Bacillus thuringiensis fur gene knockout strain as well as construction method and application thereof

Abstract

The invention relates to the technical field of bacterial genetic engineering, in particular to a bacillus thuringiensis fur gene knockout strain and a construction method and application thereof, and the bacillus thuringiensis fur gene knockout strain is obtained by knocking out an iron uptake regulatory protein fur gene from a bacillus thuringiensis genome. The construction method of the bacillus thuringiensis fur gene knockout strain comprises the following steps: constructing a gene knockout donor strain, performing single exchange for the first time, eliminating plasmids, detecting positive transformants, performing single exchange for the second time, performing positive clone screening, and eliminating plasmids to obtain the knockout fur strain. Meanwhile, the invention also relates to application of the bacillus thuringiensis fur gene knockout strain in production of siderophores and melanin. The technical scheme provided by the invention provides a bacillus thuringiensis fur gene knockout strain as well as a construction method and application thereof, and provides a novel method for producing melanin and siderophore.

Description

Technical Field

[0001] The invention relates to the technical field of bacterial genetic engineering, and in particular to a Bacillus thuringiensis fur gene knockout strain and a construction method thereof, and application thereof in producing melanin and siderophore. Background Art

[0002] Bacillus thuringiensis, or Bt for short, was first discovered by Ishiwata in 1902, who reported the microorganism that infects silkworms and causes damage to the Japanese silk industry. As a microbial insecticide, Bt has been widely used in agricultural and forestry pest control because of its strong insecticidal effect, non-toxicity to human health, no byproducts that pollute the environment, and no killing of beneficial organisms.

[0003] Melanin is a brown-black pigment. Some bacteria, fungi, animals and plants in nature have the ability to form melanin. It is a class of complex biological macromolecules composed of a variety of phenolic and indole monomers. Its composition is complex and diverse, and may contain protein molecules or doped carbohydrate molecules, which have not yet been fully studied. Melanin has the ability to absorb most visible light and plays a photoprotective role in cells. The production of melanin can effectively absorb ultraviolet rays and ionizing radiation, thereby effectively protecting cells from these harmful external stresses, thereby improving the cell's radiation resistance. In addition, melanin can also chelate metal ions, anti-oxidation, electron transfer, energy conversion, anti-virus, etc. Therefore, melanin plays a very important role in bacterial metabolism and physiological functions.

[0004] According to the chemical structure of the siderophore and the iron chelating group, the siderophore can be divided into three categories: hydroxamate, catecholate and carboxylate. Hydroxamate is the most common in nature. Most hydroxamate groups are composed of C(=O)N-(OH)R, where R is an amino acid or its derivative, such as Desferrioxamine (DFO). The two oxygen atoms of each hydroxamate group bind to Fe 3+ form a bidentate ligand, so each siderophore can bind to Fe 3+ Forming a hexadentate octahedral complex. Catechol iron carriers are commonly found in intestinal bacteria and are composed of catechol and hydroxyl groups. 3+It can bind to adjacent catechol or hydroxyl groups and chelate with iron through two oxygen atoms to form a hexadentate octahedral complex. There is significant diversity in the chemical structure of the iron carriers produced by bacteria. Iron carriers can chelate a variety of metals, including biometals and toxic and radioactive metals, although they have low affinity for some metals. This makes it of interest in agriculture, bioremediation, medicine and other fields. In agriculture, iron carriers can be used as fertilizers, pesticides and pathogen control agents; in bioremediation, they help purify the environment; in medicine, they have therapeutic, drug delivery, imaging and anti-cancer potential. Therefore, the iron carriers produced by bacteria have broad prospects and high research value.

[0005] Based on this, the present invention proposes for the first time a method for constructing Bacillus thuringiensis with fur gene knocked out and the application of the modified strain in producing melanin and siderophore. Summary of the invention

[0006] The invention aims to provide a Bacillus thuringiensis fur gene knockout strain, and also provides a construction method thereof and application thereof in producing melanin and iron carrier.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] The invention discloses a Bacillus thuringiensis fur gene knockout strain, wherein the Bacillus thuringiensis fur gene knockout strain is obtained by knocking out the iron uptake regulating protein fur gene from the genome of Bacillus thuringiensis 97-27.

[0009] Also provided is a method for constructing a Bacillus thuringiensis fur gene knockout strain, comprising the following steps:

[0010] A. Construction of gene knockout donor strain;

[0011] a1. Using the Bt 97-27 genome as a template, amplify the upstream homology arm and downstream homology arm of the fur gene;

[0012] a2. Amplify the UD sequence of the fur gene by overlap extension PCR, and use restriction endonucleases to digest the upstream homology arms, downstream homology arms and vector pRP1028, respectively, and then connect them by ligase to obtain a ligation product;

[0013] a3. The ligation product was transformed into competent E. coli, and the transformants were picked and cultured in a liquid medium containing spectinomycin resistance to obtain a successfully constructed knockout donor strain;

[0014] B. The first single exchange;

[0015] The donor strain pRP1028-furUD / DH5α, the helper strain pSS1827 / DH5α and the recipient strain Bt 97-27 are cultured in culture media respectively, wherein the donor strain pRP1028-furUD / DH5α is inoculated in a liquid culture medium containing spectinomycin, and the helper strain pSS1827 / DH5α is inoculated in a liquid culture medium containing ampicillin;

[0016] After culturing to the same OD value, resuspend the bacteria, mix them in equal proportions and add them to antibiotic-free plates for culturing. After culturing for a period of time, transfer the bacterial lawn to antibiotic-free liquid culture medium, mix them evenly and apply them to plates containing spectinomycin and polymyxin resistance for culturing. After culturing, pick the red colonies grown on the plates and transfer them to liquid culture medium containing spectinomycin and polymyxin resistance for culturing to obtain bacterial liquid.

[0017] C. Eliminate plasmids;

[0018] The bacterial solution obtained by culturing in step B is transferred to a liquid culture medium containing spectinomycin and polymyxin resistance, and the culture is transferred once every 6-8 hours, and the culture is transferred three times to obtain a bacterial solution in which the plasmid is eliminated;

[0019] D. Positive transformant detection;

[0020] The plasmid-eliminated bacterial solution is isolated from a single colony on a plate containing spectinomycin and polymyxin resistance, and after cultivation, a single colony is selected and cultured in a liquid medium containing spectinomycin and polymyxin resistance, and screened and tested to preserve the Bt 97-27 strain that succeeded in the first single exchange;

[0021] E. Second single exchange;

[0022] The donor bacteria pSS4332 / DH5α, the Bt 97-27 strain that succeeded in the first single exchange, and the auxiliary strain pSS1827 / DH5α are cultured respectively, wherein the donor bacteria pSS4332 / DH5α and the auxiliary strain pSS1827 / DH5α are inoculated in a liquid culture medium containing kanamycin for culture, and the Bt 97-27 strain that succeeded in the first single exchange is inoculated in a culture medium containing spectinomycin and polymyxin for culture; after the three strains are cultured, they are washed with antibiotic-free LB, and then mixed in equal proportions and added to antibiotic-free plates for culture, after culture for a period of time, the bacterial lawn is transferred to an antibiotic-free liquid culture medium, mixed and spread on a plate containing kanamycin and polymyxin resistance for culture, after culture, the transformants are picked and inoculated into a culture bottle, and after culture overnight, they are streaked and separated on a solid plate containing kanamycin and polymyxin resistance;

[0023] F. Positive clone screening;

[0024] Single colonies separated by streaking were inoculated on solid plates containing kanamycin and polymyxin resistance and solid plates containing spectinomycin and polymyxin for culture respectively, and colonies with kanamycin resistance but no spectinomycin resistance were selected and cultured in liquid medium containing kanamycin and polymyxin, and then genomic DNA was extracted for PCR verification;

[0025] G. Plasmid elimination;

[0026] The verified positive clones were transferred to the antibiotic-free culture medium in proportion for cultivation. The transfer was repeated for more than 10 times, and the clones were separated by streaking on the antibiotic-free plates. Single colonies were picked and inoculated on the antibiotic-free culture medium and the plates containing kanamycin resistance for cultivation. The colonies without kanamycin resistance were the colonies in which the plasmid was successfully eliminated, i.e., the fur knockout strains.

[0027] A further scheme is that in step a1, the upstream homology arm of the fur gene is amplified using the upstream forward primer furUF of the fur gene and the upstream reverse primer furUR of the fur gene; wherein the nucleotide sequence of furUF is shown in SEQ ID NO.1, and the nucleotide sequence of furUR is shown in SEQ ID NO.2;

[0028] In step a2, the downstream forward primer furDF and the downstream reverse primer furDR of the fur gene are used to amplify the downstream homology arm of the fur gene; the nucleotide sequence of furDF is shown in SEQ ID NO.3, and the nucleotide sequence of furDR is shown in SEQ ID NO.4.

[0029] In a further embodiment, the liquid culture medium containing spectinomycin resistance in step a3 is an LB liquid culture medium containing spectinomycin resistance, and the final concentration of spectinomycin is 300 μg / mL.

[0030] A further solution is that step B specifically comprises:

[0031] The final concentration of spectinomycin in the medium of the donor strain pRP1028-fur UD / DH5α was 300 μg / mL; the final concentration of ampicillin in the medium of the helper strain pSS1827 / DH5α was 100 μg / mL;

[0032] The donor strain pRP1028-fur UD / DH5α, the helper strain pSS1827 / DH5α, and the recipient strain Bt 97-27 were cultured to the same OD 600=0.8, resuspend with antibiotic-free LB, mix in equal proportions and add to antibiotic-free LB plates for culture, then transfer all the bacterial moss to antibiotic-free liquid LB, mix well and evenly spread on LB plates containing final concentration of 300μg / mL spectinomycin and 60units of polymyxin for culture, pick out red colonies and transfer to liquid LB medium containing final concentration of 300μg / mL spectinomycin and 60units of polymyxin, and culture at 200rpm and 28℃ to obtain bacterial solution.

[0033] A further solution is that step C specifically comprises:

[0034] The bacterial solution obtained in step B was transferred at a ratio of 1:100 to a liquid LB medium containing 300 μg / mL spectinomycin and 60 units of polymyxin and cultured at 37°C. The culture was transferred once every 6-8 hours. The plasmid-eliminated bacterial solution was obtained after three transfers.

[0035] Step D is specifically as follows:

[0036] The plasmid-eliminated bacterial solution was streaked on an LB plate containing a final concentration of 300 μg / mL spectinomycin and 60 units of polymyxin to isolate a single colony. After overnight culture, a single colony was picked up and cultured in a liquid LB medium containing a final concentration of 300 μg / mL spectinomycin and 60 units of polymyxin. The genome was extracted and PCR was performed to detect whether the first single exchange was successfully integrated into the genome, and the Bt 97-27 strain with a successful first single exchange was preserved.

[0037] A further solution is that step E specifically comprises:

[0038] The donor bacteria pSS4332 / DH5α and the helper strain pSS1827 / DH5α were inoculated in a culture medium containing a final concentration of 50 μg / mL kanamycin for culture, and the recipient bacteria was the Bt 97-27 strain that succeeded in the first single exchange; after culturing the three strains, they were washed with antibiotic-free LB, then mixed in a ratio of 1:1:1 and added to antibiotic-free LB plates for culture, and then the bacterial lawn was transferred to antibiotic-free liquid LB and mixed and evenly spread on a plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin resistance. After culturing for 3 days, 8-10 transformants were picked out and inoculated into a PA bottle, and cultured overnight at 200 rpm and 28°C, and then streaked and separated on a solid LB plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin resistance.

[0039] A further solution is that step F specifically comprises:

[0040] The corresponding single colonies isolated by streaking were inoculated on LB solid plates containing kanamycin and polymyxin 60 units at a final concentration of 50 μg / mL and spectinomycin and polymyxin 60 units at a final concentration of 300 μg / mL, respectively, and cultured at 28°C. The colonies with kanamycin resistance but not spectinomycin resistance were picked and cultured in liquid LB medium containing kanamycin and polymyxin 60 units at a final concentration of 50 μg / mL at 200 rpm and 28°C. The genomic DNA was extracted and verified by PCR.

[0041] Step G is specifically as follows:

[0042] The positive clones verified by PCR were transferred to the antibiotic-free LB medium at a ratio of 1:100 for cultivation, and the transfer was continued for more than 10 times. The clones were streaked on the antibiotic-free LB plate, and single colonies were picked and inoculated on the antibiotic-free LB plate and the LB plate with a final concentration of 50 μg / mL kanamycin resistance. The colonies without the final concentration of 50 μg / mL kanamycin resistance were the colonies in which the plasmid was successfully eliminated, that is, the Bacillus thuringiensis fur gene knockout strain was obtained.

[0043] In addition, the present invention also provides the use of the Bacillus thuringiensis fur gene knockout strain in producing siderophore.

[0044] Also provided is the use of the Bacillus thuringiensis fur gene knockout strain in producing melanin.

[0045] The above technical scheme provides a method for producing a Bacillus thuringiensis fur gene knockout strain that produces melanin and siderophore; at the same time, a method for using the method to obtain a knockout strain of Bacillus thuringiensis by knocking out the iron uptake regulatory protein (fur) gene, so that the knockout strain can produce melanin and siderophore.

[0046] The Bacillus thuringiensis fur gene knockout strain provided in the above technical solution can produce catechol iron carriers, and the maximum iron carrier concentration within 48 hours is 0.50mM; for melanin, the OD of the Bacillus thuringiensis fur gene knockout strain is 400 It started to increase from 24h and reached 3.10 at 168h. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 Schematic diagram of the gene knockout method mediated by I-SceI enzyme in Bacillus thuringiensis;

[0048] Figure 2 The siderophore production of Bt 97-27 and Δfur strains on CAS plates;

[0049] Figure 3 This is the result of siderophore type identification;

[0050] Figure 4 is the standard curve of 2,3-dihydroxybenzoic acid;

[0051] Figure 5 is the Δfur siderophore production curve;

[0052] Figure 6 The color of the bacterial solution changes over time;

[0053] Figure 7 is the infrared absorption spectrum of Δfur melanin and standard melanin;

[0054] Figure 8 is the melanin standard curve;

[0055] Fig. 9 is the melanin production curve of the Δfur strain;

[0056] Fig.10 The ROS results of Bt 97-27 and Δfur strains at 1, 3, and 7 are shown;

[0057] Fig.11 These are the results of scanning electron microscopy of Bt 97-27 and Δfur strains. DETAILED DESCRIPTION

[0058] In order to make the purpose and advantages of the present invention more clearly understood, the present invention is specifically described below in conjunction with embodiments. It should be understood that the following text is only used to describe one or several specific embodiments of the present invention, and does not strictly limit the scope of protection of the specific claims of the present invention.

[0059] Example 1

[0060] Obtaining Bacillus thuringiensis 97-27 Δfur

[0061] (1) Construction of gene knockout donor strain: Using the Bt 97-27 genome as a template, the upstream forward primer furUF (GGGGTACCCAAGACCGTGTAATGTCTCA) and the upstream reverse primer fur UR (GGAAAAGGTCGGTACTACTCCCTCCTCGCCAC) of the fur gene were used to amplify the upstream homology arm of the fur gene; the downstream forward primer furDF (AGTACCGACCTTTTCCTATTTAACTAGGAAGA) and the downstream reverse primer furDR (CGGGATCCCTCGTCATTTTTGGTGTCTG) of the fur gene were used to amplify the downstream homology arm of the fur gene.

[0062] Then, the UD sequence of the gene was amplified by overlapping extension PCR using furUF and furDR primers and the upstream and downstream sequences of the gene, and the upstream homologous arm was cut with restriction endonucleases Kpn I and BamH I, and the downstream homologous arm was cut with restriction endonucleases Kpn I and BamH I, and then the vector pRP1028 was cut with restriction endonucleases KpnI and BamH I at both ends, and then the upstream and downstream homologous arms and the vector fragment were connected with T4 ligase. The obtained ligation product was transformed into Escherichia coli competent state, and the transformant was picked and inoculated in LB liquid medium (containing a final concentration of 300 μg / mL) with spectinomycin (Spc) resistance for 12 hours, and the plasmid was extracted for sequencing, and the sequencing results were correct, and finally the knockout vector strain successfully constructed was obtained.

[0063] (2) First single exchange: The donor strain pRP1028-furUD / DH5α (containing a final concentration of 300 μg / mL Spc), the helper strain pSS1827 / DH5α (containing a final concentration of 100 μg / mL Amp), and the recipient strain Bt 97-27 were cultured to the same OD 600 =0.8, resuspend with fresh antibiotic-free LB, mix in a ratio of 1:1:1, and add directly to the antibiotic-free LB plate. After culturing for 24 hours, scrape all the bacterial moss with a gun tip and transfer to antibiotic-free liquid LB, mix well, and evenly apply to the LB plate containing a final concentration of 300μg / mL spectinomycin and 60units of polymyxin (Spc+Pmx). After culturing for 4-6 days, pick the red colonies grown on the plate and transfer them to liquid LB containing a final concentration of 300μg / mL spectinomycin and 60units of polymyxin (Spc+Pmx) (pick 6-8 colonies from each PA bottle) at 200rpm and 28℃.

[0064] (3) Eliminate the plasmid: Transfer the bacterial solution obtained from the previous step at 28°C at a ratio of 1:100 into liquid LB medium containing 300 μg / mL spectinomycin and 60 units of polymyxin (Spc+Pmx) and culture at 37°C. Transfer once every 6-8 hours, and transfer three times. (The pRP1028 plasmid is a temperature-sensitive plasmid in Bt 97-27 and is easily lost at 37°C. Once the plasmid is lost, the starting strain Bt 97-27 cannot grow in the Spc+Pmx-resistant medium.)

[0065] (4) Detection of positive transformants: The plasmid-eliminated bacterial solution was streaked on an LB plate containing 300 μg / mL spectinomycin and 60 units of polymyxin (Spc+Pmx) at a final concentration to isolate a single colony. After overnight culture, a single colony was picked and cultured in a liquid LB medium containing 300 μg / mL spectinomycin and 60 units of polymyxin (Spc+Pmx) at a final concentration for 12 h. The genome was extracted and PCR was performed to detect whether the first single exchange was successfully integrated into the genome. The Bt 97-27 (containing 300 μg / mL spectinomycin and 60 units of polymyxin Spc+Pmx) strain that successfully underwent the first single exchange was preserved.

[0066] (5) Second single exchange: The donor bacteria pSS4332 / DH5α (the donor bacteria pSS4332 / DH5α was obtained by the publicly available operation method of Zheng Cao. Functional analysis of the sporulation-specific diadenylate cyclase CdaS in Bacillus thuringiensis. Frontiers in Microbiology, see pages 2-3 for details) was inoculated in a medium containing kanamycin (Kan) at a final concentration of 50 μg / mL. The recipient bacteria Bt 97-27 (containing spectinomycin at a final concentration of 300 μg / mL and polymyxin 60 units) that had successfully exchanged with the first single exchange Spc+Pmx), auxiliary strain pSS1827 / DH5α(Kan), the three strains were cultured and washed with antibiotic-free LB, then mixed in a ratio of 1:1:1 and directly added to the antibiotic-free LB plate, 24 hours later, the bacterial lawn was scraped and transferred to antibiotic-free liquid LB, mixed and evenly coated on a plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin (Kan+Pmx) resistance, and 8-10 transformants were picked out and inoculated into a PA bottle after culturing for 3 days, 200 rpm, 28°C overnight, and then streaked and separated on a solid LB plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin (Kan+Pmx) resistance.

[0067] (6) Screening of positive clones: The corresponding single colonies isolated by streaking were inoculated onto solid LB plates containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin (Kan+Pmx) and a final concentration of 300 μg / mL spectinomycin and 60 units of polymyxin (Spc+Pmx) and cultured at 28°C. Colonies with Kan resistance but no Spc resistance were picked and cultured in liquid LB medium containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin (Kan+Pmx) at 200 rpm at 28°C. The genome was extracted and verified by PCR.

[0068] (7) Plasmid elimination: Transfer the verified positive clones to the antibiotic-free LB medium at a ratio of 1:100 and culture for 8 hours. Repeat the transfer for more than 10 times and separate them by streaking on the antibiotic-free LB plate. Pick single colonies and inoculate them on the antibiotic-free LB plate and the LB plate with a final concentration of 50 μg / mL kanamycin (Kan) resistance. The colonies without the final concentration of 50 μg / mL kanamycin (Kan) resistance are the colonies in which the plasmid has been successfully eliminated (remember to preserve the bacteria before plasmid elimination, because the number of transfers is large, to prevent contamination during the transfer process). The fur knockout strain (Δfur) is obtained. The entire gene knockout process is as follows. Figure 1 shown.

[0069] Example 2

[0070] Siderophore solid plate and siderophore type qualitative experiment

[0071] The chrome azure S agar plate method is usually used to qualitatively detect whether bacteria can produce iron carriers. Bt 97-27 and Δfur strains were transferred and activated overnight. Prepare CAS-LB double-layer plates and sterilize at 115℃ for 20min. Pour CAS plates on the lower layer and LB plates on the upper layer. Place the sterilized 6mm filter paper on the poured plate, and inoculate 10μL of bacterial solution from each strain on the filter paper. Each filter paper corresponds to one Bt strain. Incubate the plate upright in a 28℃ incubator for 2-5 days, and observe the color change of the lower CAS plate. If an orange circle appears around the filter paper, it indicates that iron carriers are produced.

[0072] The results of the chrome azuro S agar plate method showed that only the Δfur knockout strain could form an orange halo on the bottom CAS plate. Figure 2 As shown, it indicates that the Δfur knockout strain can form siderophore.

[0073] The type of iron carrier can be determined by the color development after reaction with different chemical reagents. Generally, the type of iron carrier is determined by the following three experiments:

[0074] 1) FeCl3 experiment: Take 1 mL of cell-free supernatant and mix it with 200 μL of 100 mM FeCl3. If the solution turns orange, it indicates the presence of trihydroxyhydroxamic acid siderophores. If the color turns pink, it indicates the presence of dihydroxyhydroxamic acid siderophores. If there is no color change, it indicates other types of siderophores.

[0075] 2) Ferric perchlorate test: Add 2.5 mL of ferric perchlorate solution to 0.5 mL of cell-free supernatant, shake vigorously to mix, let stand at room temperature, and observe the color change. If the solution changes to red or orange, it indicates the presence of hydroxamic acid-type iron carriers. If there is no color change, it may be other types of iron carriers.

[0076] 3) Arnow test: Add 1 mL of 0.5 M HCl and 1 mL of molybdate solution to 1 mL of cell-free supernatant. If there is a catechol structure in the supernatant, the color will turn yellow. After standing at room temperature for 2-3 minutes, add 1 mL of 1 M NaOH solution and observe the color change. If the color turns red and does not fade for a long time, it proves that it is a catechol-type iron carrier.

[0077] The steps for identifying the type of iron carrier are as follows: after culturing Bt 97-27 and Δfur strains in LB medium for 8 hours, the bacterial supernatant was taken for FeCl3, ferric perchlorate and Arnow experiments respectively. Except for the Δfur knockout strain, the color of the supernatant of the other four Bt strains did not change after the reagent was added in the Arnow experiment, indicating that catechol iron carriers could not be produced. In the other two experiments, the color of the supernatant of Bt 97-27 and Δfur strains changed compared with the negative control, but it was impossible to determine whether hydroxamic acid-type iron carriers or isohydroxamic acid-type iron carriers were produced. Only the Δfur knockout strain had a cell-free supernatant that turned red and did not change color for a long time in the Arnow experiment. Figure 3 As shown, it is consistent with the characteristics of catechol siderophore, indicating that the Δfur knockout strain can indeed produce siderophore, and its type of siderophore is catechol siderophore.

[0078] The Arnow experiment can be used to quantitatively determine catechol iron carriers. First, the Arnow experiment standard curve is established: 0.0154g of 2,3-dihydroxybenzoic acid (DHBA) is taken and diluted to 100mL to obtain a 1mM mother solution, and the mother solution is diluted to 0.1, 0.2, 0.3, 0.4, 0.5, 0.6 and 0.7mM respectively. Take 1mL of the above 2,3-dihydroxybenzoic acid solution with different concentration gradients and perform the Arnow experiment respectively, detect and record the absorbance value at 510nm, and draw the standard curve as shown below: Figure 4 The activated bacteria were then 600 = 0.01 was transferred to 50 mL LB medium, and samples were taken every 4 hours to quantitatively determine OD using the Arnow test 510 In addition, the iron carrier production of bacteria in different time periods was monitored, and the iron carrier production curve was drawn based on the iron carrier production of bacteria in different time periods.

[0079] Figure 4 This is the standard curve of 2,3-dihydroxybenzoic acid in the Arnow experiment. The OD of the solution in this curve is 510 It is linearly related to the concentration of 2,3-dihydroxybenzoic acid (DHBA), and its slope and intercept are shown in the figure. 2 The catechol siderophore content in the Δfur knockout strain calculated according to the standard curve is as follows Figure 5The iron carrier content produced by the Δfur knockout strain increased continuously from 12 to 48 hours, with a significant increase in iron carrier production from 12 to 24 hours (P<0.05), and a slow increase from 24 to 48 hours. The highest iron carrier concentration was 0.50 mM at 48 hours. The iron carrier content gradually decreased from 48 to 96 hours, indicating that the iron carrier production does not increase with the extension of culture time.

[0080] Example 3

[0081] Melanin color development, extraction, characteristic analysis and yield determination

[0082] The color development of the knockout strain was achieved by overnight activation culture of Bt 97-27 and Δfur knockout strains, preparing a number of liquid LB culture media, and sterilizing them at high temperature. 600 =0.01 was inoculated into 50 mL LB medium and cultured in a constant temperature shaker at 28°C and 200 rpm.

[0083] According to the results of 1 and 3 days of liquid LB culture, Figure 6 It can be seen that when cultured in normal LB medium, the color of the Δfur knockout strain is darker than that of the Bt97-27 strain.

[0084] Because only the Δfur knockout strain can produce melanin, only its characteristics were analyzed. Collect 50 mL of the bacterial liquid of the Δfur strain in a centrifuge tube, centrifuge at 8000 rpm, 4°C for 15 min, remove the bacteria and retain the supernatant, add NaOH to adjust the pH to 13, and then use 1M HCl to adjust the pH to 2. Leave it at room temperature for 4 hours to allow the melanin to precipitate naturally, centrifuge at 10000 rpm for 30 min, remove the supernatant and retain the precipitate, dry it at room temperature and grind it to obtain a melanin solid powder. The bacterial melanin sample and the purchased melanin standard were sent to the company. The melanin powder was treated with KBr and pressed into a tablet for infrared spectroscopy scanning (FTIR) analysis. The infrared spectrum range is 400-4000cm -1 .

[0085] like Figure 7 The horizontal axis shows the wavelength range, and the vertical axis "T (%)" represents the "transmittance". The transmittance in infrared spectroscopy refers to the ratio of the light that passes through the sample to the light that does not pass through the sample. The higher the transmittance, the less the sample absorbs light. From the comparison, it can be seen that the melanin produced by the Δfur strain has a wavelength of 3281.545, 1658.608 and 648.172cm -1 There are absorption peaks at 3218.395, 1620.131 and 647.145 cm-1, respectively, which are similar to those of melanin standard. -1The characteristic absorption peaks of the melanin have a high similarity, indicating that the melanin has the same basic framework and main groups as the synthetic melanin.

[0086] Melanin has an absorption peak at 400nm. First, a melanin standard curve is prepared. 25mg of melanin (molecular weight 318.28) is added to deionized water to make the volume 7.854mL. At this time, the concentration of melanin is 10mM. 10mM melanin is diluted to 9, 8, 7, 6, 5, 4, 3, 2, and 1mM respectively. Take 200μL of melanin of each concentration gradient and measure its absorbance value at a wavelength of 400nm with an enzyme marker. The melanin concentration is the x-axis and the OD is the x-axis. 400 Make a melanin standard curve for the y-axis.

[0087] By OD 400 After the measurement, 8 out of 10 points are retained to obtain R 2 A standard curve of 0.9996 was obtained, in which the OD of the solution was 400 It is linearly related to the concentration of melanin, and its slope and intercept are as follows Figure 8 shown.

[0088] Melanin has an absorption peak at 400nm, so the absorbance of bacterial culture at 400nm can be measured by an ELISA instrument to determine whether melanin is formed. Bt 97-27 and Δfur strains were activated overnight for 12h, and the activated bacterial solution was measured at the initial OD 600 =0.01 was inoculated into 50 mL LB medium and cultured in a constant temperature shaker at 28°C and 200 rpm. 200 μL of bacterial supernatant was taken every 24 h to detect its OD 400 The measured OD 400 Substitute the melanin standard curve into the calculation of melanin concentration.

[0089] like Fig. 9 As shown, the OD of the Δfur knockout strain in liquid LB culture was 400 It started to increase continuously from 24h and reached 3.10mM at 168h.

[0090] Example 4

[0091] Detection method of ROS level in strains

[0092] The intracellular ROS of Bt 97-27 and Δfur strains were measured at 1, 3, and 7 days in triplicate. The Nanjing Jiancheng Reactive Oxygen Spectrosity (ROS) Assay Kit (Chemical Fluorescence Method) (Cat. No. E004-1-1) was used. Light-proof centrifuge tubes and light-proof ELISA plates were used throughout the experiment. First, prepare 200 μL of sample, 100 μM DCFH-DA, and 0.01 M PBS with a pH of 7.2 for later use. First, centrifuge the sample to obtain the bacteria, then add 900 μL PBS and 100 μL of 100 μM DCFH-DA probe to mix, so that the final concentration of the probe is 10 μM. Incubate at 37°C for 45 minutes, flip up and down every 3-5 minutes to allow the probe and bacteria to fully combine. Centrifuge at 1000 rpm for 5 minutes, wash with PBS 1-2 times, and finally mix with PBS for measurement. The instrument used is the SPARK multi-functional full-wavelength ELISA reader. The optimal excitation wavelength is 488nm and the optimal emission wavelength is 525nm.

[0093] like Fig.10 As shown in the figure, on the 1st and 3rd days, the Δfur strain produced more ROS than the Bt 97-27 strain. It is possible that the knockout of the gene may have changed the metabolic pathway of the strain, leading to the accumulation of the intermediate product iron carrier. On the 7th day, the Δfur strain had a decrease in ROS, and the iron carrier also completely disappeared and was completely chelated by melanin.

[0094] Example 5

[0095] Method for preparing samples for scanning electron microscopy of strains

[0096] 4 mL of Bt 97-27 and Δfur culture fluid was collected from the culture for seven days, centrifuged at 6000 rpm for 3 min, washed 3-4 times with pH 7.2 phosphate buffer, then fixed with 2.5% glutaraldehyde at 4°C for 12 h, washed again with pH 7.2 phosphate buffer, and finally dehydrated with 30%, 50%, 70%, 80%, 90% and 100% alcohol in stages, 2 times for each stage, and 10-15 min for each dehydration. The samples were then freeze-dried in a vacuum freeze dryer for 12 h. The samples were powder-sprayed with gold and then observed and images were collected. The magnification of the electron microscope photos in the experiment was 5000 and 10000 times.

[0097] like Fig.11 As shown, SEM analysis showed that the Δfur strain was shorter and wider than that of the Bt 97-27 strain, which may be because the gene knockout affected the genes or regulatory factors related to the strain size, resulting in changes in the growth and reproduction process or morphological structure of the strain.

[0098] The implementation modes of the present invention are described in detail above in conjunction with the embodiments, but the present invention is not limited to the above-mentioned implementation modes. For ordinary technicians in this technical field, after knowing the contents recorded in the present invention, they can make several equivalent changes and substitutions thereto without departing from the principle of the present invention, and these equivalent changes and substitutions should also be regarded as belonging to the protection scope of the present invention.

[0099]

[0100]

Claims

1. A Bacillus thuringiensis fur gene knockout strain, characterized in that: The Bacillus thuringiensis fur gene knockout strain is obtained by knocking out the iron uptake regulatory protein fur gene from the genome of Bacillus thuringiensis 97-27.

2. A method for constructing a Bacillus thuringiensis fur gene knockout strain, characterized in that: The following steps are involved: A. Construction of gene knockout donor strain; a1. Using the Bt 97-27 genome as a template, amplify the upstream homology arm and downstream homology arm of the fur gene; a2. Amplify the UD sequence of the fur gene by overlap extension PCR, and use restriction endonucleases to digest the upstream homology arms, downstream homology arms and vector pRP1028, respectively, and then connect them by ligase to obtain a ligation product; a3. The ligation product was transformed into competent E. coli, and the transformants were picked and cultured in a liquid medium containing spectinomycin resistance to obtain a successfully constructed knockout donor strain; B. The first single exchange; The donor strain pRP1028-furUD / DH5α, the helper strain pSS1827 / DH5α and the recipient strain Bt 97-27 are cultured in culture media respectively, wherein the donor strain pRP1028-furUD / DH5α is inoculated in a liquid culture medium containing spectinomycin, and the helper strain pSS1827 / DH5α is inoculated in a liquid culture medium containing ampicillin; After culturing to the same OD value, resuspend the bacteria, mix them in equal proportions and add them to antibiotic-free plates for culturing. After culturing for a period of time, transfer the bacterial lawn to antibiotic-free liquid culture medium, mix them evenly and apply them to plates containing spectinomycin and polymyxin resistance for culturing. After culturing, pick the red colonies grown on the plates and transfer them to liquid culture medium containing spectinomycin and polymyxin resistance for culturing to obtain bacterial liquid. C. Eliminate plasmids; The bacterial solution obtained by culturing in step B is transferred to a liquid culture medium containing spectinomycin and polymyxin resistance, and the culture is transferred once every 6-8 hours, and the culture is transferred three times to obtain a bacterial solution in which the plasmid is eliminated; D. Positive transformant detection; The plasmid-eliminated bacterial solution is isolated from a single colony on a plate containing spectinomycin and polymyxin resistance, and after cultivation, a single colony is selected and cultured in a liquid medium containing spectinomycin and polymyxin resistance, and screened and tested to preserve the Bt 97-27 strain that succeeded in the first single exchange; E. Second single exchange; The donor bacteria pSS4332 / DH5α, the Bt 97-27 strain that succeeded in the first single exchange, and the auxiliary strain pSS1827 / DH5α are cultured respectively, wherein the donor bacteria pSS4332 / DH5α and the auxiliary strain pSS1827 / DH5α are inoculated in a liquid culture medium containing kanamycin for culture, and the Bt 97-27 strain that succeeded in the first single exchange is inoculated in a culture medium containing spectinomycin and polymyxin for culture; after the three strains are cultured, they are washed with antibiotic-free LB, and then mixed in equal proportions and added to antibiotic-free plates for culture, after culture for a period of time, the bacterial lawn is transferred to an antibiotic-free liquid culture medium, mixed and spread on a plate containing kanamycin and polymyxin resistance for culture, after culture, the transformants are picked and inoculated into a culture bottle, and after culture overnight, they are streaked and separated on a solid plate containing kanamycin and polymyxin resistance; F. Positive clone screening; Single colonies separated by streaking were inoculated on solid plates containing kanamycin and polymyxin resistance and solid plates containing spectinomycin and polymyxin for culture respectively, and colonies with kanamycin resistance but not spectinomycin resistance were selected and cultured in liquid medium containing kanamycin and polymyxin, and then the genome was extracted and verified by PCR; G. Plasmid elimination; The verified positive clones were transferred to the antibiotic-free culture medium in proportion for cultivation. The transfer was repeated for more than 10 times, and the clones were separated by streaking on the antibiotic-free plates. Single colonies were picked and inoculated on the antibiotic-free culture medium and the plates containing kanamycin resistance for cultivation. The colonies without kanamycin resistance were the colonies in which the plasmid was successfully eliminated, i.e., the fur knockout strains.

3. The method for constructing a Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: In step a1, the upstream homology arm of the fur gene is amplified using the upstream forward primer furUF of the fur gene and the upstream reverse primer furUR of the fur gene; wherein the nucleotide sequence of furUF is shown in SEQ ID NO.1, and the nucleotide sequence of furUR is shown in SEQ ID NO.2; In step a2, the downstream forward primer furDF and the downstream reverse primer furDR of the fur gene are used to amplify the downstream homology arm of the fur gene; the nucleotide sequence of furDF is shown in SEQ ID NO.3, and the nucleotide sequence of furDR is shown in SEQ ID NO.

4.

4. The method for constructing a Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: The liquid culture medium containing spectinomycin resistance in step a3 is an LB liquid culture medium containing spectinomycin resistance, and the final concentration of spectinomycin is 300 μg / mL.

5. The method for constructing the Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: Step B is specifically as follows: The final concentration of spectinomycin in the medium of the donor strain pRP1028-fur UD / DH5α was 300 μg / mL; the final concentration of ampicillin in the medium of the helper strain pSS1827 / DH5α was 100 μg / mL; The donor strain pRP1028-fur UD / DH5α, the helper strain pSS1827 / DH5α, and the recipient strain Bt 97-27 were cultured to the same OD 600 =0.8, resuspend with antibiotic-free LB, mix in equal proportions and add to antibiotic-free LB plates for culture, then transfer all the bacterial moss to antibiotic-free liquid LB, mix well and evenly spread on LB plates containing final concentration of 300μg / mL spectinomycin and 60units of polymyxin for culture, pick out red colonies and transfer to liquid LB medium containing final concentration of 300μg / mL spectinomycin and 60units of polymyxin, and culture at 200rpm and 28℃ to obtain bacterial solution.

6. The method for constructing a Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: Step C is specifically as follows: The bacterial solution obtained in step B was transferred at a ratio of 1:100 to a liquid LB medium containing 300 μg / mL spectinomycin and 60 units of polymyxin and cultured at 37°C. The culture was transferred once every 6-8 hours. The plasmid-eliminated bacterial solution was obtained after three transfers. Step D is specifically as follows: The plasmid-eliminated bacterial solution was streaked on an LB plate containing a final concentration of 300 μg / mL spectinomycin and 60 units of polymyxin to isolate a single colony. After overnight culture, a single colony was picked out and cultured in a liquid LB medium containing a final concentration of 300 μg / mL spectinomycin and 60 units of polymyxin. The genomic DNA was extracted and PCR was performed to detect whether the first single exchange was successfully integrated into the genome, and the Bt 97-27 strain with a successful first single exchange was preserved.

7. The method for constructing a Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: Step E is specifically as follows: The donor bacteria pSS4332 / DH5α and the helper strain pSS1827 / DH5α were inoculated in a culture medium containing a final concentration of 50 μg / mL kanamycin for culture, and the recipient bacteria was the Bt 97-27 strain that succeeded in the first single exchange; after culturing the three strains, they were washed with antibiotic-free LB, then mixed in a ratio of 1:1:1 and added to antibiotic-free LB plates for culture, and then the bacterial lawn was transferred to antibiotic-free liquid LB and mixed and evenly spread on a plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin resistance. After culturing for 3 days, 8-10 transformants were picked out and inoculated into a PA bottle, and cultured overnight at 200 rpm and 28°C, and then streaked and separated on a solid LB plate containing a final concentration of 50 μg / mL kanamycin and 60 units of polymyxin resistance.

8. The method for constructing a Bacillus thuringiensis fur gene knockout strain according to claim 2, characterized in that: Step F is specifically as follows: The corresponding single colonies isolated by streaking were inoculated on LB solid plates containing kanamycin and polymyxin 60 units at a final concentration of 50 μg / mL and spectinomycin and polymyxin 60 units at a final concentration of 300 μg / mL, respectively, and cultured at 28°C. The colonies with kanamycin resistance but not spectinomycin resistance were picked and cultured in liquid LB medium containing kanamycin and polymyxin 60 units at a final concentration of 50 μg / mL at 200 rpm and 28°C. The DNA genome was extracted and verified by PCR. Step G is specifically as follows: The positive clones verified by PCR were transferred to the antibiotic-free LB medium at a ratio of 1:100 for culture, and the transfer was continued for more than 10 times. The clones were streaked on the antibiotic-free LB plate, and single colonies were picked and inoculated on the antibiotic-free LB plate and the LB plate with a final concentration of 50 μg / mL kanamycin resistance. The colonies without the final concentration of 50 μg / mL kanamycin resistance were the colonies in which the plasmid was successfully eliminated, that is, the Bacillus thuringiensis fur gene knockout strain (Δfur) was obtained.

9. Use of the Bacillus thuringiensis fur gene knockout strain according to claim 1 in producing siderophore.

10. Use of the Bacillus thuringiensis fur gene knockout strain as claimed in claim 1 in producing melanin.

Images