Application of miR-32-5p up-regulating agent in preparation of medicine for diagnosing, preventing and / or treating invasive candida infection

Abstract

The invention provides application of a miR-32-5p up-regulating agent in preparation of a medicine for diagnosing, preventing and / or treating invasive candida infection, and belongs to the technical field of diagnosis and treatment of invasive candida infection. After the miR-32-5p is regulated and controlled and the miR-32-5p is up-regulated, the content of fungi in a mouse body can be reduced, the colonization of candida albicans on the organs of the mouse is reduced, the candida of the mouse is remarkably relieved, and the survival rate is increased. Therefore, the miR-32-5p can be used as a new molecular target for treating the candida anemia and the invasive candida infection. And a new thought and a new tool are provided for noninvasive early diagnosis and later treatment of candida caused by fungal infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of diagnosis and treatment of invasive Candida infection, and particularly relates to the use of a miR-32-5p upregulator in the preparation of a medicament for diagnosing, preventing and / or treating invasive Candida infection. Background Art

[0002] Invasive candidiasis (IC) is an important healthcare-associated fungal infection that can be caused by several species of Candida species, the most common species being Candida albicans. The disease range of invasive candidiasis ranges from mild candidemia to fulminant sepsis, with an associated mortality rate of over 70%. With the development of modern medicine, the frequent use of broad-spectrum antibiotics, glucocorticoids, and immunosuppressants, and the increase in interventional treatments, radiotherapy, chemotherapy, and invasive procedures such as central venous catheters (CVC), mechanical ventilation, hemodialysis, and extracorporeal circulation / extracorporeal membrane oxygenation (ECMO), candidemia has become a common type of invasive fungal infection in hospitals worldwide. First-line drugs, including echinocandins and azoles, were previously effective, but with the emergence of antifungal resistance, there is currently a lack of means to treat invasive candidal infections. Early-onset candidemia occurs more frequently and is associated with increased mortality, prolonged hospital stay, and subsequent increased hospital costs compared with bacterial bloodstream infection. Therefore, there is an urgent need to find new molecular targets to provide new guidance for targeted treatment of IC. Summary of the invention

[0003] In response to the above problems, in a first aspect, the present invention proposes the use of miR-32-5p upregulators in the preparation of drugs for diagnosing, preventing and / or treating invasive Candida infections, or in the screening of drugs for diagnosing, preventing and / or treating invasive Candida infections.

[0004] Further, the miR-32-5p up-regulator includes a molecule, compound or drug that can up-regulate the expression level of miR-32-5p in cells. Exemplarily, the drug includes a traditional Chinese medicine compound Qihuang decoction, which is composed of the following components: 20g of Astragalus, 10g of Rhubarb, 20g of Atractylodes macrocephala, 15g of Codonopsis pilosula, 10g of Citrus aurantium, 10g of Magnolia officinalis, 12g of Scutellaria baicalensis, and 20g of Salvia miltiorrhiza.

[0005] Furthermore, the miR-32-5p upregulator upregulates the expression level of miR-32-5p by promoting miR-32-5p transcription, reducing miR-32-5p degradation or enhancing miR-32-5p stability.

[0006] Furthermore, the symptom type of the invasive Candida infection is candidemia.

[0007] Furthermore, when the miR-32-5p is upregulated:

[0008] Inhibit the invasion and colonization of Candida in the body;

[0009] Down-regulate the expression of inflammatory factors TNF-α and IL-1β.

[0010] In a second aspect, the present invention proposes the use of miR-32-5p as a diagnostic and therapeutic effect marker in the preparation of a reagent or a kit for determining the diagnostic and therapeutic effect of invasive Candida infection.

[0011] Furthermore, the reagent or kit includes a primer pair for specific amplification of miR-32-5p or a primer for reverse transcription of miR-32-5p.

[0012] Furthermore, the upstream primer sequence and the downstream primer sequence of the primer pair for specifically amplifying miR-32-5p are shown as SEQ ID NO.1-1 and SEQ ID NO.1-2, respectively;

[0013] The primer sequences for reverse transcription of miR-32-5p are shown in SEQ ID NO.1-3.

[0014] In a third aspect, the present invention proposes the use of miR-32-5p in preparing a model for diagnosing, preventing and / or treating candidemia.

[0015] Beneficial effects of the present invention:

[0016] The present invention regulates miR-32-5p. After upregulating miR-32-5p, the present invention has a protective effect on mice, can reduce the fungal content in mice, reduce the colonization of Candida albicans in the organs of mice, significantly alleviate the candidemia of mice, and improve the survival rate. It shows that miR-32-5p can be used as a new molecular target for the treatment of candidemia and invasive candida infection. It provides new ideas and tools for the non-invasive early diagnosis and late treatment of candidemia caused by fungal infection.

[0017] Other features and advantages of the present invention will be described in the following description, and partly become apparent from the description, or understood by practicing the present invention. The purpose and other advantages of the present invention can be realized and obtained by the structures pointed out in the description, claims and drawings. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0019] Figure 1A The figure shows the survival rate of mice in each experimental group in Example 1 of the present invention;

[0020] Figure 1B The thymus coefficients of mice in each experimental group in Example 1 of the present invention are shown;

[0021] Figure 1C The spleen coefficients of mice in each experimental group in Example 1 of the present invention are shown;

[0022] Figure 1D Shows actual photos of the kidneys of mice in each experimental group in Example 1 of the present invention;

[0023] Figure 1E The HE staining results of kidney tissues of mice in each experimental group in Example 1 of the present invention are shown;

[0024] Figure 1F The results of grinding and coating the kidney tissues of mice in each experimental group in Example 1 of the present invention are shown;

[0025] Figure 1G Shows Figure 1F Quantitative results of

[0026] Figure 1H The results of detecting the expression level of kidney injury molecule 1 (KIM-1) in each experimental group of mice in Example 1 of the present invention are shown;

[0027] Fig. 1I The results of the detection of the expression level of the pro-inflammatory factor tumor necrosis factor α (TNF-α) in each experimental group of mice in Example 1 of the present invention are shown;

[0028] Figure 1J The results of the detection of the expression level of the pro-inflammatory factor interleukin 1β (IL-1β) in each experimental group of mice in Example 1 of the present invention are shown;

[0029] Figure 1K The results of the detection of the expression level of the anti-inflammatory factor interleukin 10 (IL-10) in each experimental group of mice in Example 1 of the present invention are shown;

[0030] Figure 2 The results of miR-32-5p expression in kidney tissue of mice gavaged with QHJJ in Example 2 of the present invention are shown;

[0031] Figure 3 The results of detecting miR-32-5p after adenovirus injection in Example 3 of the present invention are shown;

[0032] Figure 4A The results of up-regulating the expression of miR-32-5p in Example 3 of the present invention on the survival rate of candidemia model mice are shown;

[0033] Figure 4B The effect of up-regulating the expression of miR-32-5p on the body weight of mice with candidemia model in Example 3 of the present invention is shown;

[0034] Figure 4C The effect of up-regulating the expression of miR-32-5p on the thymus coefficient of candidemia model mice in Example 3 of the present invention is shown;

[0035] Figure 4D The effect of up-regulating the expression of miR-32-5p in Example 3 of the present invention on the spleen coefficient of candidemia model mice is shown;

[0036] Figure 5A A physical picture showing the effect of up-regulating the expression of miR-32-5p on the renal tissue of candidemia model mice in Example 3 of the present invention;

[0037] Figure 5B The cell staining diagram shows the effect of up-regulating the expression of miR-32-5p on the renal tissue of candidemia model mice in Example 3 of the present invention;

[0038] Figure 5C The results of plating the renal tissue of candidemia model mice by up-regulating the expression of miR-32-5p in Example 3 of the present invention are shown;

[0039] Figure 5D The statistical results of the plate counting results of the renal tissue of candidemia model mice by up-regulating the expression of miR-32-5p in Example 3 of the present invention are shown;

[0040] Figure 6 The results of KIM-1 in mouse kidney tissue after injection of adenovirus miR-32-5p in Example 3 of the present invention are shown;

[0041] Fig. 7A The results of detecting the inflammatory factor TNF-α in the renal tissue of mice after injection of adenovirus miR-32-5p in Example 3 of the present invention are shown;

[0042] Figure 7B The results of detecting the inflammatory factor IL-1β in the renal tissue of mice after injection of adenovirus miR-32-5p in Example 3 of the present invention are shown. DETAILED DESCRIPTION

[0043] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] Example 1

[0045] The Chinese medicine compound Qihuang decoction (QHJJ) is used to treat candidemia caused by exogenous C.albicans. The Chinese medicine compound Qihuang decoction used in this embodiment is composed of: 20g of Astragalus, 10g of Rhubarb, 20g of Atractylodes macrocephala, 15g of Codonopsis pilosula, 10g of Citrus aurantium, 10g of Magnolia officinalis, 12g of Scutellaria baicalensis, and 20g of Salvia miltiorrhiza, a total of 117g / drug. Drug source: provided by the First Affiliated Hospital of Anhui University of Traditional Chinese Medicine, which is an in-hospital preparation of the First Affiliated Hospital of Anhui University of Traditional Chinese Medicine; in this embodiment, Balb / c mice (female, 6-8 weeks) were purchased from Skbex, and the C.albicans SC5314 standard strain was donated by Professor Jiang Yuanying (Shanghai Naval Medical University, China).

[0046] The experimental process is as follows:

[0047] Grouping: The mice were adapted for 7-10 days and randomly received tap water and food in a normal 12-h light-dark cycle. The adapted mice were grouped as follows: Sham group, control group 1 (Control1), control group 2 (Control2), C.albicans group (CA group, Model in the figure), low-dose Astragalus decoction (QHJJ-L) group, medium-dose Astragalus decoction (QHJJ-M) group, high-dose Astragalus decoction (QHJJ-H) group and positive drug (FLC) group, a total of 8 groups, 8 mice in each group.

[0048] Modeling: Cyclophosphamide (150 mg / kg and 100 mg / kg) was injected intraperitoneally on days -4 and -1, and Candida albicans suspension (6×10 5CFU / mouse), cyclophosphamide was injected into the control group 1 on days -4 and -1, and Candida albicans was injected into the tail vein of the control group 2 on day 0. After the model was established on day 0, 400 μL of normal saline was gavaged into the Sham group, Control 1 group, and Control 2 group, and the Qihuang decoction drug group was gavaged with drugs every day, with a drug concentration of 1 g / kg. The gavage doses of the low, medium, and high dose groups were 200 μL (QHJJ-L group), 400 μL (QHJJ-M group), and 800 μL (QHJJ-H group), respectively. The QHJJ-H group was gavaged twice, with an interval of 5 hours, and 400 ul was gavaged each time.

[0049] After the membrane formation, the survival rate of mice in each experimental group was counted. It can be seen that the drug QHJJ can improve the survival rate of mice infected with invasive Candida albicans ( Figure 1A ).

[0050] The experiment was terminated when all mice in the CA group died. After the mice were killed, the heart, liver, spleen, lung, and kidney tissues were separated (normal control group n=6, CA group n=6), and the thymus coefficient and spleen coefficient were measured. The thymus coefficient of mice decreased significantly after the injection of the immunosuppressant cyclophosphamide. The thymus coefficient of mice in the CA group was the lowest, and it increased after medication ( Figure 1B ), the spleen coefficient of mice increased significantly after medication ( Figure 1C ).

[0051] Observe the kidney photos, perform HE staining on kidney tissue, and evaluate the inflammatory infiltration. It can be clearly seen from the kidney photos of mice that the CA group has the most fungal colonization in the kidney ( Figure 1D ); HE staining results of mouse kidney tissue showed that the inflammatory infiltration in the kidneys of mice in the CA group was more severe, which was gradually alleviated after medication ( Figure 1E ); the kidney tissue was further weighed, ground and plated to detect the colonization of Candida albicans. The results were as follows Figure 1F and 1G As shown in the figure, the grinding and smearing results of mouse kidney tissue indicate that the mouse model was successfully established. On the other hand, candidemia was alleviated after medication.

[0052] The gene expression levels of mouse kidney injury molecule 1 (KIM-1), pro-inflammatory factors (TNF-α, IL-1β) and anti-inflammatory factor interleukin (IL-10) were detected. Figure 1H-1K As shown, the results showed that QHJJ could reduce the expression of KIM-1 ( Figure 1H ), which may have alleviated renal damage; the expression of TNF-α and IL-1β decreased, indicating that QHJJ has an anti-inflammatory effect and can relieve the inflammation of mouse renal tissue. Figure 1I-1J); Genetic testing of the anti-inflammatory factor interleukin 10 (IL-10) showed that the drug could alleviate inflammation in the kidney tissue of mice ( Figure 1K ).

[0053] From the above experimental results, it can be seen that Qihuang decoction (QHJJ) showed a certain therapeutic effect in the invasive Candida infection mouse model. It can improve the survival rate of mice, promote the recovery of immune function, reduce kidney inflammation and Candida albicans colonization, and relieve candidemia.

[0054] Example 2

[0055] Three groups, namely Sham group, QHJJ-L group and QHJJ-H group, with 6 mice in each group, were intragastrically administered with QHJJ according to the dose for 7 consecutive days.

[0056] In the early preliminary experiments, including the later anatomical sampling, the colonization of Candida albicans in the kidneys and the effects of drug treatment can be clearly seen with the naked eye, for example Figure 1D Therefore, after the model was established, the kidney tissues of the mice were taken and the expression levels of miR-32-5p, KIM-1, TNF-α, IL-1β, and IL-10 were detected by RT-qPCR (reverse transcription real-time quantitative PCR).

[0057] The downstream primer sequences and upstream primer sequences used for specific amplification of miR-32-5p, U6, KIM-1, TNF-α, IL-1β, and IL-10 are shown in Table 1:

[0058] Table 1

[0059] Primer name Sequence number Base sequence (5'→3') Downstream primer sequences for miR-32-5p amplification SEQ ID NO.1-1 CAGTGCAGGGTCCGAGGT Upstream primer sequence for miR-32-5p amplification SEQ ID NO.1-2 AAGCGCCTTATTGCACATTACT U6 amplification downstream primer sequence SEQ ID NO.2-1 ATCCAGTGCAGGGTCCGAGG U6 amplification upstream primer sequence SEQ ID NO.2-2 AGAGAAGATTAGCATGGCCCCTG Downstream primer sequences for KIM-1 amplification SEQ ID NO.3-1 TGCCCCTTTAAGTTGTACCG Upstream primer sequence for KIM-1 amplification SEQ ID NO.3-2 CAATGCCCATCTTCTGCTTG Downstream primer sequences for TNF-α amplification SEQ ID NO.4-1 AGGAGGTTGACTTTCTCCTG Upstream primer sequence for TNF-α amplification SEQ ID NO.4-2 ACCACGCTCTTCTGTCTACT Downstream primer sequences for IL-1β amplification SEQ ID NO.5-1 CATCAGAGGCAAGGAGGAAAAC Upstream primer sequence for IL-1β amplification SEQ ID NO.5-2 TCGCTCAGGGTCACAAGAAA Downstream primer sequences for IL-10 amplification SEQ ID NO.6-1 CTATGCCTGCTCTTACTC Upstream primer sequence for IL-10 amplification SEQ ID NO.6-2 TCACTCTTCACCTGCTCCAC

[0060] The reverse transcription primer sequences used for reverse transcription of miR-32-5p and U6 are shown in Table 2:

[0061] Table 2

[0062]

[0063] SPSS 26.0 software was used for one-way analysis of variance, and LSD test was used for comparison between groups. P < 0.05 was considered to be significantly different, and the results were described using mean ± standard deviation. Figure 2 As shown, it can be seen that after continuous gavage for 7 days, the expression of miR-32-5p in the kidney tissue of mice in the QHJJ-L group and the QHJJ-H group was upregulated, and the miR-32-5p in the kidney tissue of mice in the QHJJ-H group was significantly upregulated.

[0064] Example 3

[0065] Effect of up-regulating miR-32-5p expression on the candidemia model caused by CA.

[0066] Grouping: After the experimental animals adapted to the environment for one week, they were randomly divided into 4 groups: Sham group, C.albicans group (CA group), CA+AAV-miR-32-5p, and AAV-NC control group, with 8 animals in each group.

[0067] Two weeks in advance, the CA+AAV-miR-32-5p group was injected with adenovirus AAV-miR-32-5p through the tail vein, and the 2.5*10^12V.G / mL AAV-NC control group was injected with adenovirus AAV-NC through the tail vein two weeks in advance. The dose was 2.5*10^12V.G / mL and the volume was 100μL. On the day of modeling, the CA group and the CA+AAV-miR-32-5p group were injected with Candida albicans (6×10 5 CFU / mouse), all the mice in the CA group died, and the experiment was terminated.

[0068] (3) The test results are as follows: Figure 3 , Figures 4A-4D and Figures 5A-5D The experimental method is the same as that of Example 2.

[0069] in Figure 3 This is the result of detecting miR-32-5p after adenovirus injection. Figures 4A-4D The effects of up-regulating miR-32-5p expression on the survival rate, body weight, thymus index and spleen index of candidemia model mice are shown respectively. Figures 5A-5D The results of the effect of up-regulating miR-32-5p expression on the renal tissue of mice with candidemia model are shown in the figure, which are the physical picture of the mouse renal tissue, cell staining picture, renal tissue coating results and counting statistics. The results showed that compared with the CA group, up-regulating miR-32-5p expression can significantly inhibit the colonization of Candida albicans in the body, thereby achieving the purpose of alleviating candidemia.

[0070] (4) Mouse kidney tissue was obtained and the expression levels of KIM-1, TNF-α, and IL-1β were detected by conventional RT-qPCR method. The experimental method was the same as that in Example 2. Figure 6 , Fig. 7A and 7B is the test result. Figure 6 It showed that upregulating the expression of miR-32-5p had a mitigating effect on the renal injury molecule KIM-1 in mouse kidney tissue. Figure 7A-7B The results showed that upregulating the expression of miR-32-5p had an important effect on the expression of inflammatory factor TNF-α ( Fig. 7A ) and IL-1β( Figure 7B ) have been alleviated.

[0071] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent substitutions for some of the technical features therein; and these modifications or substitutions do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Use of miR-32-5p upregulators in the preparation of drugs for diagnosing, preventing and / or treating invasive Candida infections, or in screening drugs for diagnosing, preventing and / or treating invasive Candida infections.

2. The use according to claim 1, characterized in that: The miR-32-5p up-regulator includes molecules or compounds that can up-regulate the expression level of miR-32-5p in cells.

3. The use according to claim 1, characterized in that: The miR-32-5p upregulator includes drugs that can upregulate the expression level of miR-32-5p in cells.

4. The use according to claim 1, characterized in that: The miR-32-5p up-regulator up-regulates the expression level of miR-32-5p by promoting miR-32-5p transcription, reducing miR-32-5p degradation or enhancing miR-32-5p stability.

5. The use according to any one of claims 1 to 4, characterized in that: The symptomatic form of the invasive Candida infection is candidemia.

6. The use according to any one of claims 1 to 4, characterized in that: When miR-32-5p is upregulated: Inhibit the invasion and colonization of Candida albicans in the body; Down-regulate the expression of inflammatory factors TNF-α and IL-1β.

7. Use of miR-32-5p as a diagnostic and therapeutic effect marker in the preparation of reagents or kits for judging the diagnostic and therapeutic effects of invasive Candida infection.

8. The use according to claim 7, characterized in that: The reagent or kit includes a primer pair for specific amplification of miR-32-5p or a primer for reverse transcription of miR-32-5p.

9. The use according to claim 8, characterized in that: The upstream primer sequence and the downstream primer sequence of the primer pair for specifically amplifying miR-32-5p are shown in SEQ ID NO.1-1 and SEQ ID NO.1-2, respectively; The primer sequences for reverse transcription of miR-32-5p are shown in SEQ ID NO.1-3.

10. Application of miR-32-5p in preparing a model for diagnosing, preventing and / or treating candidemia.

Images