporter plasmid system constructed by the method of Example 1 can quantitatively and visually detect the translation characteristics and misfolding of the recombinant protein. Since the entire operation process is based on a 96-well plate, it also has the characteristics of low cost, high timeliness, and high throughput.

[0095] In addition, by analyzing the correlation between the luciferase activity detected by the translation reporter plasmid and the fluorescence value detected by the misfolding reporter plasmid, it was found that there was an anti-correlation between the two. This anti-correlation is reflected in that the smaller the fluorescence value detected by the misfolding reporter plasmid, the higher the corresponding luciferase activity. This is also consistent with the original soluble expression of the three recombinant proteins mentioned above (IL1β has the highest soluble expression, IL10 has the worst soluble expression, and TEV is in the middle), reflecting the sensitivity of the detection system. Moreover, the model shows that the soluble expression of recombinant proteins can be quickly and efficiently pre-judged in 10-20 minutes, which greatly improves the efficiency of recombinant protein expression research.

[0096] In summary, the dual-reporter plasmid system of the present invention can reflect the expression of recombinant proteins in bacteria in real time and accurately, and can better utilize the E. coli expression system to produce foreign proteins with excellent performance.

[0097] The applicant declares that the present invention illustrates the detailed method of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed method, that is, it does not mean that the present invention must rely on the above-mentioned detailed method to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of various raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A dual reporter plasmid system, characterized in that: The dual reporter plasmid system includes a translation reporter plasmid and a misfolding response plasmid; The translation reporter plasmid includes a target protein gene sequence, an mRNA secondary structure sequence, and a luciferase gene sequence; The misfolding response plasmid includes a heat shock stress promoter and a fluorescent protein gene.

2. The dual reporter plasmid system according to claim 1, characterized in that The fluorescent protein gene includes a green fluorescent protein gene; Preferably, the starting plasmid of the translation reporter plasmid includes at least one of the pET series plasmids or IPTG-induced series plasmids; Preferably, the starting plasmid of the misfolding response plasmid includes at least one of pSEVA631, a plasmid series containing pBBR1 replication origin, or a plasmid series containing CoIE1 replication origin; Preferably, the mRNA secondary structure sequence includes the sequence shown in SEQ ID NO.

1.

3. The dual reporter plasmid system according to claim 1 or 2, characterized in that The luciferase gene sequence includes the sequence shown in SEQ ID NO.

2.

4. The dual reporter plasmid system according to any one of claims 1 to 3, characterized in that The heat shock stress promoter includes lbpAP.

5. The dual reporter plasmid system according to claim 4, characterized in that The nucleic acid sequence of the lbpAP includes the sequence shown in SEQ ID NO.

3.

6. The dual reporter plasmid system according to any one of claims 1 to 5, characterized in that The nucleic acid sequence of the green fluorescent protein gene includes the sequence shown in SEQ ID NO.

4.

7. A method for constructing the dual reporter plasmid system according to any one of claims 1 to 6, characterized in that: The method comprises the following steps: (1) Amplifying the target protein gene sequence, mRNA secondary structure sequence and luciferase gene sequence by PCR method; (2) Insert the target protein gene sequence, mRNA secondary structure sequence and luciferase gene sequence amplified in step (1) into pET28 + The vector was cloned and sequenced to obtain the correct recombinant plasmid. (3) Amplify the green fluorescent protein gene using PCR; (4) The green fluorescent protein gene amplified in step (3) was inserted into the pSEVA631 vector containing the heat shock stress promoter, and sequencing analysis was performed to obtain a recombinant plasmid that was verified to be correct.

8. A kit for detecting protein expression, characterized in that: The kit contains the dual reporter plasmid system according to any one of claims 1 to 6.

9. Use of the dual reporter plasmid system according to any one of claims 1 to 6 in detecting soluble protein expression.

10. Use of the dual reporter plasmid system according to any one of claims 1 to 6 in detecting protein misfolding and / or protein aggregates.

Images