A molecular marker related to soybean hundred-grain weight trait and primer composition and application thereof

Abstract

The application discloses a molecular marker related to a soybean hundred-grain weight trait, a primer composition and application thereof, and relates to the technical field of biotechnology, in particular to a molecular marker related to a soybean hundred-grain weight trait, a primer composition and application thereof. The application identifies or assists in identifying the soybean hundred-grain weight trait by detecting the polymorphism or genotype (allele) of a SNP site in a soybean genome, wherein the SNP site is a site on a chromosome 19 of the soybean, the nucleotide type is A or C, and the 20th nucleotide in sequence 1 in a sequence table. The hundred-grain weight of the soybean with the AA genotype of the site is higher than that of the soybean with the CC genotype. The substance for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as a substance for detecting the single nucleotide polymorphism or genotype of another molecular marker related to the soybean hundred-grain weight trait) to prepare a product for identifying the soybean hundred-grain weight trait.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker related to soybean 100-grain weight trait, a primer composition and application thereof. Background Art

[0002] Soybean (Glycine max (Linn.) Merr.) is an important grain and oilseed crop in my country. With socioeconomic development and the continuous improvement of people's living standards, soybean consumption has increased significantly, leading to a serious imbalance between soybean supply and demand. China is the world's largest soybean consumer. Faced with huge domestic demand, domestic soybean production is insufficient, forcing it to rely heavily on imports. Since 2000, China has become the world's largest soybean importer, and soybean imports have increased annually. Since 2012, my country's soybean dependence on foreign countries has exceeded 80%, and in 2023, imports reached 99.4 million tons, accounting for over 80% of total domestic consumption (https: / / www.cfsn.cn / ). This massive soybean import volume has led to a significant crisis for the entire domestic soybean industry chain, seriously threatening my country's food security. Therefore, increasing soybean yield has always been a challenging issue for soybean breeders in my country.

[0003] Soybean 100-kernel weight is a key factor influencing soybean yield. Several genetic loci and candidate genes associated with 100-kernel weight have been reported, but molecular markers for molecular-assisted soybean breeding remain underdeveloped. Cultivated soybeans have been selected for their much lower genetic diversity than wild soybeans. Discovering and developing molecular markers for 100-kernel weight in wild soybeans and applying them to modern breeding processes has important scientific implications for fully utilizing the superior genetic information of wild soybeans and cultivating new, high-yield, high-quality soybean varieties. Summary of the Invention

[0004] The problem to be solved by the present invention is how to identify or assist in identifying the soybean 100-grain weight trait.

[0005] In order to solve the above technical problems, the present invention first provides the use of a substance for detecting the polymorphism or genotype of SNPs in the soybean genome in any of the following:

[0006] (1) Identify or assist in identifying soybean 100-grain weight traits;

[0007] (2) Screening or breeding soybean plants, lines, strains, or varieties with high 100-grain weight;

[0008] (3) Screening or breeding soybean plants, lines, strains, or varieties with low 100-grain weight;

[0009] (4) Soybean breeding;

[0010] (5) Preparing products for identifying or assisting in identifying soybean 100-grain weight traits;

[0011] (6) preparing products for screening or breeding soybean plants, lines, strains, or varieties with high 100-grain weight;

[0012] (7) preparing products for screening or breeding soybean plants, lines, strains, or varieties with low 100-grain weight;

[0013] (8) preparing soybean breeding products;

[0014] The soybean Williams 82 (Wm82.a2.v1) genome sequence is used as the reference genome. The SNP is a site on soybean chromosome 19, the nucleotide type is A or C, and it is the 20th nucleotide of sequence 1 in the sequence list.

[0015] The present invention also provides a method for identifying or assisting in the identification of the soybean 100-grain weight trait, comprising detecting the genotype of a SNP in the soybean genome to be tested, and identifying or assisting in the identification of the soybean 100-grain weight trait based on the genotype, wherein the SNP is a site on soybean chromosome 19, the nucleotide type of which is A or C, and is the 20th nucleotide of sequence 1 in the sequence list.

[0016] In the above application or method, the genotype of the SNP is AA, CC or AC, wherein AA is the homozygous type of the SNP site A, CC is the homozygous type of the SNP site C, and AC is the heterozygous type of the SNP sites A and C.

[0017] In the above application or method, the identification or auxiliary identification of soybean 100-grain weight trait based on the SNP genotype is any of the following methods:

[0018] 1) The soybean to be tested, whose SNP genotype is AA, is or is a candidate soybean for soybeans with a high 100-grain weight trait;

[0019] 2) The soybean to be tested, whose SNP genotype is CC, is or is a candidate soybean for the soybean low 100-kernel weight trait;

[0020] 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

[0021] As an embodiment, the method for identifying or assisting in identifying the soybean 100-grain weight trait may include the following steps:

[0022] Using the genomic DNA of the soybean to be tested as a template, fluorescent quantitative PCR amplification was performed using the primer combination R4866-FAM, R4866-VIC and R4866-R composed of sequence 2, sequence 3 and sequence 4 in the sequence list. Genotyping was performed based on the fluorescence detection results of the obtained amplification products to identify the 100-grain weight of the soybean sample to be tested; the 100-grain weight of the soybean to be tested whose genotype of the SNP was AA was higher than that of the soybean to be tested whose genotype of the SNP was CC.

[0023] The specific determination method is as follows:

[0024] If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled by the primer shown in Sequence 2 in the sequence table, the genotype of the SNP site is AA, and the soybean sample to be tested is a soybean variety with a high 100-grain weight;

[0025] If the fluorescence of the amplified product is consistent with the fluorescence of the fluorescent group labeled with the primer shown in Sequence 3 in the sequence table, the genotype of the SNP site is CC, and the soybean sample to be tested is a soybean variety with a low 100-grain weight.

[0026] The application of the above-mentioned method for identifying or assisting in identifying the soybean 100-grain weight trait in soybean breeding also falls within the scope of protection of the present invention.

[0027] The present invention also provides a soybean breeding method.

[0028] The soybean breeding method provided by the present invention can be M1 or M2:

[0029] M1. The method comprises detecting the genotype of the SNP of claim 1 in the soybean genome, selecting soybeans having the genotype of the SNP as AA as parents for breeding, wherein the AA is a homozygous form of the SNP as A, and the breeding purpose of the method comprises breeding soybeans having a high 100-grain weight trait;

[0030] M2. The method includes detecting the genotype of the SNP described in claim 1 in the soybean genome, selecting soybeans with the genotype of the SNP being CC as parents for breeding, wherein the CC is the homozygous type of the SNP being C, and the breeding purpose of the method includes breeding soybeans with low 100-grain weight traits.

[0031] The present invention also provides a product containing a substance for detecting the polymorphism or genotype of a SNP site in the soybean genome, and the product may be any of the following:

[0032] C1) Products for detecting single nucleotide polymorphisms or genotypes related to soybean 100-grain weight;

[0033] C2) Products that identify or assist in identifying the soybean 100-kernel weight trait;

[0034] C3) Products used for soybean breeding;

[0035] C4) Screening or breeding soybean plants, lines, strains, or varieties with high 100-kernel weight;

[0036] C5) Screening or breeding products of soybean plants, lines, varieties or varieties with low 100-grain weight.

[0037] In the above applications, methods, and products, the substance may be a reagent and / or instrument required for determining the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chip. Among them, SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on "one-step" reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule DNA binding reactions.

[0038] Alternatively, the substance may be the following D1), D2) or D3):

[0039] D1) containing a primer composition for amplifying a soybean genomic DNA fragment including the SNP site;

[0040] D2) a PCR reagent containing the primer combination described in D1);

[0041] D3) A kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0042] Alternatively, the amplification may be PCR amplification. The primer composition is composed of the primers R4866-FAM, R4866-VIC and R4866-R. In the above-mentioned applications, methods and products, the primer composition may be labeled with a marker or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include but are not limited to dyes; radioactive labels such as 32P; binding moieties such as biotin; haptens such as digoxigenin (DIG); luminescent, phosphorescent or fluorescent moieties; and fluorescent dyes alone or in combination with moieties that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence containing the label is detectable. In some embodiments, nucleic acids are detected directly (eg, directly read the sequence) without labeling.

[0043] In the above-mentioned application, method or product, the primer composition can specifically be composed of primers R4866-FAM, R4866-VIC and R4866-R; the primer R4866-FAM is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list; the primer R4866-VIC is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list; the primer R4866-R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence list.

[0044] The present invention also provides a DNA molecule, the nucleotide sequence of the DNA molecule is shown in Sequence 1 of the sequence listing.

[0045] The application of the above-mentioned DNA molecules also falls within the scope of protection of the present invention. The application is specifically any of the following:

[0046] (1) Identify or assist in identifying soybean 100-grain weight traits;

[0047] (2) Screening or breeding soybean plants, lines, strains, or varieties with high 100-grain weight;

[0048] (3) Screening or breeding soybean plants, lines, strains, or varieties with low 100-grain weight;

[0049] (4) Soybean breeding;

[0050] (5) Preparing products for identifying or assisting in identifying soybean 100-grain weight traits;

[0051] (6) preparing products for screening or breeding soybean plants, lines, strains, or varieties with high 100-grain weight;

[0052] (7) preparing products for screening or breeding soybean plants, lines, strains, or varieties with low 100-grain weight;

[0053] (8) Prepare soybean breeding products.

[0054] Optionally, in the above application, the DNA molecule serves as a detection target.

[0055] The substances for detecting the polymorphism and genotype of the SNP site can be combined with other substances (such as substances for detecting the single nucleotide polymorphism or genotype of other molecular markers related to the soybean 100-grain weight trait) to prepare a product for identifying the soybean 100-grain weight trait.

[0056] The present invention provides a soybean-specific SNP site located on soybean chromosome 19, with a nucleotide type of A or C, corresponding to the 20th nucleotide of sequence 1 in the sequence listing. A primer combination is also provided, along with a method for identifying or assisting in identifying the soybean 100-grain weight trait using the primer combination. The method established by the present invention can be used to predict the soybean 100-grain weight trait, enabling early screening of soybeans to be screened, and can be used in soybean molecular marker-assisted breeding. The method has important application value in the discovery of soybean germplasm resources with high 100-grain weight and the selection of soybean varieties with high 100-grain weight. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 This is a diagram showing the results of QTL positioning analysis for the 100-grain weight trait of population numbered 14025 in Example 1 of the present invention.

[0058] Figure 2 This is the normal distribution of 100-grain weight and marker selection efficiency diagram of population numbered 14025 in 2019 in Example 1 of the present invention.

[0059] Figure 3 This is the normal distribution of 100-grain weight and marker selection efficiency diagram of the population numbered 14025 in 2021 in Example 1 of the present invention.

[0060] Figure 4 This is the genotyping result of the test soybean using the KASP marker in Example 2 of the present invention.

[0061] Figure 5 This is the genotyping result of the test soybean using the dCAPS marker designed for EcoRV digestion in Example 2 of the present invention. DETAILED DESCRIPTION

[0062] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0063] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0064] The quantitative experiments in the following examples were performed in triplicate unless otherwise specified.

[0065] The cultivated soybean Jidou 12 of the present invention has been described in Yang Chunyan, Zhang Mengchen, Zhao Shuangjin, and Wang Wenxiu. "Research on Breeding of High-Yield and High-Protein Soybean Jidou 12," Journal of Hebei Agricultural University, Issue 4, 2004. The public can obtain the biological material from the Institute of Cereals and Oils Crops, Hebei Academy of Agricultural and Forestry Sciences (i.e., the applicant). The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0066] The wild soybean ZYD02738 in the present invention has been described in: Li Man, Shi Xiaolei, Di Rui, Liu Zhifang, Meng Qingmin, Fu Cai, Yang Chunyan, Wang Dongmei, Zhang Mengchen, Zhang Jie, Yan Long. Development and Application of Long-Segment Insertion / Deletion Markers in Soybean, Acta Agriculturae Boreali-Sinica, Issue 1, 2022. The public can obtain the biological material from the Institute of Cereals and Oils Crops, Hebei Academy of Agricultural and Forestry Sciences (i.e., the applicant). The biological material is only used to repeat the relevant experiments of the present invention and cannot be used for other purposes.

[0067] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results were expressed as mean values ​​and tested using t-test. P < 0.001 (***) indicated a highly significant difference.

[0068] Example 1: Discovery of the SNP site Chr19_43194866 associated with soybean 100-grain weight

[0069] The soybean material in the present embodiment comes from: using cultivated soybean Jidou 12 (the variety with high 100-grain weight) as female parent, wild soybean ZYD02738 (the variety with low 100-grain weight) as male parent, hybridize, and set up RIL colony.In 2012, Jidou 12 was female parent, and RIL colony was male parent, and backcrossed, the BC1F1 colony obtained in 2013.In 2014, Jidou 12 was female parent, and the BC1F2 of Jidou 12 and ZYD02738 combination was male parent, and backcrossed; In 2015, BC2F1 colony was obtained. Self-pollination 4 times, BC2F4:5 colony was obtained, and 55 strains of 14025 colony were numbered.

[0070] In December 2018, leaves from the BC2F4:5 line were collected in Sanya, DNA was extracted by BioMed, and genome resequencing was performed on each line to construct a genotype map based on SLAF technology ( Figure 1 ). According to the genetic locus and SNP markers, combined with the Williams 82 reference genome sequence (Glycine max Wm82.a2.v1), sequencing analysis screened out a SNP site related to soybean 100-grain weight, Chr19_43194866_A_C, a diallelic polymorphic SNP site located on chromosome 19 of soybean, which is the 20th nucleotide of sequence 1 in the sequence table, and its nucleotide type is A or C. The genotype of this SNP site is as follows: AA, CC or AC. Chr19_43194866 with genotype AA is a homozygous type of nucleotide A, Chr19_43194866 with genotype CC is a homozygous type of nucleotide C, and Chr19_43194866 with genotype AC is a heterozygous type of A and C. In sequence 1, m is c or a. The genotype identification results of the soybean material Chr19_43194866 in this embodiment are shown in Table 1.

[0071] The phenotypic testing method for soybean 100-grain weight is as follows: The number of grains per plant and the grain weight per plant were counted for each family in the wild soybean substitution line population 14025. The 100-grain weight was calculated using the formula: 100-grain weight = (grain weight per plant / number of grains per plant) × 100. The results of soybean 100-grain weight for the 55 lines in population 14025 are shown in Table 1.

[0072] Table 1. Corresponding results of 100-grain weight of tested soybean materials and their genotypes

[0073]

[0074]

[0075]

[0076] The genotyping results of soybean 100-grain weight at Chr19_43194866 for 55 lines of population No. 14025 are shown in Table 1. The 100-grain weight of 55 BC2F4:5 soybean materials were measured and statistically analyzed. Figure 2 and Figure 3 As shown. Combined with the genotyping results in Table 1, in 2019, the average 100-grain weight of the AA and CC genotype families was 14.92g and 13.45g, respectively. The genetic variation rate that can be explained by this marker in the population is 35.20%. Compared with the average 100-grain weight of the CC genotype family, the average 100-grain weight of the AA genotype family was significantly higher by 10.95% (P < 0.001); in 2021, the average 100-grain weight of the AA and CC genotype families was 18.81g and 16.67g, respectively. The genetic variation rate that can be explained by this marker in the population is 30.70%. Compared with the average 100-grain weight of the CC genotype family, the average 100-grain weight of the AA genotype family was significantly higher by 12.80% (P < 0.001). The above results show that the identification of soybean 100-grain weight by the marker Chr19_43194866_A_C is reliable and effective.

[0077] In summary, soybeans with the AA genotype at Chr19_43194866 have high 100-kernel weight, while soybeans with the CC genotype have low 100-kernel weight. The AA genotype has a higher 100-kernel weight than the CC genotype. When selecting soybean varieties with superior 100-kernel weight, soybeans with the AA genotype at the Chr19_43194866 locus are selected for breeding and improvement.

[0078] Example 2. Development and identification of KASP molecular markers

[0079] Molecular markers were developed for the SNP site Chr19_43194866 associated with soybean 100-grain weight discovered in Example 1, and KASP molecular markers were developed based on the base sequence of its complementary chain.

[0080] Based on the fluorescence signal, varieties with high 100-grain weight (genotype AA) and varieties with low 100-grain weight (genotype CC) can be clearly distinguished. The specific design is as follows (the primer sequence was synthesized by Shanghai Sangon Biotechnology Co., Ltd.):

[0081] R4866-FAM: 5'-gaaggtgaccaagttcatgctACAAACCAACACAATATTAA-3' (sequence 2);

[0082] R4866-VIC: 5'-gaaggtcggagtcaacggattACAAACCAACACAATATTAC-3' (sequence 3);

[0083] R4866-R: 5'-CCAATTAAGTTGGCCATCAGGC-3' (SEQ ID NO: 4).

[0084] According to the use of this marker, PCR detection and analysis of the test soybean materials were carried out with the above-extracted DNA as a template. The PCR system is shown in Table 3, wherein KASP Assay Mix was prepared by ourselves (1.2 μL each of R4866-FAM and R4866-VIC, 3 μL of R4866-R, and 4.6 μL of ddH2O). The reaction program was as follows: 94°C for 15 min; 94°C for 20 s, 61-55°C for 30 s, for 10 cycles, with a decrease of 0.6°C each cycle; 94°C for 20 s, 55°C for 1 min, for 26 cycles, and finally 30°C for 1 min.

[0085] Table 3. PCR reaction system of test population

[0086] name Volume (μL) 2×KASP Master Mix 2.5 KASP Assay mix 0.07 DNA template (100 ng / μL) 2.5 Total volume 5.07

[0087] The marker was used to amplify and genotype 55 soybean materials. The marker could well divide the population into three genotypes: AA, CC, and AC. Among them, 26 soybean materials with genotype AA showed yellow fluorescence, 20 soybean materials with genotype CC showed blue fluorescence, and 9 soybean materials with AC heterozygous genotype showed green fluorescence. The parent Jidou 12 (high 100-grain weight) showed yellow fluorescence, and the wild soybean ZYD02738 (low 100-grain weight) showed blue fluorescence, which was consistent with the genotype sequencing results ( Figure 4 ).

[0088] In the early stage, dCAPS markers were designed for the SNP site Chr19_43194866. RsaI, EcoRV, and TaqI restriction sites were used, and the following primers were designed for detection:

[0089] RsaI-F: TCCAGCTTTATTGGTCAAAT;

[0090] RsaI-R: ATCATTCAAGCACAAACCAACACAATAGTA;

[0091] EcoRV-F: GACCAAACAAGATTCTATTTGTATACAGA;

[0092] EcoRV-R:CACGAAAGAAGATCGTGGGT;

[0093] TaqI-F: GGACCAAACAAGATTCTATTTGTATACATC;

[0094] TaqI-R: CTGGCCCTGCATGATTTTAG;

[0095] Test results ( Figure 5 ) showed that some target fragments were not well digested by enzymes, and the genotyping results after enzyme digestion were inconsistent with the sequencing results.

[0096] The present invention designs multiple molecular markers and primer sequences to ultimately obtain the Chr19_43194866 site KASP molecular marker primer combination of the present invention, which has stable testing, accurate typing, and is closely linked to the phenotype.

[0097] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a soybean genome in any of the following: (1) Identify or assist in identifying soybean 100-grain weight traits; (2) Screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight; (3) Screening or breeding soybean plants, lines, strains or varieties with low 100-grain weight; (4) Preparation of products for identifying or assisting in identifying soybean 100-grain weight traits; (5) Preparation of products for screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight; (6) Preparation of products for screening or breeding soybean plants, lines, strains or varieties with low 100-grain weight; The SNP site is a site on soybean chromosome 19, the nucleotide type of which is A or C, and is the 20th nucleotide of sequence 1 in the sequence list; The genotype of the SNP is AA, CC or AC, the AA genotype is the homozygous type of the SNP A, the CC genotype is the homozygous type of the SNP C, and the AC genotype is the heterozygous type of A and C; the identification or auxiliary identification of the soybean 100-grain weight trait based on the SNP genotype is any of the following methods: 1) The soybean to be tested, whose SNP genotype is AA, is or is a candidate soybean with high 100-kernel weight; 2) The soybean to be tested, whose SNP genotype is CC, is or is a candidate soybean with low 100-kernel weight; 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

2. A method for identifying or assisting in identifying the soybean 100-grain weight trait, characterized in that: The method comprises detecting the genotype of a SNP site in the soybean genome to be tested, and identifying or assisting in identifying the soybean 100-grain weight trait according to the genotype, wherein the SNP site is a site on soybean chromosome 19, the nucleotide type of which is A or C, and is the 20th nucleotide of sequence 1 in the sequence list; the genotype of the SNP is AA, CC or AC, the AA genotype is a homozygous type of the SNP being A, the CC genotype is a homozygous type of the SNP being C, and the genotype AC is a heterozygous type of A and C; the identification or assisting in identifying the soybean 100-grain weight trait according to the SNP genotype is any of the following methods: 1) The soybean to be tested, whose SNP genotype is AA, is or is a candidate soybean with high 100-kernel weight; 2) The soybean to be tested, whose SNP genotype is CC, is or is a candidate soybean with low 100-kernel weight; 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

3. Use of the method according to claim 2 in soybean breeding, wherein the purpose of the breeding is to breed soybean varieties with high 100-grain weight.

4. A soybean breeding method, characterized in that: The method is M1 or M2, wherein M1 comprises detecting the genotype of the SNP of claim 1 in the soybean genome, selecting soybeans having the genotype of the SNP as AA as parents for breeding, wherein the AA is a homozygous type of the SNP as A, and the breeding purpose of the method comprises breeding soybeans with a high 100-grain weight trait; M2. The method includes detecting the genotype of the SNP described in claim 1 in the soybean genome, selecting soybeans with the genotype of the SNP being CC as parents for breeding, wherein the CC is the homozygous type of the SNP being C, and the breeding purpose of the method includes breeding soybeans with low 100-grain weight trait.

5. A product containing a substance for detecting the polymorphism or genotype of the SNP site described in claim 1 in the soybean genome, characterized in that: The product is any of the following, C1) Products for detecting single nucleotide polymorphisms or genotypes related to soybean 100-grain weight; C2) Products that identify or assist in identifying the soybean 100-kernel weight trait; C3) Products used for soybean breeding; C4) Screening or breeding of soybean plants, lines, strains or varieties with high 100-kernel weight; C5) Screening or breeding of soybean plants, lines, strains or varieties with low 100-kernel weight; The substance is as follows D1), D2) or D3): D1) containing a primer combination for amplifying a soybean genomic DNA fragment including the SNP site; D2) a PCR reagent containing the primer combination described in D1); D3) a kit containing the primer composition described in D1) or the PCR reagent described in D2); The primer composition consists of primer R4866-FAM, primer R4866-VIC, and primer R4866-R; The primer R4866-FAM is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence list; The primer R4866-VIC is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence list; The primer R4866-R is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence table.

6. Use of a DNA molecule having a nucleotide sequence as shown in Sequence 1 of the sequence listing in any of the following applications: (1) Identify or assist in identifying soybean 100-grain weight traits; (2) Screening or breeding soybean plants, lines, strains, or varieties with high 100-grain weight; (3) Screening or breeding soybean plants, lines, strains, or varieties with low 100-grain weight; (4) Preparation of products for identifying or assisting in identifying soybean 100-grain weight traits; (6) Preparation of products for screening or breeding soybean plants, lines, strains or varieties with high 100-grain weight; (7) Preparing products for screening or breeding soybean plants, lines, strains or varieties with low 100-grain weight and high 100-grain weight; The 20th position of the sequence 1 is a SNP site, the nucleotide type of which is A or C, the genotype of the SNP is AA, CC or AC, the AA genotype is the homozygous type of the SNP being A, the CC genotype is the homozygous type of the SNP being C, and the AC genotype is the heterozygous type of A and C; the identification or auxiliary identification of the soybean 100-grain weight trait based on the SNP genotype is any of the following methods: 1) The soybean to be tested, whose SNP genotype is AA, is or is a candidate soybean with high 100-kernel weight; 2) The soybean to be tested, whose SNP genotype is CC, is or is a candidate soybean with low 100-kernel weight; 3) The 100-grain weight of the soybean to be tested whose genotype of the SNP is AA is higher than that of the soybean to be tested whose genotype of the SNP is CC.

Images