Biomarker for detecting carotid atherosclerosis and application thereof

Abstract

The invention discloses a biomarker for detecting carotid atherosclerosis and application of the biomarker, and relates to the technical field of biology, the biomarker is circular RNA hsacirc0008558, and the polynucleotide sequence of the biomarker is as shown in SEQ ID NO. 1. According to the invention, circular RNA hsacirc0008558 is used as a biomarker, and the circular RNA is insensitive to nuclease and is more stable than linear RNA, so that the circular RNA has obvious advantages in development and application as a novel clinical diagnosis marker; the circular RNA hsacirc0008558 and the kit thereof provided by the invention can be used for evaluating the carotid atherosclerosis of a patient, a new method for clinically detecting the carotid atherosclerosis is provided, and the carotid atherosclerosis can be quickly, simply and conveniently diagnosed and evaluated with high accuracy, high operability and difficulty in interference.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, in particular to a biomarker for detecting carotid atherosclerosis and application thereof. Background Art

[0002] At present, the morbidity and mortality of cardiovascular and cerebrovascular diseases rank first in the world, which is a serious threat to human health. Therefore, both basic scientific researchers and clinicians attach great importance to the research of cardiovascular and cerebrovascular diseases. Carotid atherosclerosis is an important cause of ischemic stroke. Timely, accurate and effective assessment of carotid atherosclerosis is of great significance for early detection and intervention treatment of ischemic stroke.

[0003] In recent years, the study of the pathogenesis of cardiovascular diseases from the molecular biology level has made great achievements. It is possible to find a method for diagnosing and evaluating carotid atherosclerosis that is fast, simple, accurate, easy to operate, and not easily interfered with.

[0004] Unlike traditional linear RNA (linear RNA, containing 5' and 3' ends), circRNA molecules have a closed circular structure, are not affected by RNA exonucleases, are more stably expressed, and are not easily degraded, which makes circular RNA have obvious advantages in the development and application of new clinical diagnostic markers. As a special non-coding RNA, circRNA can exert sponge activity by binding to specific miRNAs, inhibit miRNA functions, affect the progress of related pathways, and thus affect the development of cerebrovascular diseases. In addition, compared with traditional detection methods, circRNA as a marker has the advantages of convenience, sensitivity, non-invasiveness, and easy tracking. For example, circular ANRIL (cANRIL) is a circular splicing form of the long non-coding RNA ANRIL. Its expression in human cells is related to several SNPs at this site that may affect ANRIL splicing, which can regulate the level of INK4 / ARF and increase the risk of atherosclerosis. In addition, hsa_circ_0001402, which is derived from exons 13, 14, and 15 of TBC1D1, can inhibit VSMC proliferation and migration and activate VSMC autophagy by promoting the expression of FKBPL and BECN1, thereby reducing intimal hyperplasia. Moreover, circARCN1, which can be used as a diagnostic marker for stable angina (SA) or acute coronary syndrome (ACS), has been reported. These studies fully prove that circRNA is associated with the occurrence of diseases and can be well used as a new biomarker for diseases. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a biomarker for detecting carotid atherosclerosis and application thereof.

[0006] In order to solve the above technical problems, the technical solutions adopted by the present invention are as follows.

[0007] A biomarker associated with carotid atherosclerosis, wherein the biomarker is circular RNA hsa_circ_0008558, and its polynucleotide sequence is shown in SEQ ID NO.1.

[0008] A carotid atherosclerosis diagnostic kit capable of measuring the expression level of circular RNA hsa_circ_0008558 in blood.

[0009] Further preferably, the kit comprises the following components: a total RNA extraction reagent set for a plasma sample; an RNA reverse transcription reagent set; a real-time fluorescence quantitative PCR reagent set; and a real-time fluorescence quantitative PCR primer set.

[0010] Further preferably, the total RNA extraction reagent set for the plasma sample includes Buffer RZ solution, chloroform, anhydrous ethanol, deproteinization solution RD, rinse solution RW, adsorption column CR3 and DEPC water.

[0011] Further preferably, the RNA reverse transcription reagent set includes 5×gDNA Buffer, 10×King RT Buffer, FastKing RT Enzyme Mix, FQ-RT Primer Mix and RNase-Free ddH2O.

[0012] Further preferably, the real-time fluorescence quantitative PCR reagent set includes cDNA and 2×ChamQ UniversalSYBR qPCR MasterMix.

[0013] Further preferably, the real-time fluorescence quantitative PCR primer set includes: an amplification primer set for detecting the polynucleotide sequence shown in SEQ ID NO:1, which includes an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3; and an amplification primer set for detecting the internal reference gene GAPDH, which includes an upstream primer shown in SEQ ID NO.4 and a downstream primer shown in SEQ ID NO.5.

[0014] A method for diagnosing carotid atherosclerosis, the method comprising the following steps: a. detecting the expression level of circular RNA hsa_circ_0008558 in the plasma of a test subject;

[0015] b. comparing the expression level of circular RNA hsa_circ_0008558 in the test subject with the reference expression level of healthy subjects;

[0016] c. If the expression level of circular RNAhsa_circ_0008558 in the test subject is lower than the reference expression level of a healthy person, it indicates that the test subject suffers from carotid atherosclerosis.

[0017] Further preferably, the method uses the above-mentioned kit for detection.

[0018] A biomarker is used as a therapeutic target for carotid atherosclerosis, wherein the biomarker is circular RNAhsa_circ_0008558, and its polynucleotide sequence is shown in SEQ ID NO.1.

[0019] The beneficial effects of the above technical solution are: As a biomarker, hsa_circ_0008558 is more stable than linear RNA because circular RNA is insensitive to nucleases, which makes circular RNA have obvious advantages in the development and application of new clinical diagnostic markers; the hsa_circ_0008558 and the kit provided by the present invention can be used to evaluate carotid atherosclerosis in patients, thereby providing a new method for detecting carotid atherosclerosis in the clinic, which can diagnose and evaluate carotid atherosclerosis quickly, simply, accurately, easily and not easily interfered with; the real-time fluorescence quantitative PCR primer set in the kit of the present invention can sensitively and specifically detect the expression amount of circular RNA hsa_circ_0008558 in the plasma of the subject to be tested, and can accurately determine whether the subject suffers from carotid atherosclerosis, which is of great significance for early detection and intervention treatment of ischemic stroke; the hsa_circ_0008558 gene provided by the present invention can also be used as a potential therapeutic target for patients with carotid atherosclerosis. The above-mentioned biomarker, kit and diagnostic method thereof are not affected by human signs and have a more ideal accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is an agarose gel electrophoresis diagram of the hsa_circ_0008558 biomarker prepared in the present invention, wherein the marker is D2000 and the length of the amplified hsa_circ_0008558 sequence is 176 bp;

[0021] Figure 2 Figure 2 is a diagram of the circularization site and PCR product sequencing results;

[0022] Figure 3 This is a graph showing the difference in expression of circular RNA hsa_circ_0008558 in the plasma of healthy subjects (Nor) and patients with carotid atherosclerosis (CAS).

[0023] Figure 4This is the receiver operating characteristic (ROC) curve of plasma hsa_circ_0008558 expression level in predicting patients with carotid atherosclerosis. DETAILED DESCRIPTION

[0024] The following examples illustrate the present invention in detail. The various raw materials and equipment used in the present invention are conventional commercial products and can be directly obtained by purchasing from the market. The experimental methods used in the following examples are conventional methods unless otherwise specified.

[0025] It should be understood that when used in the present specification and the appended claims, the term "comprising" indicates the presence of described features, wholes, steps, operations, elements and / or components, but does not exclude the presence or addition of one or more other features, wholes, steps, operations, elements, components and / or combinations thereof.

[0026] It should also be understood that the term “and / or” used in the specification and appended claims refers to any and all possible combinations of one or more of the associated listed items, and includes these combinations.

[0027] References to "one embodiment" or "some embodiments" etc. described in the specification of this application mean that one or more embodiments of the present application include specific features, structures or characteristics described in conjunction with the embodiment. Therefore, the statements "in one embodiment", "in some embodiments", "in some other embodiments", "in some other embodiments", etc. that appear in different places in this specification do not necessarily refer to the same embodiment, but mean "one or more but not all embodiments", unless otherwise specifically emphasized in other ways. The terms "including", "comprising", "having" and their variations all mean "including but not limited to", unless otherwise specifically emphasized in other ways.

[0028] In addition, in the description of the present application specification and the appended claims, the terms "first", "second", "third", etc. are only used to distinguish the descriptions and cannot be understood as indicating or implying relative importance.

[0029] The following will be combined with specific embodiments of the present invention to clearly and completely describe the technical solution of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Example 1. Test subjects

[0031] Plasma samples of 22 patients (one of whom was excluded due to abnormal data) were randomly selected as the experimental group. The patients were patients with carotid atherosclerosis from Hebei Provincial People's Hospital and had imaging evidence of carotid atherosclerosis.

[0032] Plasma samples from 26 healthy subjects were randomly selected as the control group. The healthy subjects were from the Physical Examination Center of Hebei Provincial People's Hospital and were of similar age to the patients with carotid atherosclerosis. They had no history of stroke or surgery, and their baseline data such as blood lipids, blood sugar, and blood pressure showed no statistical differences compared with those of the patients with carotid atherosclerosis (Table 1). They had no familial genetic diseases and no liver or kidney dysfunction.

[0033] Table 1 Comparison of general data between the two groups M (P25, P75)

[0034]

[0035] Example 2, test method

[0036] 2 mL of peripheral venous blood sample was collected from each subject using EDTA-K2 anticoagulant tube, and the collected blood sample was divided into RNase-free EP tube within 2 hours for use.

[0037] While collecting blood, the gender, age, current medical history, past medical history, smoking and drinking history, comorbidities (such as hyperlipidemia, hypertension, diabetes, etc.), and various imaging indicators (such as stenosis segment, degree and length of stenosis, distal blood supply, etc.) of each subject were collected.

[0038] Before the determination, the above plasma samples were taken out, and then the total RNA extraction reagent set, RNA reverse transcription reagent set, real-time fluorescence quantitative PCR reagent set and real-time fluorescence quantitative PCR primer set of the plasma samples were used to configure various reaction systems to detect the expression level of biomarkers in the samples, and then analyze the difference between the biomarkers in the experimental group and the control group. Among them, the reaction system mainly includes total RNA extraction, total RNA reverse transcription, and real-time fluorescence quantitative PCR of the plasma samples of the test subjects, and then the expression level of the biomarkers in the plasma of healthy people in the control group and the plasma of patients with carotid atherosclerosis in the experimental group is calculated according to the relative quantitative formula of fluorescence quantitative PCR.

[0039] 2.1 Extraction of total RNA from plasma samples

[0040] The total RNA extraction reagent set was extracted using RNAsimple Total RNAKit reagent from Tiangen Biochemical Technology (Beijing) Co., Ltd. The total RNA extraction reagent set included Buffer RZ solution, chloroform, anhydrous ethanol, deproteinization solution RD, rinse solution RW, adsorption column CR3 and DEPC water. The specific steps of the extraction are as follows:

[0041] (a) Take out the above plasma sample, generally add Buffer RZ solution at a ratio of 1:3 (it can be stored at -80℃ after oscillation), mix at room temperature to fully lyse, and incubate at room temperature for 5 minutes;

[0042] (b) Add 0.2 ml of chloroform to the EP tube in (a), cover the tube tightly, shake for 15 seconds, and then stand at room temperature for 3 minutes to obtain a mixed extract;

[0043] (c) centrifuging the mixed extract at 12,000 rpm for 10 min at 4° C., and taking the supernatant into an RNase-free EP tube;

[0044] (d) slowly adding 0.5 times the volume of anhydrous ethanol to the supernatant obtained in (c), mixing well, and transferring the solution to adsorption column CR3;

[0045] (e) After the operation in step (d) is completed, take out the tube and centrifuge it at 4°C and 12000 rpm for 30 seconds, and discard the waste liquid in the collection tube;

[0046] (f) After the operation in step (e) is completed, add 500 μl of deproteinized solution RD (please add ethanol before use) to the adsorption column CR3, centrifuge at 4°C and 12,000 rpm for 30 seconds, discard the waste liquid, and place CR3 in a collection tube;

[0047] (g) Add 500 μl of rinse solution RW (please add ethanol before use) to the adsorption column CR3 obtained in (f), let it stand at room temperature for 2 min, centrifuge at 4°C and 12,000 rpm for 30 sec, and discard the waste liquid;

[0048] (h) repeating step (g);

[0049] (i) Place the adsorption column in a 2 ml collection tube, centrifuge at 12,000 rpm for 2 min at 4 °C to remove residual liquid, and leave at room temperature for 8 min to fully dry;

[0050] (j) Transfer the adsorption column CR3 into a new 1.5 ml centrifuge tube, add 30-100 μl DEPC water, place at room temperature for 2 min, and centrifuge at 4°C and 12,000 rpm for 2 min.

[0051] (k) 1 μl of the RNA solution obtained in (j) was measured using an ultra-micro UV spectrophotometer to measure the absorbance at wavelengths of 260 nm and 280 nm, respectively, and then the A260 / A280 absorbance was calculated to be 1.8 to 2.0; the remaining sample was stored at -80°C pending reverse transcription reaction.

[0052] 2.2 Total RNA reverse transcription

[0053] The first strand of cDNA was synthesized using the FastKing cDNA First Strand Synthesis Kit from Tiangen Biochemical Technology (Beijing) Co., Ltd. The specific steps are as follows:

[0054] (a) Prepare the gDNA removal reaction system according to Table 2 and mix thoroughly. Centrifuge briefly and incubate at 42°C for 3 min. Then place on ice.

[0055] Table 2 gDNA removal reaction system

[0056]

[0057]

[0058] (b) Prepare the reverse transcription reaction system according to Table 3 and add it to the reaction solution obtained in step (a) and mix thoroughly. Incubate at 42°C for 15 min, then at 95°C for 3 min and place on ice. The obtained cDNA can be used for subsequent experiments or stored at -20°C.

[0059] Table 3 Reverse transcription reaction system

[0060]

[0061] 2.3 Real-time fluorescence quantitative PCR

[0062] (1) PCR reaction system of circular RNA hsa_circ_0008558:

[0063] The total volume of the reaction system was 15 μl according to Vazyme's ChamQ Universal SYBR qPCR Master Mix. The components and component contents of the PCR reaction system of circular RNA hsa_circ_0008558 are shown in Table 4 below:

[0064] Table 4 Real-time fluorescence quantitative PCR reaction system

[0065]

[0066] Among them, the upstream and downstream primers in Table 3 are:

[0067] Upstream primer: 5'GCAGAAGGACAGCATAAGGA3' (SEQ ID NO. 2);

[0068] Downstream primer: 5'ACCCTGTAGACTTTTTCCCA3' (SEQ ID NO. 3).

[0069] The amplification reaction conditions were: 95°C for 3 min 20 s, (95°C for 15 s, 55°C for 15 s, 72°C for 10 s) × 40 cycles.

[0070] (2) PCR reaction system of internal reference gene GAPDH:

[0071] A reaction system with a total volume of 15 μl was prepared according to Vazyme's ChamQ Universal SYBR qPCR Master Mix. The components and component contents of the PCR reaction system of the internal reference gene GAPDH are shown in Table 5 below:

[0072] Table 5 Real-time fluorescence quantitative PCR reaction system

[0073]

[0074] Among them, the upstream and downstream primers in Table 4 are respectively:

[0075] Upstream primer: P1-GAPDH: 5'GCTCTCTGCTCCTCCTGT3' (SEQ ID NO. 4);

[0076] Downstream primer: P2-GAPDH: 5'GACTCCGACCTTCACCTTCC3' (SEQ ID NO. 5).

[0077] The amplification reaction conditions were: 95°C for 3 min and 20 s, (95°C for 15 s, 55°C for 15 s, and 72°C for 10 s) × 40 cycles.

[0078] Example 3: Data Analysis

[0079] The experiments were repeated three times, and the results were analyzed using SPSS25.0 statistical software. The rank sum test was used to perform paired comparisons between the control group (Nor), i.e., the group without carotid atherosclerosis, and the experimental group (CAS), i.e., the group with carotid atherosclerosis. P < 0.05 was considered statistically significant.

[0080] Observe the real-time fluorescence quantitative PCR amplification curve and melting curve, set the baseline and threshold to obtain Ct value experimental data; the experimental data is calculated according to the fluorescence quantitative PCR relative quantitative formula: The expression levels of the biomarker circular RNAhsa_circ_0008558 (SEQ ID NO.1) in the plasma of healthy subjects in the control group and patients with carotid atherosclerosis in the experimental group were calculated respectively. This calculation method is a recognized calculation method, which involves the use of internal reference genes.

[0081] Table 6 Statistical table of plasma PCR data of healthy subjects in the control group

[0082]

[0083]

[0084]

[0085] Note: “ND” indicates abnormal data, which has been eliminated.

[0086] Table 7 Statistical table of plasma PCR data of patients with carotid atherosclerosis in the experimental group

[0087]

[0088]

[0089]

[0090] Note: “ND” indicates abnormal data, which has been eliminated.

[0091] Example 4, Result Analysis

[0092] According to the relative quantitative formula of fluorescence quantitative PCR: 2 -△△Ct The expression levels of circular RNA hsa_circ_0008558 (SEQ ID NO.1) in the plasma of healthy subjects (Nor) and patients with carotid atherosclerosis (CAS) were calculated. Figure 3 As shown in Figure 1, the expression level of circular RNA hsa_circ_0008558 (SEQ ID NO.1) in the plasma of patients with carotid atherosclerosis was (0.59±0.17) times that of healthy controls, and the difference was statistically significant (P<0.001). Figure 4 As shown in the figure, the ROC curve results showed that the area under the ROC curve (AUC) of plasma hsa_circ_0008558 expression in predicting carotid atherosclerosis was 0.8425, the cutoff value was 1.171, the sensitivity was 52.38%, and the specificity was 100%. The above test results were consistent with the patient's imaging results.

[0093] While embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that numerous changes, modifications, substitutions and variations may be made to the examples without departing from the principles and spirit of the invention, the scope of the invention being defined by the appended claims and their equivalents.

[0094] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0095] The embodiments described above are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. Such modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention, and should all be included in the protection scope of the present invention.

Claims

1. A biomarker associated with carotid atherosclerosis, characterized in that: The biomarker is circular RNA hsa_circ_0008558, and its polynucleotide sequence is shown in SEQ ID NO.

1.

2. A carotid atherosclerosis screening or diagnostic kit, which can measure the expression level of circular RNA hsa_circ_0008558 in the blood.

3. The kit according to claim 2, characterized in that The kit includes the following components: a total RNA extraction reagent set for plasma samples; an RNA reverse transcription reagent set; Real-time fluorescence quantitative PCR reagent set; Real-time fluorescence quantitative PCR primer set.

4. The kit according to claim 3, characterized in that The total RNA extraction reagent set of the plasma sample includes Buffer RZ solution, chloroform, anhydrous ethanol, deproteinization solution RD, rinse solution RW, adsorption column CR3 and DEPC water.

5. The kit according to claim 3, characterized in that The RNA reverse transcription reagent set includes 5×gDNA Buffer, 10×King RT Buffer, FastKing RT Enzyme Mix, FQ-RT Primer Mix and RNase-FreeddH2O.

6. The kit according to claim 3, characterized in that The real-time fluorescence quantitative PCR reagent set includes cDNA and 2×ChamQ Universal SYBR qPCR Master Mix.

7. The kit according to claim 3, characterized in that The real-time fluorescence quantitative PCR primer set includes: an amplification primer set for detecting the polynucleotide sequence shown in SEQ ID NO:1, which includes an upstream primer shown in SEQ ID NO.2 and a downstream primer shown in SEQ ID NO.3; and an amplification primer set for detecting the internal reference gene GAPDH, which includes an upstream primer shown in SEQ ID NO.4 and a downstream primer shown in SEQ ID NO.

5.

8. Use of a biomarker in the initial screening of carotid atherosclerosis or in the preparation of a diagnostic drug, characterized in that: The biomarker is circular RNA hsa_circ_0008558, and its polynucleotide sequence is shown in SEQ ID NO.

1.

9. Use of a biomarker in the preparation of a drug for treating carotid atherosclerosis, characterized in that: The biomarker is circular RNA hsa_circ_0008558, and its polynucleotide sequence is shown in SEQ ID NO.1; and the biomarker is used as a drug target.

Images