SNP (Single Nucleotide Polymorphism) molecular marker linked with major QTL (Quantitative Trait Loci) related to grass carp body weight traits and application of SNP molecular marker

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker linked with a major QTL (Quantitative Trait Loci) related to grass carp body weight traits and application of the SNP molecular marker, the SNP molecular marker is positioned on a 13428777 site basic group of a 24th chromosome of grass carp, and polymorphism of two alleles A and G appears at the site. The screened SNP molecular marker is closely related to the main effect QTL locus of the grass carp body weight character, and plays an important role in regulation and control of the grass carp body weight. When the genotype of the SNP molecular marker is AA, the average body weight and average body length of the grass carp are higher than those of individuals with genotypes of AG and GG. Therefore, the SNP molecular marker can be used for assisting in selection of grass carp breeding, and especially has a wide application prospect when being used for selecting grass carp strains with high growth speed.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology and genetic breeding, and particularly relates to a SNP molecular marker linked to a major effect QTL site related to a grass carp body weight trait and an application thereof. Background Art

[0002] Grass carp is a major freshwater aquaculture species in my country, and is widely distributed in the Yangtze River, Pearl River and Heilongjiang River basins. Due to its low breeding cost, strong adaptability and easy breeding, grass carp is widely farmed in ponds, lakes and reservoirs. It is the farmed fish with the highest production in my country and even in the world. The weight trait of grass carp is a key factor affecting its production. Genetic improvement of the weight trait of grass carp is one of the most effective ways to increase grass carp production. However, the sexual maturity period of grass carp is usually 4 to 5 years, and its breeding work started late, and the progress of its genetic improvement is relatively slow.

[0003] Molecular marker-assisted breeding (MAS) is an efficient breeding method that can target breeding goals, shorten the breeding period, and reduce blindness in the breeding process. The core of molecular marker-assisted breeding is to develop and identify DNA markers that are highly associated with target traits. SNP (single nucleotide polymorphism) markers are one of the commonly used molecular markers. By designing polymorphisms of nucleotides at the same site, they have the advantages of high polymorphism, simple operation process, and good repeatability.

[0004] The weight trait of grass carp is a complex trait controlled by quantitative trait loci (QTL). It has been proven that QTL positioning is an effective strategy for analyzing complex genetic basis and is conducive to promoting molecular marker-assisted breeding. Therefore, through molecular markers and QTL positioning, studying the weight trait of grass carp at the molecular level is conducive to improving production and laying the foundation for revealing the genetic and molecular mechanism of grass carp weight. Summary of the invention

[0005] The main purpose of the present invention is to provide a SNP molecular marker linked to the main effect QTL site of grass carp weight trait, which is closely related to the main effect QTL site of grass carp weight trait and plays an important role in regulating grass carp weight.

[0006] Another object of the present invention is to provide the use of the SNP molecular marker linked to the major QTL site of grass carp body weight trait in grass carp assisted breeding.

[0007] To achieve the above purpose, the technical solution proposed by the present invention is as follows:

[0008] The first aspect of the present invention provides a SNP marker linked to a major QTL locus of grass carp body weight trait, the marker is located at base 13428777 of chromosome 24 of grass carp, and polymorphisms of two alleles, A and G, occur at this locus.

[0009] The second aspect of the present invention provides a SNP molecular marker amplification primer for detecting the major effect QTL site of the grass carp body weight trait.

[0010] Preferably, the SNP molecular marker amplification primers are designed based on DNA fragments of upstream and downstream sequences of the SNP molecular marker at the major effect QTL site of the body weight trait of grass carp chromosomes, and the lengths of the upstream and downstream sequences are both 100-500 bp.

[0011] Preferably, the SNP molecular marker amplification primers are designed based on a DNA fragment of 500 bp sequence upstream and downstream of the 13428777th base of chromosome 24 of grass carp, and the sequence of the DNA fragment is shown in SEQ ID NO: 1, specifically:

[0012] ATTGGCTAAAATAACCTTTCTTTCAGATCCCACCACACGGGGGCCACTATGCAG

[0013] CAGATTTGTGTCCTACTTCCGTGGGCGTTTTAGATTTCGTGTGTTGACTCTC

[0014] CAGCCCTGTCCATGGCAGTAAAGCTTCTGGATCCCCCCACTGAAACGTGC

[0015] AGGAAGAAGCAGCGAGAGAGAGTTCTCGAGCGCTCAGCTGAGAGAGCTC

[0016] GAGCGAGTTGAGCTGACAGAGTTTTGTCCGTCGCCGTCAGGAGGAAACAA

[0017] ACCAGGGGGACTTAAACGTCCCTCGACATGACGACAAAAACCTCTCCTGAC

[0018] CGAAACGGATATCTTTAACTCTATGCTGGACGCTGTTCGGTTCCCGTGGAT

[0019] GGCTTAGTATGCGAGTTGTGCGCAGTTGAAATGAGGGAGCTTGTGTTTTTT

[0020] TCTCCCTCGTCGTCCAGCGAGAGGACAAGATGGCAGCGCGAGCGCGTCGA

[0021] GCATGCAGTGGGTGCGAATTAAACCCGAACATGTTCACTAAAGACCCACG

[0022] GTCCGACCACAGCTGCTGTCTGTGAAGGTATGGAAGATTTTAACGAGTTGT

[0023] AAAGGCGTAAATACGTGTCTGATACTTAATAGTGAAGATATTAAATCAGGCT

[0024] TGACTTCGGAGGAGTGATCGCGAGCTCGTAGTTGTTGCGAAAAAAGTTGC

[0025] CACGCCACAACAAAAACTTCAAAGCAATGTTTCGCAGGGTTTGGTAATGT

[0026] GTTTTGGTAGCTGTTGAGTTTCTGGTTTTAATAAAATTACAACCTTTTTATTG

[0027] CCTGACAACTTTTAATCTTTAAATGTTCGCAAATACTTGCTGGTCACCAGCC

[0028] AAACCCATAATGTTTACCTAAATCCTACTGCTTAAAACCATGACGTAAAGA

[0029] AGTTCGGTTGCTGTTTTTAAGCTTTACGCATTAAACATTTAAACATTAGTGC

[0030] ATATGAATTGTATGTTTTAAAGTGAGTTTTCCGTATAAACTCGCCAGTTCTACTATAATAAAGTGACATGTTGCTCAATCCTCCCAA(SEQ ID NO:1).

[0031] Furthermore, the amplification primer sequences of the SNP molecular markers are as shown in SEQ ID NO:2 and SEQ ID NO:3, specifically:

[0032] Forward primer: TTGAGCTGACAGAGTTTGTCCG (SEQ ID NO:2);

[0033] Downstream primer: CCCTGCGAAACATTGCTTTG (SEQ ID NO: 3).

[0034] The third aspect of the present invention provides a grass carp breeding method, comprising: using the SNP marker linked to the major effect QTL site of the grass carp weight trait and the SNP molecular marker amplification primer to detect the grass carp DNA to be tested, and selecting suitable grass carp for breeding.

[0035] Furthermore, the detection is performed based on PCR and sequencing.

[0036] The fourth aspect of the present invention provides the use of the SNP marker linked to the major QTL locus of the grass carp body weight trait and the SNP molecular marker amplification primer in grass carp genotyping, grass carp breeding or assisted breeding.

[0037] In the present invention, breeding or assisted breeding is understood in a broad sense, such as including one or more of molecular marker-assisted breeding, QTL analysis, backcross breeding, identification of transgenic components and identification of germplasm resources.

[0038] Compared with the prior art, the present invention has the following beneficial effects:

[0039] The SNP molecular marker screened out by the present invention is a major effect QTL site for the weight trait of grass carp, and plays an important role in regulating the weight trait of grass carp. When the genotype of the SNP molecular marker is AA, the average weight and average body length of grass carp are higher than those of individuals with genotypes AG and GG, and the weight of grass carp can be effectively selected. It can also be used to assist in the selection of grass carp breeding, accelerate the process of high-yield breeding or assisted breeding of grass carp, and has broad application prospects in selecting fast-growing grass carp strains. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a flow chart for the molecular marker development of the major QTL loci associated with the body weight trait of grass carp in the example.

[0041] Figure 2 It is the molecular marker sequencing peak diagram of the main effect QTL site related to the grass carp body weight trait described in the example. DETAILED DESCRIPTION

[0042] In order to more fully understand and demonstrate the technical solutions, purposes and advantages of the present invention, the technical effects produced by the present invention are further described in detail and completely in conjunction with specific embodiments. Obviously, the described embodiments are only part of the embodiments of the present invention, not all. It should be pointed out that for those of ordinary skill in the art, other embodiments obtained without departing from the concept of the present invention all belong to the protection scope of the present invention.

[0043] Example 1

[0044] The molecular marker development process of the major QTL loci related to the weight trait of grass carp in this embodiment is as follows: Figure 1 As shown, one female parent and one male parent of grass carp from the Yangtze River system were selected to construct a full-sib family. The offspring were raised in a 667-square-meter earthen pond in the Grass Carp Genetic Breeding Center, and 185 offspring were randomly selected for construction of the genetic linkage map.

[0045] The total DNA of the two parents and 185 offspring was extracted by phenol-chloroform method. The integrity of the extracted total DNA was analyzed by 1% agarose gel electrophoresis, and its concentration was determined by NanoDrop 2000 spectrophotometer.

[0046] Genotyping of grass carp parents and progeny by simplified genome sequencing.

[0047] The genetic linkage map of grass carp SNP molecular markers constructed 24 linkage groups. The total length of the genetic linkage map was 1752.742 cM, containing a total of 3979 markers, and the average genetic distance between markers was 0.44 cM (Table 1).

[0048] Table 1: Genetic linkage map information

[0049]

[0050]

[0051] The results of using these SNP molecular markers to detect QTLs for body weight traits showed that there was a major QTL for body weight traits at SNP2343 located on chromosome 24 (Table 2).

[0052] Table 2: Main effect QTL information of grass carp weight traits

[0053]

[0054] The SNP molecular marker is located at base 13428777 on chromosome 24.

[0055] The SNP molecular marker linked to the major QTL locus of grass carp body weight trait and the flanking 500 bp sequence (SEQ ID NO: 1) were selected using BEDTools software, and amplification primers were designed using Primer 5 software (Table 3).

[0056] Table 3: SNP2343 molecular marker primers

[0057]

[0058] A total of 539 grass carp germplasm resources were further used to verify the SNP molecular marker linked to the major QTL locus of grass carp body weight traits.

[0059] 20 female parents and 22 male parents of grass carp from the Yangtze River system were selected to construct the first mixed family, and the offspring were raised in the 667-square-meter soil pool of Pond No. 1 of the Grass Carp Genetic Breeding Center; 24 female parents and 21 male parents from the Yangtze River system were selected to construct the second mixed family, and the offspring were raised in the 667-square-meter soil pool of Pond No. 2 of the Grass Carp Genetic Breeding Center; 413 offspring were randomly selected from Pond No. 1, and 126 offspring were randomly selected from Pond No. 2, for a total of 539 offspring for verification of the SNP molecular marker.

[0060] The total DNA of 539 grass carps in the validation group was extracted using the phenol-chloroform method.

[0061] PCR amplification of the SNP site was performed on the DNA of 539 grass carp in the verification population.

[0062] The size of the amplified product was checked by 1% agarose gel electrophoresis and the amplified product was sequenced by Sanger sequencing.

[0063] GeneMapper software was used to compare the Sanger sequencing results, and the genotype of each sample at the SNP site was determined based on the sequencing peak graph ( Figure 2 ).

[0064] In the validation population, the genotype frequency and allele frequency of the grass carp SNP molecular marker were statistically analyzed (Table 4). The mutation type of the grass carp SNP molecular marker was conversion, showing two allele types, namely A and G.

[0065] Table 4: Genotype and allele frequency statistics of SNP2343 in the validation population

[0066]

[0067] SPSS software was used to calculate the correlation analysis between different genotypes of the SNP locus and body weight and body length, and the significance level was set at 0.05 (Table 5). It can be seen that among the 413 grass carps in the validation population of Pond No. 1, the average weight of individuals with AA genotype was 289.09±125.14 g, the average weight of individuals with AG genotype was 260.65±102.36 g, and the average weight of individuals with GG genotype was 251.91±55.42 g. The average weight of individuals with AA genotype was significantly greater than that of individuals with AG and GG genotypes. Among the 126 grass carps in the validation population of Pond No. 2, the average weight of individuals with AA genotype was 300.79±153.76 g, the average weight of individuals with AG genotype was 261.38±84.37 g, and the average weight of individuals with GG genotype was 255.10±106.21 g. The average weight of individuals with AA genotype was greater than that of individuals with AG and GG genotypes, and was significantly different from that of individuals with AG genotype. In addition, grass carp with AA genotype in the validation population also showed an advantage in body length, with an average body length higher than that of individuals with AG and GG genotypes.

[0068] Table 5: Association analysis between SNP2343 genotype and body weight and length traits in the validation population

[0069]

[0070] In the same group, if the letters of the data in the same column are different, it means that the difference is statistically significant (P<0.05)

[0071] The present invention uses one female parent and one male parent from the Yangtze River system to construct a full-sib family, and constructs a genetic linkage map by simplified genome sequencing, and detects a major effect QTL related to the weight trait at the SNP2343 site of chromosome 24. The SNP molecular marker is further verified in a verification population, and when the genotype of the molecular marker is AA, the weight and body length of grass carp are higher than those of individuals with genotypes of AG and GG, and can be used to assist in the selection of grass carp strains with fast growth rate.

[0072] The above are only preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A SNP molecular marker linked to a major QTL locus related to the weight trait of grass carp, characterized in that: The marker is located at base 13428777 of chromosome 24 of grass carp, where polymorphism of two alleles, A and G, occurs.

2. A primer for amplifying a SNP molecular marker for detecting the major QTL locus linked to the grass carp weight trait according to claim 1, characterized in that: The DNA fragment is designed based on a 500 bp sequence upstream and downstream of the 13428777th base of chromosome 24 of grass carp. The sequence of the DNA fragment is shown in SEQ ID NO:

1.

3. The SNP molecular marker amplification primer according to claim 2, characterized in that: The SNP molecular marker amplification primer sequences are shown in SEQ ID NO:2 and SEQ ID NO:

3.

4. A grass carp breeding method, characterized in that: include: The SNP marker linked to the major effect QTL locus of the grass carp weight trait according to claim 1 and the SNP molecular marker amplification primers according to claim 2 or 3 are used to detect the grass carp DNA to be tested, and grass carp with genotype AA is selected for breeding.

5. The grass carp breeding method according to claim 4, characterized in that: The detection is based on PCR and sequencing.

6. Use of the SNP marker linked to the major QTL locus of grass carp body weight trait according to claim 1, or the SNP molecular marker amplification primer according to claim 2 or 3 in grass carp genotyping, grass carp breeding or assisted breeding.

7. The use according to claim 6, characterized in that: The grass carp breeding or assisted breeding is selected from one or more of molecular marker assisted breeding, QTL analysis, backcross breeding, transgenic component identification and germplasm resource identification.

Images