A major-effect QTL-linked SNP molecular marker associated with grass carp weight trait and its application

By developing SNP molecular markers linked to major QTL sites for the grass carp weight trait and their amplification primers, the problem of slow grass carp breeding progress has been solved, and efficient breeding selection and yield improvement have been achieved.

CN119799913BActive Publication Date: 2025-10-31SHANGHAI OCEAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510047209.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-01-13
Publication Date
2025-10-31
Estimated Expiration
2045-01-13

AI Technical Summary

Technical Problem

The weight trait of grass carp is controlled by quantitative trait loci (QTLs), and existing technologies are difficult to effectively improve genetically, resulting in slow breeding progress.

Method used

We developed SNP molecular markers linked to major QTL loci for the weight trait in grass carp, designed corresponding amplification primers, and detected them by PCR and sequencing for use in grass carp breeding selection.

Benefits of technology

This method enables effective selection of grass carp weight traits, improves breeding efficiency, shortens breeding time, and increases grass carp yield, especially by selecting strains with fast growth rates.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119799913B_ABST
    Figure CN119799913B_ABST
Patent Text Reader

Abstract

This invention discloses a SNP molecular marker linked to a major QTL locus related to the weight trait of grass carp and its application. This SNP molecular marker is located at base 13,428,777 on chromosome 24 of grass carp, where polymorphisms of both A and G alleles are observed. The SNP molecular marker screened in this invention is closely related to the major QTL locus of grass carp weight trait and plays an important role in the regulation of grass carp weight. When the genotype of this SNP molecular marker is AA, the average weight and average body length of grass carp are higher than those of individuals with genotypes AG and GG. Therefore, this SNP molecular marker can be used to assist in the selection of grass carp breeding, especially in the selection of grass carp strains with fast growth rates, and has broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a major QTL-linked SNP molecular marker related to the weight trait of grass carp and its application. Background Technology

[0002] Grass carp is a major freshwater aquaculture species in my country, widely distributed in the Yangtze, Pearl, and Heilongjiang river basins. Due to its low feeding costs, strong adaptability, and ease of cultivation, grass carp is widely farmed in ponds, lakes, and reservoirs, making it the highest-yielding farmed fish species in my country and even the world. Body weight is a key factor affecting grass carp yield, and genetic improvement of this trait is one of the most effective ways to increase grass carp production. However, grass carp typically reach sexual maturity at 4 to 5 years old, and breeding efforts started relatively late, resulting in relatively slow progress in genetic improvement.

[0003] Molecular marker-assisted breeding (MAS) is a highly efficient breeding method that can target breeding objectives, shorten breeding time, and reduce the randomness in the breeding process. The core of MAS lies in the development and identification of DNA markers highly associated with the target trait. SNP (single nucleotide polymorphism) markers are one of the commonly used molecular markers. By designing polymorphic designs for nucleotides at the same site, they offer advantages such as high polymorphism, simple operation procedures, and good reproducibility.

[0004] Grass carp weight is a complex trait controlled by quantitative trait loci (QTLs). QTL mapping has been proven to be an effective strategy for analyzing complex genetic bases and is beneficial for advancing marker-assisted breeding. Therefore, studying grass carp weight at the molecular level through molecular markers and QTL mapping is conducive to improving yield and lays the foundation for revealing the genetic and molecular mechanisms of grass carp weight. Summary of the Invention

[0005] The main objective of this invention is to provide an SNP molecular marker linked to the major QTL site of grass carp weight trait, which is closely related to the major QTL site of grass carp weight trait and plays an important role in the regulation of grass carp weight.

[0006] Another objective of this invention is to provide the application of the SNP molecular marker linked to the major QTL locus of grass carp weight trait in grass carp assisted breeding.

[0007] To achieve the above objectives, the technical solution proposed by this invention is as follows:

[0008] In a first aspect, the present invention provides an SNP marker linked to a major QTL site for the weight trait of grass carp, the marker being located at base 13428777 on chromosome 24 of grass carp, at which polymorphisms of two alleles, A and G, are observed.

[0009] In a second aspect, the present invention provides SNP molecular marker amplification primers for detecting major QTL sites of the grass carp weight trait.

[0010] Preferably, the SNP molecular marker amplification primers are designed based on the DNA fragments of the upstream and downstream sequences of the major QTL locus of the weight trait on grass carp chromosomes, and the length of the upstream and downstream sequences is 100-500 bp.

[0011] Preferably, the SNP molecular marker amplification primers are designed based on a DNA fragment of 500 bp upstream and downstream of base position 13428777 on chromosome 24 of grass carp, the sequence of which is shown in SEQ ID NO:1, specifically:

[0012] ATTGGCTAAAATAACCTTTCTTTCAGATCCCACCACACGGGGGCCACTATGCAG

[0013] CAGATTTGTGTCCTACTTCCGTGGGCGTTTTAGATTTCGTGTGTTGACTCTC

[0014] CAGCCCTGTCCATGGCAGTAAAGCTTCTGGATCCCCCCACTGAAACGTGC

[0015] AGGAAGAAGCAGCGAGAGAGAGTTCTCGAGCGCTCAGCTGAGAGAGCTC

[0016] GAGCGAGTTGAGCTGACAGAGTTTTGTCCGTCGCCGTCAGGAGGAAACAA

[0017] ACCAGGGGGACTTAAACGTCCCTCGACATGACGACAAAAACCTCTCCTGAC

[0018] CGAAACGGATATCTTTAACTCTATGCTGGACGCTGTTCGGTTCCCGTGGAT

[0019] GGCTTAGTATGCGAGTTGTGCGCAGTTGAAATGAGGGAGCTTGTGTTTTTT

[0020] TCTCCCTCGTCGTCCAGCGAGAGGACAAGATGGCAGCGCGAGCGCGTCGA

[0021] GCATGCAGTGGGTGCGAATTAAACCCGAACATGTTCACTAAAGACCCACG

[0022] GTCCGACCACAGCTGCTGTCTGTGAAGGTATGGAAGATTTTAACGAGTTGT

[0023] AAAGGCGTAAATACGTGTCTGATACTTAATAGTGAAGATATTAAATCAGGCT

[0024] TGACTTCGGAGGAGTGATCGCGAGCTCGTAGTTGTTGCGAAAAAAGTTGC

[0025] CACGCCACAACAAAAACTTCAAAGCAATGTTTCGCAGGGTTTGGTAATGT

[0026] GTTTTGGTAGCTGTTGAGTTTCTGGTTTTAATAAAATTACAACCTTTTTATTG

[0027] CCTGACAACTTTTAATCTTTAAATGTTCGCAAATACTTGCTGGTCACCAGCC

[0028] AAACCCATAATGTTTACCTAAATCCTACTGCTTAAAACCATGACGTAAAGA

[0029] AGTTCGGTTGCTGTTTTTAAGCTTTACGCATTAAACATTTAAACATTAGTGC

[0030] ATATGAATTGTATGTTTTAAAGTGAGTTTTCCGTATAAACTCGCCAGTTCTACTATAATAAAGTGACATGTTGCTCAATCCTCCCAA(SEQ ID NO:1).

[0031] Furthermore, the SNP molecular marker amplification primer sequences are as shown in SEQ ID NO:2 and SEQ ID NO:3, specifically:

[0032] Forward primer: TTGAGCTGACAGAGTTTGTCCG (SEQ ID NO:2);

[0033] Downstream primer: CCCTGCGAAACATTGCTTTG (SEQ ID NO:3).

[0034] A third aspect of the present invention provides a method for breeding grass carp, comprising: using an SNP marker linked to the major QTL site of the grass carp weight trait and the SNP molecular marker amplification primers to detect the DNA of the grass carp to be tested, and selecting suitable grass carp for breeding.

[0035] Furthermore, the detection is based on PCR and sequencing.

[0036] In a fourth aspect, the present invention provides an SNP marker linked to the major QTL site of the grass carp weight trait, and the application of the SNP molecular marker amplification primers in grass carp genotyping, grass carp breeding, or assisted breeding.

[0037] In this invention, breeding or assisted breeding is understood in a broad sense, such as including one or more of molecular marker-assisted breeding, QTL analysis, backcross breeding, transgenic component identification, and germplasm resource identification.

[0038] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0039] The SNP molecular markers screened in this invention are major QTL loci for grass carp weight traits, playing an important role in the regulation of grass carp weight traits. When the genotype of this SNP molecular marker is AA, the average weight and average body length of grass carp are higher than those of individuals with genotypes AG and GG. This can effectively select for grass carp weight and can also be used to assist in the selection of grass carp breeding, accelerate the process of high-yield breeding or assisted breeding of grass carp, and has broad application prospects in selecting grass carp strains with fast growth rates. Attached Figure Description

[0040] Figure 1 This is a flowchart illustrating the development of molecular markers for major QTL sites related to the weight trait of grass carp in this embodiment.

[0041] Figure 2 This is a molecular marker sequencing peak diagram of the major QTL sites related to the weight trait of grass carp described in the examples. Detailed Implementation

[0042] To more fully understand and demonstrate the technical solutions, objectives, and advantages of the present invention, the technical effects produced by the present invention will be further described in detail and completely below with reference to specific embodiments. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. It should be noted that other embodiments obtained by those skilled in the art without departing from the concept of the present invention are all within the protection scope of the present invention.

[0043] Example 1

[0044] In this embodiment, the molecular marker development process for major QTL sites related to grass carp weight traits is as follows: Figure 1 As shown, one female and one male grass carp from the Yangtze River system were selected to construct a full-sib family. The offspring were raised in a 667-square-meter earthen pond at the grass carp genetic breeding center, and 185 offspring were randomly selected for genetic linkage map construction.

[0045] Total DNA was extracted from two parental lines and 185 progeny lines using the phenol-chloroform method. The integrity of the extracted total DNA was analyzed by 1% agarose gel electrophoresis, and its concentration was determined using a NanoDrop 2000 spectrophotometer.

[0046] Genotyping of grass carp parents and offspring was performed using simplified genome sequencing.

[0047] Genetic linkage maps of grass carp SNP molecular markers were constructed, with 24 linkage groups and a total length of 1752.742 cM, containing 3979 markers. The average genetic distance between markers was 0.44 cM (Table 1).

[0048] Table 1: Genetic linkage map information

[0049]

[0050]

[0051] Using these SNP molecular markers to detect QTLs for the weight trait, the results showed that there was a major QTL for the weight trait located at SNP2343 on chromosome 24 (Table 2).

[0052] Table 2: Major effect QTL information of the grass carp weight trait

[0053]

[0054] The SNP molecular marker is located at base 13428777 on chromosome 24.

[0055] The SNP molecular marker linked to the major QTL site associated with the weight gain trait of grass carp and its flanking 500bp sequences (SEQ ID NO:1) were selected using BEDTools software, and amplification primers were designed using Primer 5 software (Table 3).

[0056] Table 3: SNP2343 molecular marker primers

[0057]

[0058] Further, using 539 grass carp germplasm resources, we verified the SNP molecular marker linked to the major QTL site of the grass carp weight trait.

[0059] The first hybrid family was constructed using 20 female and 22 male grass carp from the Yangtze River system, and the offspring were raised in Pond No. 1, a 667-square-meter earthen pond at the Grass Carp Genetic Breeding Center. Similarly, the second hybrid family was constructed using 24 female and 21 male grass carp from the Yangtze River system, and the offspring were raised in Pond No. 2, a 667-square-meter earthen pond at the Grass Carp Genetic Breeding Center. 413 offspring were randomly selected from Pond No. 1 and 126 offspring were randomly selected from Pond No. 2, for a total of 539 offspring for the verification of the SNP molecular marker.

[0060] Total DNA was extracted from 539 grass carp in the population using the phenol-chloroform method.

[0061] PCR amplification of this SNP site was performed on the DNA of 539 grass carp in the validation population.

[0062] The size of the amplified product bands was examined using 1% agarose gel electrophoresis, and the amplified products were then subjected to Sanger sequencing.

[0063] The Sanger sequencing results were compared using GeneMapper software, and the genotype of each sample at that SNP locus was determined based on the sequencing peak diagram. Figure 2 ).

[0064] In the validation population, the genotype and allele frequencies of this grass carp SNP molecular marker were statistically analyzed (Table 4). The mutation type of this grass carp SNP molecular marker was a transition, manifested as two alleles, namely A and G.

[0065] Table 4: Genotype and allele frequencies of SNP2343 in the validation population

[0066]

[0067] The correlation between different genotypes of this SNP locus and body weight and length was calculated using SPSS software, with a significance level of 0.05 (Table 5). It was observed that in the validation population of 413 grass carp in Pond 1, the average body weight of individuals with the AA genotype was 289.09 ± 125.14 g, the average body weight of individuals with the AG genotype was 260.65 ± 102.36 g, and the average body weight of individuals with the GG genotype was 251.91 ± 55.42 g. The average body weight of individuals with the AA genotype was significantly greater than that of individuals with the AG and GG genotypes. In the validation population of 126 grass carp in Pond 2, the average body weight of individuals with the AA genotype was 300.79 ± 153.76 g, the average body weight of individuals with the AG genotype was 261.38 ± 84.37 g, and the average body weight of individuals with the GG genotype was 255.10 ± 106.21 g. The average body weight of individuals with the AA genotype was greater than that of individuals with the AG and GG genotypes, and there was a significant difference compared to individuals with the AG genotype. In addition, grass carp with the AA genotype also showed an advantage in body length in the validation population, with an average body length higher than that of individuals with the AG and GG genotypes.

[0068] Table 5: Association analysis between SNP2343 genotype and body weight and body length traits in the validation population

[0069]

[0070] In the same group, if the letters in the same column of data are different, it indicates that the difference is statistically significant (P<0.05).

[0071] This invention utilizes one female and one male parent from the Yangtze River system to construct a full-sib family. A genetic linkage map is built using simplified genome sequencing, and a major-effect QTL related to body weight trait is detected at SNP2343 on chromosome 24. Further validation of this SNP marker in a validation population shows that when the genotype of this marker is AA, the grass carp exhibit higher body weight and length than individuals with genotypes AG and GG, which can be used to assist in the selection of grass carp strains with faster growth rates.

[0072] The above are merely preferred embodiments of the present invention and are not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A method for breeding grass carp, characterized in that, include: The DNA of grass carp to be tested was detected using SNP molecular markers linked to major QTL sites of grass carp weight traits and primers for amplification of the SNP molecular markers. Grass carp with genotype AA were selected for breeding, and the average body weight of grass carp with genotype AA was [not specified]. The SNP molecular marker linked to the major QTL site associated with the grass carp weight trait has the sequence shown in SEQ ID NO:1, wherein polymorphism of two alleles, A and G, appears at base 501. The amplification primer sequences for the SNP molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:

3.

2. The grass carp breeding method according to claim 1, characterized in that, The detection of grass carp DNA was performed using PCR and sequencing.

3. Application of an SNP molecular marker amplification primer in grass carp genotyping or breeding; The sequence of the SNP molecular marker is shown in SEQ ID NO:1, wherein polymorphism of two alleles, A and G, appears at the 501st base; The amplification primer sequences for the SNP molecular marker are shown in SEQ ID NO:2 and SEQ ID NO:3; The genotyping includes: the average body weight of grass carp with genotype AA; The breeding includes: selecting grass carp with genotype AA for breeding, wherein the grass carp with genotype AA have an average body weight; The application is for screening grass carp with a large average weight.

Citation Information

Patent Citations

  • SNP molecular marker related to grass carp traits and application thereof

    CN113930520A

  • SNP molecular marker related to grass carp traits and application thereof

    CN113957155A