A bovine-derived multi-drug resistant b. bronchiseptica with double gene deletion, construction method and application
By constructing a bovine type A Pasteurella multocida strain with double gene deletion, the problem of the lack of effective vaccines in existing technologies has been solved, achieving immune protection against bovine type A and type F Pasteurella multocida and reducing the virulence and capsule formation of the strain.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTHWEST UNIV
- Filing Date
- 2025-01-09
- Publication Date
- 2026-08-04
AI Technical Summary
There is a lack of effective, domestically developed bovine Pasteurella multocida vaccines, and imported vaccines do not provide ideal immune protection and cannot effectively control diseases caused by Pasteurella multocida.
We constructed a bovine Pasteurella multocida type A variant with double gene deletions, and prepared cross-immunization vaccines and inactivated vaccines by knocking out the cpxA and cpxR genes. These vaccines were then applied to provide immunoprotection against bovine Pasteurella multocida types A and F.
It achieves effective immune protection against bovine Pasteurella multocida types A and F, reduces the virulence of the strain and capsule formation, and has good application prospects.
Smart Images

Figure CN119823928B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal disease prevention and control technology, specifically to a bovine type A Pasteurella multocida with double gene deletion, its construction method, and its application. Background Technology
[0002] Pasteurella multocida (Pm) is a zoonotic pathogen that can infect humans and all livestock and poultry, as well as various wild animals such as tigers and chimpanzees. It can cause a variety of diseases, including fowl cholera, atrophic rhinitis in pigs, pneumonia in pigs, cattle, and sheep, and hemorrhagic septicemia, resulting in significant economic losses to the livestock industry. Based on its capsular antigen typing, Pm can be classified into five serotypes: A, B, D, E, and F. In my country, capsular Pm types A and B are the most prevalent in cattle herds. However, currently, my country lacks domestically developed commercial vaccines specifically targeting capsular Pm type A; all related vaccines are imported, and their immunoprotective effects are not ideal. Therefore, developing a more effective broad-spectrum Pm vaccine is crucial for the prevention and control of Pm disease. Summary of the Invention
[0003] To address the aforementioned shortcomings of existing technologies, this invention provides a bovine type A Pasteurella multocida with double gene deletions, its construction method, and its applications.
[0004] To achieve the above-mentioned objectives, the technical solution adopted by this invention is as follows: This invention provides a bovine Pasteurella multocida type A strain with double gene deletions, specifically a bovine Pasteurella multocida type A strain with PmCQ2 knockout isolated from the bovine respiratory tract. cpxA Genes and cpxR The double gene deletion strain Δ obtained from the gene cpxA Δ cpxR The missing gene nucleic acid sequences are shown in SEQ ID NO1 and SEQ ID NO2.
[0005] The present invention also provides the application of the above-mentioned double-gene-deleted bovine type A Pasteurella multocida in the preparation of a cross-immunization vaccine that simultaneously protects against bovine type A, bovine type A and bovine type F Pasteurella multocida.
[0006] Furthermore, bovine Pasteurella multocida type A Δ in cross-immunization vaccines cpxA Δ cpxR The content is 5×10 9 CFU / mL.
[0007] The present invention also provides the application of the above-mentioned double-gene-deleted bovine Pasteurella multocida type A in the preparation of bovine Pasteurella multocida type A inactivated vaccine.
[0008] Furthermore, the bovine-derived Pasteurella multocida attenuated live vaccine contains bovine-derived Pasteurella multocida Δ... cpxA Δ cpxR The content is 5×10 9 CFU / mL.
[0009] This invention also provides a method for constructing the above-mentioned double-gene-deleted bovine Pasteurella multocida type A, comprising the following specific steps: S1: Using genomic DNA of bovine Pasteurella multocida type A PmCQ2 as a template, primers were used... cpxA -Up-F、 cpxA -Up-R amplification cpxA upstream homologous arms of the gene, using primers cpxA -Down-F、 cpxA Down-R amplification cpxA Downstream homologous arms of the gene; and primers were used. cpxA -Up-F and cpxA -Down-R connects the upstream and downstream homologous arms to obtain the inserted fragment. cpxA up+down ; The primer sequences are as follows: cpxA -Up-F as shown in SEQ ID NO3: GACCATGATTACGCCAAGCTTATGCCATTTGCGAAAGAAAG; cpxA -Up-R as shown in SEQ ID NO4: AATCACAATCCAAACACTTTTTTCAAAGGT; cpxA -Down-F as shown in SEQ ID NO5: AAAGTGTTTGGATTGTGATTGATGATAATG; cpxA -Down-R as shown in SEQ ID NO6: TTTATCGGTACCCGGGGATCCTTAACTGGTAATCCAAAGCG; S2: Insert fragment cpxA up+down Connected to linear vector pUC19 ori Kan R The recombinant plasmid pUC19 with the deleted gene was obtained. ori Kan R -Δ cpxA up+down ; S3: Using the gene-deleted recombinant plasmid pUC19 ori Kan R -Δ cpxA up+down Electroporation of PmCQ2 competent cells and screening for knockout cells cpxA strain Δ of the gene cpxA ; S4: Using genomic DNA of bovine Pasteurella multocida PmCQ2 as a template, primers were used... cpxR -Up-F、 cpxR -Up-R amplification cpxR upstream homologous arms of the gene, using primers cpxR -Down-F、 cpxR Down-R amplification cpxR Downstream homologous arms of the gene; and primers were used. cpxR -Up-F and cpxR -Down-R connects the upstream and downstream homologous arms to obtain the inserted fragment. cpxR up+down ; The primer sequences are as follows: cpxR -Up-F as shown in SEQ ID NO7: GACCATGATTACGCCAAGCTTATGCGGAGAAGAGTGCCTCA; cpxR -Up-R as shown in SEQ ID NO8: GTGCTATTGATAACGTCTCAACCCCATTGA; cpxR -Down-F as shown in SEQ ID NO9: TGAGACGTTAGTGCTATTGATATGCATATG; cpxR -Down-R as shown in SEQ ID NO10: TTTATTCGGTACCCGGGGATCCCAGAATAAATGCGAGAATCA; S5: Insert fragment cpxR up+down Connected to linear vector pUC19 ori Kan R The recombinant plasmid pUC19 with the deleted gene was obtained. ori Kan R -Δ cpxR up+down ; S6: Using the gene-deleted recombinant plasmid pUC19 ori Kan R -Δ cpxR up+downElectroporation strain Δ cpxA competent cells; screened to obtain knockout cells cpxA Genes and cpxR Bovine Pasteurella multocida Δ gene cpxA Δ cpxR .
[0010] Furthermore, in step S3, strain Δ cpxA The screening was performed using primers. dcpxA -F and dcpxA -R is used for identification, primers dcpxA The -F sequence is shown in SEQ ID NO11: GTGATGATAAAGGCTATTAT; Primers dcpxA The sequence of -R is shown in SEQ ID NO12: TGGCATTTTTCTAACACGCT.
[0011] Furthermore, in step S6, strain Δ cpxA Δ cpxR The screening was performed using primers. dcpxR -F and dcpxR -R is used for identification, primers dcpxR The -F sequence is shown in SEQ ID NO13: AGTAAGCCTGCAATTAACAA; Primers dcpxR The sequence of -R is shown in SEQ ID NO14: ATAGAAGTGATAATTTCTTG.
[0012] The beneficial effects of this invention are as follows: This invention utilizes homologous recombination to target bovine Pasteurella multocida PmCQ2. cpxA Genes and cpxR Gene knockout successfully constructed a double-gene deletion strain Δ cpxA Δ cpxR For the first time, it was confirmed that the deletion strain has acid resistance, reduced capsule production, and reduced virulence. The vaccine prepared from the deletion strain can provide good immunoprotection against bovine type A, bovine type A, and bovine type F Pasteurella multocida, and has good application prospects as a vaccine. Attached Figure Description
[0013] Figure 1 For Δ cpxA Δ cpxA Δ cpxR PCR identification diagram; Figure 2 For Δ cpxA Δ cpxA Δ cpxR PCR identification diagram of in vivo genetic stability; Figure 3 For Δ cpxA Δ cpxA Δ cpxR PCR identification diagram of in vitro genetic stability; Figure 4 For Δ cpxA Δ cpxA Δ cpxR A comparison chart of capsule content; Figure 5 For Δ cpxA Δ cpxA Δ cpxR Comparative chart of cross-immunoprotective efficacy evaluation of inactivated vaccines; Figure 6 For Δ cpxA Δ cpxA Δ cpxR Growth curve in a high-permeability environment; Figure 7 For Δ cpxA Δ cpxA Δ cpxR Growth curves under acid-base stress. Detailed Implementation
[0014] The specific embodiments of the present invention are described below to enable those skilled in the art to understand the present invention. However, it should be understood that the present invention is not limited to the scope of the specific embodiments. For those skilled in the art, various changes are obvious as long as they are within the spirit and scope of the present invention as defined and determined by the appended claims. All inventions utilizing the concept of the present invention are protected.
[0015] In this embodiment of the invention, the bovine type A virulent strain PmCQ2 of Pasteurella multocida was isolated and identified by the Beef Cattle Disease Prevention and Control Research Laboratory of the College of Veterinary Medicine, Southwest University; the plasmid pUC19 was purchased and preserved by the laboratory of the College of Veterinary Medicine, Southwest University, and was modified in the early stage by modifying the plasmid's restriction enzyme sites. Kpn I and EcoR I. The modified knockout plasmid vector pUC19 was inserted into the middle to express the temperature-sensitive replication origin of the Kan nucleus and Pasteurella multocida. ori Kan R Store in a laboratory freezer at -80°C.
[0016] The mice used in the embodiments of the present invention were Kunming mice (female, 18-22g, 6-8 weeks old) purchased from Hunan Slack Jingda Experimental Animal Co., Ltd.; the sources of the instruments involved are shown in Table 6 below; Table 6
[0017] Example 1: Strain Δ cpxA Screening preparation strain Δ cpxA The screening and preparation process includes the following specific steps: A1: Obtaining the whole genome of PmCQ2: The PmCQ2 strain stored in the laboratory at -80℃ was taken out, and a sterile inoculation loop was used to pick up the PmCQ2 strain and streak it on Martin solid medium. It was incubated upside down in a 37℃ incubator for 24-30 hours. A single colony was picked and placed in 5 mL of Martin liquid medium and incubated in a 37℃ shaking incubator for 12 hours. The whole genome was extracted according to the steps of the bacterial genomic DNA extraction kit instructions. After determining the concentration of the obtained whole genome, it was stored in a -20℃ refrigerator.
[0018] A2: cpxA Amplification and purification of upstream and downstream homologous arms of the gene: using primers cpxA Up-F, cpxA Up-R and cpxA Down-F, cpxA Down-R amplification cpxA The upper and lower homologous arms of the gene. The PCR reaction system is shown in Table 1 below.
[0019] Table 1
[0020] After the PCR reaction was completed, the target band was detected by 1% agarose gel electrophoresis. The upper and lower homologous arms were then measured for concentration and stored at -20°C.
[0021] A3: cpxA Connection of upstream and downstream homologous arms of a gene: using primers cpxA -Up-F、 cpxA -Down-R connection cpxA Upstream and downstream homologous arms of the gene. The PCR reaction system is shown in Table 2 below.
[0022] Table 2
[0023] After the PCR reaction, the target band was detected by 1% agarose gel electrophoresis. The upper and lower homologous arms were then extracted and recovered. cpxA up+down After determining the concentration, store in a -20°C refrigerator.
[0024] A4: Linear vector pUC19 ori Kan R and cpxA Upper and lower homologous arms cpxAup+down Connection: Remove competent DH5α cells from the laboratory -80℃ freezer, and then follow the steps of the Taq Master PCR Mix kit purchased from Tiangen Biotech Co., Ltd. cpxA up+down Add the DH5α competent cells, gently tap the tube to mix, incubate on ice for 30 min, heat shock for 45 s, immediately cool on ice for 2-3 min, add an appropriate amount of LB liquid medium, and incubate at 30℃ in a shaking incubator for 1 h. Centrifuge at 5000 rpm for 5 min, resuspend the bacterial pellet with an appropriate amount of medium, spread it on LB solid medium containing Kans, and incubate upside down at 30℃ for 12-16 h. Identify the colonies grown on the medium. The PCR reaction system is shown in Table 3.
[0025] Table 3
[0026] The verified colonies were picked and transferred to 5 mL of LB broth containing Kans, and incubated at 30°C with shaking for 12 h. Plasmid extraction was then performed according to the instructions of the plasmid mini-extraction kit. The extracted plasmids were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing using single-phase primer M13-48. The concentration of the correctly sequenced plasmids was determined to yield pUC19. ori Kan R -Δ cpxA up+down Store in a laboratory freezer at -20°C.
[0027] A5: Recombinant plasmid pUC19 ori Kan R -Δ cpxA up+down Electroporation of competent PmCQ2 cells: Thaw competent PmCQ2 cells on ice and add 5-10 μL of recombinant plasmid pUC19 to the competent PmCQ2 cells. ori KanR-Δ cpxA up+downGently tap the tube wall to mix, and let stand on ice for 10 minutes; clean the electroporation cup twice with 75% alcohol, then treat with 95% alcohol for 5 minutes, discard the alcohol, dry in a 65℃ oven, and pre-cool in a -20℃ refrigerator for later use; transfer the liquid to the electroporation cup, wipe off the water droplets on the outer wall, and electroporate for 5 ms at a voltage of 2,500V and a resistance of 500Ω; immediately add 900 μL BHI liquid medium, mix well, and transfer to a 1.5 mL centrifuge tube, and incubate in a 30℃ shaking incubator for 2 hours; centrifuge at 5000 rpm for 5 minutes, discard the supernatant, resuspend the cells in 100-200 μL Martin liquid medium, spread on Martin solid medium containing Kans, and incubate in a 30℃ constant temperature incubator for 30-48 hours.
[0028] A6: All colonies grown in the above selection medium will be analyzed using primer d. cpxA -F and d cpxA -R was used for identification, and the PCR reaction system is shown in Table 4.
[0029] Primer d cpxA The -F sequence is GTGATGATAAAGGCTATTAT; primer d cpxA The sequence for -R is TGGCATTTTTCTAACACGCT; Table 4
[0030] Colonies that have undergone single-exchange assays (detecting two target bands by 1% agarose gel electrophoresis: one band amplifying the upper homologous arm + target gene + lower homologous arm, and the other band amplifying only the upper and lower homologous arms) were picked and serially diluted in 900 μL of physiological saline, then plated on Martin's solid medium and incubated at 37°C for 30-40 h. Simultaneously, they were inoculated into 5 mL of Martin's liquid medium containing Kans and incubated at 37°C with shaking for 12 h, then preserved at -80°C.
[0031] Repeat the above steps until colonies that have undergone double exchange (detection of the target band by 1% agarose gel electrophoresis: amplification of only the upstream and downstream homologous arms) are selected. Pick these colonies into 5 mL of Martin liquid medium and incubate at 37°C with shaking for 12 h, then preserve them at -80°C.
[0032] The above colonies were identified using primers pUC19-F and pUC19-R. The PCR reaction system is shown in Table 3.11.
[0033] The sequence of primer pUC19-F is GAGCGGATAACAATTTCACAC; the sequence of primer pUC19-R is ATTTAAGAATACCTTGCCGC. Colonies that did not amplify the target band (recombinant plasmid was lost during screening) were picked and transferred to 5 mL of Martin liquid medium and cultured in a shaking incubator at 37°C for 12 h. Then, 100 μL of the bacterial culture was transferred to 5 mL of Martin liquid medium containing Kan and cultured in a shaking incubator at 37°C for 48 h to confirm that the resistance had been completely eliminated.
[0034] The bacterial suspension, after completely eliminating resistance, was serially diluted and plated onto Martin's solid medium. Single colonies obtained were analyzed using primers d. cpxA -F and d cpxA -R was used for identification, and the PCR reaction system is shown in Table 5.
[0035] Table 5
[0036] PCR products were sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional sequencing. Primers used were d... cpxA -F and d cpxA -R. Strains with correct sequencing were obtained by expanding the culture of the colonies. cpxA Preserve the seeds in a -80℃ refrigerator.
[0037] Example 2: Strain Δ cpxA Δ cpxR Screening preparation B1: cpxR Amplification and purification of upstream and downstream homologous arms of the gene: using primers cpxR Up-F, cpxR Up-R and cpxR Down-F, cpxR Down-R was amplified respectively. cpxR Homologous arms of a gene cpxR up+down The PCR reaction system is shown in Table 1. After verifying the correct bands, the gel was recovered, the concentration was determined, and the gel was stored at -20°C. B2: Using the method in step A4 of Example 1, the linear carrier pUC19 ori Kan R and cpxR up+down The recombinant plasmid pUC19 was obtained by ligation. ori KanR-Δ cpxR up+down ; B3: strain Δ cpxA Preparation of competent cells: The strain Δ cpxAThe bacterial culture was transferred to 5 mL of Martin's liquid medium and incubated at 37°C with shaking for 12 h. 100 μL of the bacterial culture was then transferred to two 5 mL tubes of Martin's liquid medium and incubated at 37°C with shaking for 4.5 h. OD 600 Approximately 0.6; add 1-3 μL of hyaluronidase to each tube and continue culturing in a 37°C shaking incubator for 30 min; incubate on ice for 30 min; aliquot the bacterial solution into 1.5 mL centrifuge tubes, centrifuge at 13400 rpm for 4 min, discard the supernatant, resuspend the bacterial pellet in sterile 10% glycerol, centrifuge at 10,000 rpm for 90 s, discard the supernatant, wash three times with 10% glycerol, and finally resuspend the bacterial pellet in 100 μL of 10% glycerol. Δ cpxA After the competent cells were prepared, they were flash-frozen in liquid nitrogen and temporarily stored in a -80°C freezer.
[0038] B4: Using the method in step A5 of Example 1, the recombinant plasmid pUC19 ori KanR-Δ cpxR up+down Electrical conversion to Δ cpxA Bacterial strains were obtained from competent cells; B5: Use primer d to transfer the bacterial strain obtained in B4. cpxR -F and d cpxR -R was used for identification, and the PCR reaction system is shown in Table 4; During the first-generation culture process, double exchange has been completed (the target band was detected by 1% agarose gel electrophoresis; only the amplified band was detected). cpxR Colonies of the gene (upstream and downstream homologous arms) are processed according to step A6; colonies grown in Martin medium are then analyzed using primer d. cpxR -F、d cpxR -R is used for identification. For colonies that are verified to be correct, PCR amplification is performed using primers pUC19-F and pUC19-R.
[0039] When all the above colonies can amplify bands, pick all single colonies into 1 mL of Martin liquid medium containing Kan and incubate in a shaking incubator at 37°C for 12 h.
[0040] Colonies exhibiting poor growth were selected and serially diluted in 900 μL of physiological saline, then plated onto Martin's agar plates and incubated at 37°C for 30-40 h. Simultaneously, the corresponding bacterial culture was preserved at -80°C. All colonies from the solid agar plates were transferred to 1 mL of Martin's liquid agar containing Kans and incubated at 37°C with shaking for 12 h. This process was repeated until colonies that could not grow on Martin's liquid agar containing Kans were identified.
[0041] These colonies were transferred to Martin liquid medium with reduced Kan concentration. The above steps were repeated, with the Kan concentration in Martin liquid medium decreasing sequentially, until colonies that could not grow in Martin liquid medium containing low concentrations of Kan were screened out.
[0042] Colony identification was performed using primers pUC19-F and pUC19-R. Colonies that did not amplify the target band (recombinant plasmids were lost during screening) were picked and transferred to 5 mL of Martin liquid medium and incubated at 37°C with shaking for 12 h. The colonies were then serially diluted, plated onto Martin solid medium, and incubated at 37°C for 24-30 h, following step A6. The sequencing-normal strain Δ... cpxA Δ cpxR Preserve the seed in a -80℃ freezer.
[0043] Example 3: Validation at the strain gene level With PmCQ2, Δ cpxA Δ cpxA Δ cpxR Using single colonies as templates, KMT-F / R, pUC19-F / R, and d were used. cpxA -F / R and d cpxR PCR amplification was performed using 4 primer pairs (-F / R), and the results were detected by 1% agarose gel electrophoresis. Figure 1 As shown. Lanes 1-3 were amplified using Pasteurella multocida-specific primers KMT-F / R, and amplification bands were observed, indicating that all three bacterial strains were Pasteurella multocida. Lanes 4-6 were amplified using primers d... cpxA Amplification was performed using -F / R, with PmCQ2 as the template in lane 6, resulting in an amplified fragment of 1480 bp. cpxA The full-length gene plus the non-coding region outside the gene), the amplified fragments in lanes 4 and 5 are 687 bp ( cpxA (793bp gene deletion); lanes 7-9 are primed with primer d cpxR Amplification was performed using -F / R, with lanes 7 and 9 serving as templates for Δ. cpxA And PmCQ2, therefore the amplified fragment is 1080bp ( cpxR The full-length gene plus the non-coding region outside the gene), the 8-lane amplified fragment is 683bp ( cpxR (A 397bp gene deletion was found). Lanes 10 and 11 were amplified using primer pUC19-F / R, but no fragment was amplified, indicating that the temperature-sensitive plasmid was missing in the deleted strain. Lanes 12 and 13 each used two plasmids as positive controls. In summary, this indicates that Δ cpxA Δ cpxA Δ cpxR Successfully built.
[0044] Example 4 Gene deletion strain Δ cpxA and Δ cpxA Δ cpxR Genetic stability verification The study included in vivo and in vitro genetic stability verification. The specific steps for in vivo genetic stability verification were as follows: 100 μL of the gene-deleted bacterial culture was injected intramuscularly into mice. After the mice died, they were dissected, and the liver sections were streaked with a loop in three zones on Martin's solid medium. The culture was incubated at 37°C for 24-36 h. The obtained single colonies were transferred to 5 mL of Martin's liquid medium and incubated at 37°C with shaking for 12 h to obtain the first generation of in vivo passaged bacterial culture.
[0045] Repeat the above steps, using primers KMT-F, KMT-R, and d every five generations. cpxA -F、d cpxA -R, pUC19-F and pUC19-R were validated once. The PCR reaction system is shown in Table 4. 20 generations of passaged bacterial culture were obtained.
[0046] The sequence of primer KMT-F is ATCCGCTATTTACCCAGTGG; the sequence of primer KMT-R is GCTGTAAACGAACTCGCCAC. The 20th generation strain Δ obtained by continuous in vivo culture cpxA Δ cpxA Δ cpxR Using single colonies as templates, KMT-F / R, pUC19-F / R, and d were used. cpxA -F / R、d cpxR -F / R4 primers were used for PCR verification, and the results are as follows: Figure 2 As shown, lanes 1-3 were amplified using the Pasteurella multocida-specific primer KMT-F / R, and amplification bands appeared, indicating that all three bacteria were Pasteurella multocida. Lanes 4-6 were amplified using primer d cpxA Amplification was performed using -F / R, with PmCQ2 as the template in lane 4, resulting in an amplified fragment of 1480 bp. cpxA The full-length gene plus the non-coding region outside the gene), the amplified fragments in lanes 5 and 6 are 687 bp ( cpxA (793bp gene deletion); lanes 7-9 are primed with primer d cpxR Amplification was performed using -F / R, with lanes 7 and 8 templates being PmCQ2 and Δ. cpxA Therefore, the amplified fragment is 1080bp ( cpxR The full-length gene plus the non-coding region outside the gene), the 9-lane amplified fragment is 683bp ( cpxR(A 397bp gene deletion was observed). Lanes 10 and 11 were amplified using primers pUC19-F / R, but no fragment was amplified, indicating that the temperature-sensitive plasmid was missing in the deletion strain. Lanes 12 and 13 used two plasmids as positive controls, respectively. In summary, this indicates that after continuous passage in vivo, Δ cpxA Unable to amplify cpxA Gene, Δ cpxA Δ cpxR Unable to amplify cpxA Genes and cpxR Genes, indicating the Δ constructed in the experiment cpxA Δ cpxA Δ cpxR It can be stably inherited in the body.
[0047] The specific steps for verifying in vitro genetic stability are as follows: Dip the gene-deleted bacterial culture into the inoculation loop, inoculate it into Martin solid medium, and incubate it in a constant temperature incubator at 37℃ for 24-36 hours. The obtained single colonies are picked into 5 mL of Martin liquid medium and incubated in a shaking incubator at 37℃ for 12 hours to obtain the first generation of in vitro passaged bacterial culture.
[0048] Repeat the above steps, using primers KMT-F, KMT-R, and d every five generations. cpxA -F、d cpxA -R, pUC19-F and pUC19-R were validated once. The PCR reaction system is shown in Table 4. 40 generations of passaged bacterial culture were obtained.
[0049] Δ, which has been continuously cultured in vitro for 40 generations cpxA Δ cpxA Δ cpxR Using single colonies as templates, KMT-F / R, PUC19-F / R, and d cpxA -F / R、d cpxR -F / R4 primers were used for PCR verification, and the results are as follows: Figure 3 As shown, lanes 1-3 were amplified using the Pasteurella multocida-specific primer KMT-F / R, and amplification bands appeared, indicating that all three bacteria were Pasteurella multocida. Lanes 4-6 were amplified using primer d cpxA Amplification was performed using -F / R, with PmCQ2 as the template in lane 4, resulting in an amplified fragment of 1480 bp. cpxA The full-length gene plus the non-coding region outside the gene), the amplified fragments in lanes 5 and 6 are 687 bp ( cpxA (793bp gene deletion); lanes 7-9 are primed with primer d cpxR Amplification was performed using -F / R, with lanes 7 and 8 templates being PmCQ2 and Δ. cpxA Therefore, the amplified fragment is 1080bp ( cpxR The full-length gene plus the non-coding region outside the gene), the 9-lane amplified fragment is 683bp ( cpxR(A 397bp gene deletion was observed); lanes 12 and 13 were amplified using primers pUC19-F / R, but no fragment was amplified, indicating that the temperature-sensitive plasmid was missing in the deletion strain. Lanes 10 and 11 each used two plasmids as positive controls. In summary, this indicates that after continuous in vitro passage, Δ cpxA Unable to amplify cpxA Gene, Δ cpxA Δ cpxR Unable to amplify cpxA Genes and cpxR Genes, indicating the Δ constructed in the experiment cpxA Δ cpxA Δ cpxR It can be stably inherited in vitro.
[0050] Example 5: Determination of bacterial capsule content For PmCQ2, Δ cpxA Δ cpxA Δ cpxR The capsule content of the strain was determined using the following method: (1) Standard curve preparation: The hyaluronic acid standard solution (50 μg / 100 μL) was diluted to different concentration gradients (0, 1, 3, 5, 10 μg / 100 μL). 100 μL of the liquid was added to 900 μL of capsular staining solution. Three replicates were set for each concentration gradient. After mixing, 200 μL of the liquid was taken to measure the OD. 630 The concentration gradient was plotted on the x-axis, and the measured OD values were... 630 Plot a standard curve with the average value as the ordinate.
[0051] (2) Take 100 μL Pm CQ2, Δ cpxA and Δ cpxA Δ cpxR The bacterial culture was transferred to 5 mL of Martin liquid medium and incubated in a shaking incubator at 37 °C for 6 h. 1 mL of the bacterial culture was then transferred to a 1.5 mL centrifuge tube, with 3 replicates per group. The cells were centrifuged at 13400 rpm for 15 min, the supernatant was discarded, and the cells were resuspended in 1 mL of sterile PBS. The cells were centrifuged again at 13400 rpm for 15 min, washed twice, and finally resuspended in 1 mL of sterile PBS.
[0052] (3) Place the above liquid in a metal bath at 42°C and treat for 1 hour. Take 100 μL of liquid before and after treatment and dilute it for plate counting.
[0053] (4) Centrifuge the remaining liquid at 13000 r / min for 20 min and transfer the supernatant to a clean 1.5 mL centrifuge tube.
[0054] (5) Add 100 μL of liquid to 900 μL of capsular staining solution, mix well, and then take 200 μL of liquid to measure OD. 630 The amount of hyaluronic acid released by the dead bacteria was calculated by substituting the values into the standard curve.
[0055] The results are as follows Figure 4 As shown, with PmCQ2 and Δ cpxA In comparison, Δ cpxA Δ cpxR The capsule content was significantly reduced, while Δ cpxA The capsule content was not significantly different from that of PmCQ2.
[0056] Example 6 Δ cpxA and Δ cpxA Δ cpxR Determination of cross-immunoprotective effect of inactivated vaccines Preparation of inactivated vaccine: Take 1 mL Δ cpxA and Δ cpxA Δ cpxR The bacterial culture was transferred to 100 mL of Martin's liquid medium and incubated at 37°C with a shaking incubator for 12 h. After dilution and plate counting, the bacterial culture was centrifuged at 13400 rpm for 15 min, and the cells were resuspended in an appropriate amount of sterile PBS to adjust the bacterial concentration. Formaldehyde solution was added to bring the final concentration to 0.15%, and the culture was inactivated at 37°C for 24 h, vortexed every 6 h. The inactivated bacterial culture and sterile PBS were mixed with 15 VG mineral oil adjuvant at a ratio of 4:1 to prepare 5 × 10⁻⁶ plates. 9 CFU / mLΔ cpxA Inactivated seedlings, 5×10 9 CFU / mLΔ cpxA Δ cpxR Inactivated vaccine and PBS emulsifier. After safety evaluation, store at 4°C.
[0057] After immunizing mice according to the corresponding immunization program, the bacterial strains cultured to the logarithmic growth phase were adjusted to appropriate concentrations, and 100 μL of bacterial solution was injected intramuscularly into mice (n=6). Mice were observed at 12-hour intervals for one week, and mouse mortality was recorded. Survival curves were plotted. Figure 5 As shown. The results indicate that, compared with PmCQ2 inactivated seedlings, Δ cpxA and Δ cpxA Δ cpxR The inactivated vaccine provides 100% protection against bovine type A Pasteurella multocida (PmCQ2) attacks and 50% protection against bovine type B (PmB) and type F Pasteurella multocida (PmF) attacks.
[0058] Example 7 Δ cpxA and Δ cpxA Δ cpxR Determination of salt stress capacity In Martin's liquid medium supplemented with 200 mM NaCl and 200 mM KCl respectively, 1 × 10⁻⁶ cells were inoculated. 9 CFU's PmCQ2, Δ cpxA and Δ cpxA Δ cpxR Bacterial suspension (n=3), OD600 was measured at 2-hour intervals, and plotted as shown below. Figure 6 The growth curve shown. Figure 6 It can be seen that in the early stages of growth of the three strains in Martin medium containing 200 mM NaCl solution, there was no significant difference among them. From 6 h onwards, the two deletion strains grew significantly faster than the wild-type strain. In the middle and late stages, Δ cpxA Growth significantly faster than Δ cpxA Δ cpxR In Martin medium containing 200 mM KCl solution, during the mid-to-late growth stages, Δ cpxA Growth was significantly faster than PmCQ2 and Δ cpxA Δ cpxR And PmCQ2 and Δ cpxA Δ cpxR There was no significant difference in growth. The results indicate that... cpxA Gene deletion enhances PmCQ2's ability to cope with hyperosmolar environments. cpxR The deletion of genes limits Δ cpxA The ability to cope with highly permeable environments.
[0059] Example 8 Δ cpxA and Δ cpxA Δ cpxR Determination of acid stress capacity 1×10 9 CFU culture was added to Martin's liquid medium at pH 5.5 (n=3), and measurements were taken every hour starting from the 8th hour. Figure 7 As can be seen from A, in an acidic environment, considering the entire growth stage, Δ cpxA Significantly faster than PmCQ2 and Δ cpxA Δ cpxR Δ cpxA Δ cpxR Significantly faster than PmCQ2. The results indicate that... cpxA Gene deletion enhances PmCQ2's ability to cope with acid stress. cpxR The deletion of genes limits Δ cpxA The ability to cope with acid stress.
[0060] 1×10 9 CFU bacterial culture was added to Martin's liquid medium at pH 8.5 (n=3), and OD600 was measured at 2-hour intervals. The results were plotted as shown in the figure. Figure 7The growth curve is shown in B. In an alkaline environment, PmCQ2 and Δ cpxA There was no significant difference in growth; in the early stages of growth, Δ cpxA Δ cpxR Significantly faster than PmCQ2 and Δ cpxA In the middle and late stages of growth, Δ cpxA Δ cpxR Significantly slower than PmCQ2 and Δ cpxA The results showed that... cpxA Gene deletion does not affect the ability of PmCQ2 to cope with alkaline stress. cpxR Genes can enhance Δ cpxA The ability to cope with alkaline stress.
Claims
1. A bovine Pasteurella multocida type A strain with double gene deletion, characterized in that, The genes missing in the strain are cpxA and cpxR, whose nucleotide sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.
2. The application of the double-gene-deleted bovine Pasteurella multocida type A as described in claim 1 in the preparation of a cross-immunization vaccine that simultaneously protects against bovine Pasteurella multocida types A, B, and F.
3. The application according to claim 2, characterized in that, Bovine Pasteurella multocida Δ vaccine cpxA Δ cpxR The content is 5×10 9 CFU / mL.
4. The application of the double-gene-deleted bovine Pasteurella multocida type A as described in claim 1 in the preparation of a bovine Pasteurella multocida type A inactivated vaccine.
5. The application according to claim 4, characterized in that, Bovine Pasteurella multocida attenuated live vaccine containing bovine Pasteurella multocida Δ cpxA Δ cpxR The content is 5×10 9 CFU / mL.
6. A method for constructing the bovine type A Pasteurella multocida with double gene deletion as described in claim 1, characterized in that, The specific steps include the following: S1: Using genomic DNA of bovine Pasteurella multocida type A PmCQ2 as a template, primers were used... cpxA -Up-F、 cpxA -Up-R amplification cpxA Upstream homologous arms of the gene, using primers cpxA -Down-F、 cpxA Down-R amplification cpxA Downstream homologous arms of the gene; and primers were used. cpxA -Up-F and cpxA -Down-R connects the upstream and downstream homologous arms to obtain the inserted fragment. cpxA up+down ; The primer sequences are as follows: cpxA -Up-F as shown in SEQ ID NO3: GACCATGATTACGCCAAGCTTATGCCATTTGCGAAAGAAAG; cpxA -Up-R as shown in SEQ ID NO4: AATCACAATCCAAACACTTTTTTCAAAGGT; cpxA -Down-F as shown in SEQ ID NO5: AAAGTGTTTGGATTGTGATTGATGATAATG; cpxA -Down-R is as shown in SEQ ID NO6: TTTATCGGTACCCGGGGATCCTTAACTGGTAATCCAAAGCG; S2: Insert fragment cpxA up+down Connected to linear vector pUC19 ori Kan R The recombinant plasmid pUC19 with the deleted gene was obtained. ori Kan R -Δ cpxA up+down ; S3: Using the gene-deleted recombinant plasmid pUC19 ori Kan R -Δ cpxA up+down Electroporation of PmCQ2 competent cells and screening for knockout cells cpxA strain Δ of the gene cpxA ; S4: Using genomic DNA of bovine Pasteurella multocida PmCQ2 as a template, primers were used... cpxR -Up-F、 cpxR -Up-R amplification cpxR Upstream homologous arms of the gene, using primers cpxR -Down-F、 cpxR Down-R amplification cpxR Downstream homologous arms of the gene; and primers were used. cpxR -Up-F and cpxR -Down-R connects the upstream and downstream homologous arms to obtain the inserted fragment. cpxR up+down ; The primer sequences are as follows: cpxR -Up-F as shown in SEQ ID NO7: GACCATGATTACGCCAAGCTTATGCGGAGAAGAGTGCCTCA; cpxR -Up-R as shown in SEQ ID NO8: GTGCTATTGATAACGTCTCAACCCCATTGA; cpxR -Down-F as shown in SEQ ID NO9: TGAGACGTTAGTGCTATTGATATGCATATG; cpxR -Down-R as shown in SEQ ID NO10: TTTATTCGGTACCCGGGGATCCCAGAATAAATGCGAGAATCA; S5: Insert fragment cpxR up+down Connected to linear vector pUC19 ori Kan R The recombinant plasmid pUC19 with the deleted gene was obtained. ori Kan R -Δ cpxR up+down ; S6: Using the gene-deleted recombinant plasmid pUC19 ori Kan R -Δ cpxR up+down Electroporation strain Δ cpxA competent cells; screened to obtain knockout cells cpxA Genes and cpxR Bovine Pasteurella multocida Δ gene cpxA Δ cpxR .
7. The construction method according to claim 6, characterized in that, In step S3, strain Δ cpxA The screening was performed using primers. dcpxA -F and dcpxA -R is used for identification, primers dcpxA The -F sequence is shown in SEQ ID NO11: GTGATGATAAAGGCTATTAT; Primers dcpxA The sequence of -R is shown in SEQ ID NO12: TGGCATTTTTCTAACACGCT.
8. The construction method according to claim 6, characterized in that, In step S6, strain Δ cpxA Δ cpxR The screening was performed using primers. dcpxR -F and dcpxR -R is used for identification, primers dcpxR The -F sequence is shown in SEQ ID NO13: AGTAAGCCTGCAATTAACAA; Primers dcpxR The sequence of -R is shown in SEQ ID NO14: ATAGAAGTGATAATTTCTTG.