A molecular marker for detecting wheat ear sprouting resistance and application

Abstract

The present application relates to the technical field of biology, and specifically provides a molecular marker for detecting wheat ear bud resistance and application. Genotype data is obtained by using Wheat55K wheat high-throughput gene chip, a QTL site Qphs.caas-3DS related to ear bud resistance is detected from a resistant material, and a KASP marker and a detection primer set thereof are developed to efficiently screen high and low ear bud resistance. The wheat genomic DNA is subjected to PCR amplification by using the primer set of the present application, and whether the ear bud resistance gene is carried can be directly determined by KASP typing, the detection method is simple to operate, the detection result is very intuitive, the detection effect is obvious and effective, and the use of the molecular marker for screening can greatly improve the efficiency of molecular marker assisted selection of wheat breeding with ear bud resistance.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biotechnology, and relates to a molecular marker for detecting pre-harvest sprouting resistance of wheat and application thereof. BACKGROUND

[0002] Pre-harvest sprouting (PHS) of wheat refers to the phenomenon that mature but unharvested grains on the mother plant sprout in a high-humidity environment in the late growth period of wheat, which is a worldwide natural disaster. Wheat-producing countries such as France, the United States, Canada and Australia have all suffered varying degrees of pre-harvest sprouting damage, among which Australia is the most serious, with a pre-harvest sprouting area of up to 20% in 1984. In addition, enzymes in sprouted wheat can also damage starch molecules, making the flour sticky, which is not conducive to food processing and production. Therefore, cultivating and planting pre-harvest sprouting-resistant wheat varieties is the most economical and effective way.

[0003] Pre-harvest sprouting of wheat is a quantitative trait controlled by multiple genes. Currently, 60 PHS-related QTLs have been reported. Many studies have located PHS-related QTLs on 21 chromosomes of wheat through different genetic mapping populations, mainly on the third and fourth homologous chromosome groups. In common wheat, genes related to pre-harvest sprouting resistance have been identified on all chromosomes except 1D. With the support of genome technology and molecular biology, the localization and identification of wheat pre-harvest sprouting resistance genes are being continuously deepened, providing new scientific basis and methods for breeding wheat varieties with higher resistance. Currently, 8 wheat pre-harvest sprouting resistance genes have been identified through map-based cloning or homologous cloning, including TaMFT-3A 、 TaVP-1 、 TaMKK3 、 PM19-A1 、 PM19-A2 、 Tasdr 、 TaDFR and Tamyb10 In the past few decades, we have generally improved the agronomic traits of wheat based on traditional breeding methods, although some progress has been made, but this method is time-consuming and labor-intensive, especially for the improvement of quantitative traits that are easily affected by the environment, and the pre-harvest sprouting resistance of wheat is a complex quantitative trait controlled by multiple genes. Simple phenotype screening is easily affected by environmental conditions, and the selection efficiency is low. Therefore, for such traits, combined with certain molecular marker-assisted selection, new pre-harvest sprouting resistance genes (QTLs) can be mined and molecular markers can be developed, which can greatly improve the selection efficiency of traditional breeding, shorten the breeding process, and have important significance for wheat breeding.

[0004] Genome-wide association studies (GWAS) are genome-wide methods that identify and locate genes by identifying and genotyping target traits and using statistical methods to detect associations between the two. Currently, GWAS has been widely used in quantitative trait genetic studies in crops such as wheat, rice, and maize. The principle is to analyze the association between molecular data and phenotypic traits using a mixed linear model (MLM). Principal component analysis (PCA) and the kinship matrix (K) are used as covariates to calculate the linear regression relationship between genotype and phenotype. With the continuous development of high-throughput SNP marker typing and high-throughput sequencing technologies, the cost of wheat genotyping has gradually decreased. Simultaneously, the gradual improvement of phenotypic identification systems has led to increasingly accurate phenotypic data. GWAS is increasingly being used in genetic studies of various complex wheat traits, such as spikelet initiation, ear sprouting, stripe rust, and yield and quality. By acquiring individual genotypic data and years of phenotypic data, this analytical method can identify a large number of genes / QTLs that control complex traits, making it an important tool in crop genetic improvement research.

[0005] Molecular marker-assisted breeding has accelerated the progress of traditional breeding. Single nucleotide polymorphisms (SNPs) are caused by the replacement, deletion, or addition of a single base pair in the genome, thereby changing the base sequence and causing DNA sequence polymorphism. SNPs are widely distributed in the genome and are highly stable. With the rapid development of molecular biology technology, they have higher use value and greater development space, and people can use them for molecular marker-assisted selection. Therefore, competitive allele-specific PCR (KASP) technology for detecting SNPs has shown good development prospects, mainly because KASP markers have the advantages of high throughput, high stability, and high accuracy. At present, KASP marker technology is very mature and is widely used in wheat genetic breeding. Summary of the Invention

[0006] The purpose of the present invention is to overcome the defects of the prior art and provide a method for detecting QTL for ear sprouting resistance. Qphs.caas-3DS The present invention uses Wheat55K wheat high-throughput gene chip to obtain genotype data and combines phenotypic data from 331 natural populations to detect a stable QTL locus associated with spike sprouting resistance. Qphs.caas-3DS Based on this, a KASP marker and primer set was developed to efficiently screen the level of ear sprouting resistance.

[0007] In one aspect, the present invention provides a stable QTL for wheat spike sprouting resistance. Qphs.caas-3DS The KASP molecular marker has a nucleotide sequence as shown in SEQ ID No.4.

[0008] In another aspect, the present invention provides a primer set for detecting whether the allele variation at position 25 in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C, the primer set comprising two upstream primers and one downstream primer;

[0009] The upstream primers are designed based on the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome and its upstream sequence, and the 3'-terminal deoxyribonucleotide of one of the upstream primers is T, and the 3'-terminal deoxyribonucleotide of the other upstream primer is G;

[0010] The downstream primer is designed based on the downstream sequence of the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome.

[0011] Furthermore, the nucleotide sequence of one upstream primer is shown as SEQ ID No. 1, the nucleotide sequence of another upstream primer is shown as SEQ ID No. 2, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 3.

[0012] Furthermore, the 5' end of one of the upstream primers is connected to a fluorescent tag sequence FAM, and the 5' end of the other upstream primer is connected to a fluorescent tag sequence HEX.

[0013] The substance for detecting the wheat ear sprouting resistance molecular marker also falls within the protection scope of the present invention.

[0014] The substance for detecting the wheat ear sprouting resistance molecular marker can be a kit.

[0015] The DNA molecule shown in SEQ ID No. 4 also falls within the scope of protection of the present invention.

[0016] The present invention also provides any of the following uses of the wheat spike sprout resistance molecular marker or the DNA molecule shown in SEQ ID No. 4:

[0017] X1) Detection or auxiliary detection of wheat ear sprout resistance;

[0018] X2) Compare the strength of ear sprout resistance of different wheat varieties;

[0019] X3) Breeding wheat with strong resistance to ear sprouting;

[0020] X4) Screen or remove wheat with weak resistance to ear sprouting;

[0021] X5) Wheat breeding.

[0022] The present invention also provides any of the following applications of the substance for detecting the wheat spike sprouting resistance molecular marker:

[0023] Y1) Preparation of products for detecting or assisting in detecting wheat spike sprout resistance;

[0024] Y2) Compare the strength of ear sprout resistance of different wheat varieties;

[0025] Y3) Prepare products to compare the strength of ear sprout resistance of different wheat varieties;

[0026] Y4) Breeding wheat with strong resistance to ear sprouting;

[0027] Y5) preparing products for breeding wheat with strong resistance to spike sprouting;

[0028] Y6) Screening or culling wheat with weak ear sprout resistance;

[0029] Y7) preparing products for screening or culling wheat with weak ear sprout resistance;

[0030] Y8) Wheat breeding.

[0031] On the other hand, the present invention also provides any of the following methods:

[0032] Method A: A method for detecting whether the allele variation at position 25 in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C, comprising the following steps (A1) or (A2):

[0033] (A1) Direct sequencing;

[0034] (A2) performing PCR amplification on the wheat genomic DNA to be tested using the primer set or kit, scanning the amplified product for fluorescence signals, analyzing the scan data, and then determining whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat gene to be tested is AA, CC, or A and C according to the following method:

[0035] If the fluorescence signal data of the amplified product of the wheat to be tested is analyzed by Kluster Caller software and is displayed as red, then the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the genome of the wheat to be tested is a homozygous C;

[0036] If the fluorescence signal data of the amplified product of the wheat to be tested is blue after analysis by Kluster Caller software, then the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the wheat genome to be tested is a homozygous A;

[0037] If the fluorescence signal data of the amplified product of the wheat to be tested is green after analysis by Kluster Caller software, then the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the genome of the wheat to be tested is a hybrid of A and C;

[0038] Method B: A method for comparing the sprouting resistance of wheat spikes to be tested, comprising the following steps:

[0039] (B1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0040] (B2) Determine the wheat spike sprout resistance as follows: SEQ ID No. 4 on chromosome 3D in the genome

[0041] The spike sprouting resistance of the wheat to be tested, in which the 25th deoxyribonucleotide in the nucleotide sequence is C, is stronger than the spike sprouting resistance of the wheat to be tested, in which the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the genome is A, or in which the 25th deoxyribonucleotide is A and C, is a homozygote;

[0042] Method C: A method for breeding or screening wheat plants, lines, strains, or varieties with relatively strong ear sprout resistance, comprising the following steps:

[0043] (C1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0044] (C2) selecting a wheat plant to be tested that is homozygous for C at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome as a parent for breeding, and selecting wheat plants that are homozygous for C at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties with relatively strong ear germination;

[0045] Method D: A method for breeding or screening wheat plants, lines, varieties, or varieties with relatively weak ear sprouting resistance, comprising the following steps:

[0046] (D1) detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C;

[0047] (D2) selecting a wheat plant to be tested that is homozygous for A at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome as a parent for breeding, and selecting wheat plants that are homozygous for A at the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D of the genome in each breeding generation, ultimately obtaining wheat plants, lines, varieties, or varieties with relatively weak ear sprouting resistance.

[0048] Furthermore, in the method B, the method C and the method D, the method for detecting whether the 25th deoxyribonucleotide in the nucleotide sequence shown in SEQ ID No. 4 on chromosome 3D in the wheat genome is AA, CC, or A and C is the method A.

[0049] On the other hand, the present invention also provides the use of the primer set or the method in wheat molecular marker-assisted breeding.

[0050] Beneficial effects of the present invention:

[0051] The present invention uses the Wheat55K wheat high-throughput gene chip to obtain genotype data and detects a major effect QTL locus related to ear sprouting resistance from a disease-resistant variety on chromosome 3D. Qphs.caas-3DS , and further developed the KASP marker and the dedicated primer set KASP-3DS-Phs. Experiments have shown that the KASP molecular marker of the present invention can be used for the main effect QTL of wheat spike sprouting resistance. Qphs.caas-3DS The present invention is a QTL site for anti-ear sprouting Qphs.caas-3DS It provides a good tool for effective use in breeding. This marker can quickly screen wheat ear sprouting resistance, provide convenience for screening wheat materials carrying excellent allelic variations, and improve breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] 图1 Manhattan plot of association analysis for 331 wheat varieties based on 55K microarray.

[0053] 图2 This is the quantile plot (QQ plot) of 331 wheat varieties based on 55K chip association analysis.

[0054] 图3 The results of the KASP marker amplification test for the spike sprouting resistance genotypes of 331 varieties and 63 wheat lines in Example 1 and Example 2 were obtained. DETAILED DESCRIPTION

[0055] Unless otherwise noted, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in literature in the field or in accordance with product specifications. Materials, reagents, and instruments used in the following examples are commercially available unless otherwise noted. In the following examples, unless otherwise noted, the first position of each nucleotide sequence in the sequence listing refers to the 5′-terminal nucleotide of the corresponding DNA / RNA, and the last position refers to the 3′-terminal nucleotide of the corresponding DNA / RNA.

[0056] Example 1 Screening for stable SNP sites significantly associated with ear sprouting resistance

[0057] 1. Acquisition of phenotypic data

[0058] This example uses 331 main wheat varieties cultivated from 1964 to 2020 as materials, including 20 varieties from the northern wheat region, 263 varieties from the Huanghuai winter wheat region, 29 varieties from the middle and lower reaches of the Yangtze River winter wheat region, 17 varieties from the southwestern winter wheat region, and 2 varieties introduced from abroad. Natural populations were planted at the Xinxiang Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences in the three wheat growing seasons of 2018-2019, 2019-2020, and 2020-2021. Each material was planted in 2 rows, with a row length of 2 m and a row width of 0.2 m. Before sowing, compound fertilizer equivalent to 200 kg hm of pure N was applied. -2 , P2O5 191 kg hm -2 and K2O 41 kg hm -2 . Other field managements were carried out in accordance with local field production management. All materials were sampled during the physiological maturity of wheat (about 35 days after flowering), and then naturally air-dried and threshed. The threshed seeds were stored in a -20°C freezer for later use. Place two sterile filter papers or germination papers in a sterile culture dish and add an appropriate amount of distilled water. Rinse the seeds disinfected with 5% sodium hypochlorite solution with distilled water 3 to 5 times, then count 50 seeds and place them neatly on the filter paper with the ventral groove facing down, and place them in an incubator or indoors at 25°C for incubation, keeping the filter paper moist during the period. Count the germinated grains every day and pick out the germinated seeds. The germination index is calculated using the following formula:

[0059] Germination index = [(7 × n1 + 6 × n2 + 5 × n3 + 4 × n4 + 3 × n5 + 2 × n6 + 1 × n7) / (7 × N)] × 100%, where n1, n2, ..., n7 are the number of seeds germinated daily from day 1 to day 7, and N is the total number of seeds used for germination. The experiment was repeated three times.

[0060] 2. Genome-wide association analysis

[0061] Genomic DNA was extracted using the PVP-40 method, and wheat 55K SNP array genotyping was performed by Beijing Zhongyu Gold Marker Biotechnology Co., Ltd. The array contains 53,063 single nucleotide polymorphisms (SNPs). Genotyping was performed using Affymetri Axiom software. SNP physical positions were referenced to the Chinese Spring reference genome IWGSCRefSeq v1.0 data. SNP markers with more than 20% missing data and a minor allele frequency less than 5% were excluded from subsequent analyses. GWAS analysis was performed using Tassel software with principal component analysis (PCA) and the kinship matrix (K) as covariates using an MLM model. Markers with a -log10 (p) > 3 were considered significant markers with a significant association with the phenotype.

[0062] The experiment obtained a relatively stable locus related to ear sprouting resistance Qphs.caas-3DS , which can explain 3.77-4.61% of the phenotypic variation.

[0063] Table 1 Stable anti-ear sprouting sites

[0064]

[0065] 3. Design and Utilization of KASP Primers

[0066] 1. Design of KASP primers

[0067] like 图1 and 图2 As shown, this application locates a significant SNP site associated with ear sprouting resistance through association analysis (GWAS) Qphs.caas-3DS , located at 5.41 Mb in the wheat reference genome (chromosome 3D) Chinese Spring RefSeq v1.0 (reference genome website: https: / / urgi.versailles.inra.fr / blast_iwgsc / ). KASP marker primer sequences were designed based on the antisense strand of the SNP site. KASP primers were designed using Polymarker (http: / / polymarker.tgac.ac.uk / ) and synthesized by Sangon Biotech Co., Ltd. The resulting KASP marker, KASP-3DS-Phs, was successfully constructed. The corresponding variant site is A / C, which is position 25 in the nucleotide sequence shown in SEQ ID No. 4. SEQ ID No. 4 sequence: GTCTGTTCATTTCTAACCATGCAT[Y]GACCGTGTATTTTCATGTGCACCAACATACCTGGTAAGTCTTTCTCCAGAATTTTCCATTCCTTTTGCACCGTTTTGGCCCAACTCTTCCCTCGACTAGCGCCTTGCATTTCCTTGAAAAAGAGAGGATTGATTGAAGTTCTACATTTAG (Y represents A / C).

[0068] In this example, a KASP-3DS-Phs primer set was designed for this SNP. The primer set includes an upstream primer with the nucleotide sequence F1: 5'-GAAGGTGACCAAGTTCATGCTGTCTGTTCATTTCTAACCATGCATT-3' (SEQ ID No. 1); another upstream primer with the nucleotide sequence F2: 5'-GAAGGTCGGAGTCAACGGATTGTCTGTTCATTTCTAACCATGCATG-3' (SEQ ID No. 2); and a shared downstream primer with the nucleotide sequence R: 5'-TCCTCTCTTTTTCAAGGAAATGCAA-3' (SEQ ID No. 3). The 5' end of the upstream primer SEQ ID No. 1 is linked to the fluorescent tag sequence FAM, while the 5' end of the other upstream primer SEQ ID No. 2 is linked to the fluorescent tag sequence HEX. The 3' end of the upstream primer contains the allelic variant T / G at this site. The downstream primer ensures 3D chromosome specificity for PCR amplification.

[0069] 2. Establishment of KASP detection method

[0070] The principle of KASP: two forward competitive primers (the 5' end of the primer has a base sequence that is complementary to the fluorescent groups HEX and FAM, and the other sequences differ only at the SNP at the 3' end) and a reverse common primer; the PCR reaction system contains a universal sequence modified with a fluorescent group and a quenching group (Master Mix provided by LGC). The two forward primers can emit two different colors of light. If the site is homozygous, a single fluorescence is emitted, and if it is heterozygous, two fluorescences can be emitted simultaneously. KASP amplification is performed on a Bio-RAD C1000 Thermal Cycler PCR instrument (Bio-Rad, Hercules, USA). The reaction system is 5 μL, including 2 μL DNA template (50-100 ngμL –1 ), 2.5 μL 2 × KASP Master Mix, PrimerMix 0.056 μL and Mg 2 + The KASP amplification protocol consisted of 15 min of initial denaturation at 94°C, 10 cycles of denaturation at 94°C for 20 s, annealing at 65-57°C (touch-down) for 1 min, and 30 cycles of extension at 94°C for 20 s and post-extension at 57°C for 1 min. After the reaction, the final fluorescence data were read using a Fluostar Omega fluorescence scanner (BMG Labtech, Durham, NC, USA) and then imported into Klustercaller v3.4 (LGC, Hoddesdon, UK) for genotyping.

[0071] For KASP-3DS-Phs markers: If the fluorescence signal data of the amplified product is close to the Y-axis (FAM fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is CC homozygous; if the fluorescence signal data of the amplified product is close to the X-axis (HEX fluorescence signal) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is AA homozygous; if the fluorescence signal data of the amplified product is located between the X-axis and Y-axis (with both FAM and HEX signals) after analysis by the genotyping software KlusterCaller, it means that the genotype of the site (sense chain) is AC heterozygous.

[0072] 3. KASP detection:

[0073] The experimental material is a genetic population constructed by crossing the wheat variety Lunxuan 13, which is susceptible to ear sprouting, with the wheat variety Lunxuan 061, which is resistant to ear sprouting, through single-seed descent. This genetic population includes 199 F5RIL families. See Table 2 for details.

[0074] 199 RIL families were planted in the 2021-2022 growing season at the Xinxiang Experimental Station of the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. Each material was planted in two rows, with a row length of 2 m and a row width of 0.2 m. Before sowing, compound fertilizer equivalent to pure N of 200 kghm was applied. -2 , P2O5 191 kg hm -2 and K2O 41 kg hm -2 (Zhang et al. 2020). Other field management procedures were carried out in accordance with local field production management.

[0075] Samples were taken at the physiological maturity stage of wheat (about 35 days after flowering) for spike germination phenotype evaluation to obtain phenotypic data. Genomic DNA of all experimental materials was then extracted and used as a template for detection using the KASP primers designed in step 2. For specific operations, see step 2. The results are shown in Tables 2 and 图3 Among the 199 RIL families, 92 were CC homozygous, 93 were AA homozygous, and 14 were AC heterozygous. The average spike germination index of CC homozygous wheat materials was 4.93% lower than that of AA homozygous wheat materials. The spike germination index of the two homozygous genotypes was significantly different at the 0.001 level (Table 3), indicating that the KASP-3DS-Phs marker of the present invention is associated with wheat spike germination resistance.

[0076] Table 2 Qphs.caas-3DS 229 RIL families

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086] Table 3, Carry Qphs.caas-3DS T test results of spike germination index of two homozygous genotypes at the locus

[0087]

[0088] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. Application of a substance for detecting molecular markers of wheat ear sprouting resistance in detecting or assisting in detecting wheat ear sprouting resistance; The wheat spike sprouting resistance molecular marker is the nucleotide at position 25 on the wheat 3D chromosome corresponding to SEQ ID No. 4 in the sequence list, which is A or C.

2. The use according to claim 1, characterized in that: The substance for detecting the molecular marker of wheat ear sprouting resistance includes: a primer set capable of amplifying the DNA fragment shown at position 25 of SEQ ID No. 4 in the sequence table.

3. The use according to claim 2, characterized in that: The primer set consists of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 is a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of SEQ ID No.1, the upstream primer F2 is a single-stranded DNA whose nucleotide sequence is the 22nd to 46th positions of SEQ ID No.2, and the downstream primer R is a single-stranded DNA whose nucleotide sequence is SEQ ID No.

3.

4. The use according to claim 2, characterized in that: The primer set consists of three single-stranded DNAs named upstream primer F1, upstream primer F2 and downstream primer R, wherein the upstream primer F1 is a single-stranded DNA whose nucleotide sequence is positions 1-46 of SEQ ID No.1, the upstream primer F2 is a single-stranded DNA whose nucleotide sequence is positions 1-46 of SEQ ID No.2, and the downstream primer R is a single-stranded DNA whose nucleotide sequence is SEQ ID No.

3.

5. A method for detecting wheat spike sprouting resistance, comprising: The nucleotide corresponding to the 25th position of SEQ ID No. 4 in the sequence list is detected in the genomic DNA of the wheat to be tested. The spike sprouting resistance of the homozygous wheat to be tested in which the nucleotide corresponding to the 25th position of SEQ ID No. 4 in the sequence list in the genomic DNA is C is higher or can be higher than that of the homozygous wheat to be tested in which the nucleotide corresponding to the 25th position of SEQ ID No. 4 in the sequence list in the genomic DNA is A.

6. The method according to claim 5, characterized in that: The nucleotide corresponding to position 25 of SEQ ID No. 4 in the sequence list in the genomic DNA of the wheat to be tested is detected using the substance for detecting the wheat spike sprouting resistance molecular marker according to any one of claims 1 to 4.

7. Any of the following uses of the substance for detecting the wheat spike sprouting resistance molecular marker according to any one of claims 1 to 4: Y1) Preparation of products for detecting or assisting in detecting wheat spike sprout resistance; Y2) Compare the strength of ear sprout resistance of different wheat varieties; Y3) Prepare products to compare the strength of ear sprout resistance of different wheat varieties; Y4) Breeding wheat with strong resistance to ear sprouting; Y5) preparing products for breeding wheat with strong resistance to ear sprouting; Y6) Screening or culling wheat with weak ear sprout resistance; Y7) preparing products for screening or culling wheat with weak ear sprout resistance; Y8) Breeding for wheat spike sprout resistance.

8. A method for breeding wheat spike sprout resistance, comprising: The method comprises detecting the nucleotide at position 25 corresponding to SEQ ID No. 4 in the sequence list in the wheat genomic DNA, selecting homozygous or heterozygous wheat whose nucleotide at position 25 corresponding to SEQ ID No. 4 in the sequence list is C as a parent for breeding, and screening the homozygous wheat whose nucleotide at position 25 corresponding to SEQ ID No. 4 in the sequence list is C in the genomic DNA of the wheat to obtain wheat with ear sprouting resistance.

Images