Maleate hydratase and application thereof

Abstract

The invention discloses a maleate hydratase mutant SEQ ID NO: 7, which can efficiently catalyze a substrate in a reaction system with maleic acid concentration as high as 300g / L to carry out hydration conversion to generate D-malic acid with high optical purity, and has industrial application prospects.

Description

Technical Field

[0001] The invention belongs to the technical field of biocatalysis, and in particular relates to a maleate hydratase and an application thereof in the preparation of D-malic acid. Background Art

[0002] D-malic acid, also known as 2-hydroxysuccinic acid, is a rare organic acid in nature. However, its enantiomer L-malic acid exists in large quantities, and common fruits such as apples and pears contain L-malic acid.

[0003] D-malic acid is widely used in the chemical and pharmaceutical industries. Its applications mainly include three aspects: 1. As a precursor for the synthesis of many important compounds, such as chiral drugs, antibiotics, D,L-carnitine, pheromones, etc. 2. In the application of chiral resolution reagents, D-malic acid can resolve some neuroleptic drugs and muscle relaxants. 3. Used as a ligand in asymmetric synthesis.

[0004] The methods for preparing D-malic acid mainly include chemical synthesis, microbial fermentation and enzyme catalysis. The chemical method uses (2R, 3R)-tartaric acid or D-aspartic acid as raw materials to synthesize D-malic acid, but the raw material cost is high and the production efficiency is low. There is currently no report on industrial production. The concentration of malic acid in the fermentation broth of the microbial fermentation method is low, and there is no report on industrial production. The enzyme catalysis method mainly uses maleate hydratase to synthesize D-malic acid. The production of malic acid can be completed in one step using the cheap substrate maleic acid, and the theoretical yield is 100%.

[0005] In the previous research work, the inventor reported in CN110747190A that the mutant obtained after directed evolution of fumarate hydratase fumC from photosynthetic bacteria Rhodopseudomonas capsulata can catalyze the hydration reaction of maleic acid to generate D-malic acid, and the concentration of the substrate in the reaction system reaches 100g / L, but there is still a certain gap from industrial application. It is also disclosed that fumaric acid and maleic acid are both butenedioic acid, and the difference between the two is that the three-dimensional structure is different, fumaric acid is fumaric acid, which is a trans structure; maleic acid is maleic acid, which is a cis structure, and the acidity of the two is different. Maleic acid is also called dehydrated malic acid.

[0006]

[0007] Patent document CN109402184A discloses using Escherichia coli as a host bacterium to co-express the large and small subunits aHbzI and PaHbzJ of maleate hydratase from Pseudomonas alcaligenes, and obtaining an engineered bacterium DHIJ co-expressing the large and small subunits PaHbzI and PaHbzJ of maleate hydratase, which can convert maleic acid into D-malic acid in whole cells, wherein the concentration of substrate maleic acid can reach 1.5 mol / L, i.e., 174 g / L. However, since the engineered bacterium expresses two proteins aHbzI and PaHbzJ used in combination, maleic acid hydratase cannot be provided alone for catalytic reaction, and only whole-cell catalysis can be performed. The patent document also does not report the optical purity of the product D-malic acid. Summary of the invention

[0008] In order to provide a maleate hydratase that can be used for industrial application, which is used to catalyze the hydration reaction of maleic acid with high substrate concentration to generate D-malic acid with high optical purity, the inventors, in addition to further structurally modifying the maleate hydratase mutant reported in CN110747190A to improve the enzyme activity, are also committed to developing new sources of maleate hydratase from other microbial sources with high enzyme activity and high stereoselectivity. Based on bioinformatics data, it was found that the multifunctional enzyme (isopropylmalate / citramalate isomerase large subunit) LeuC (UniprotKB P81291, amino acid sequence is SEQ ID NO: 1) from Methanocaldococcusjannaschii has the function of maleate hydratase, and experiments have confirmed that it can catalyze the hydration reaction of maleic acid alone to generate optically pure D-malic acid.

[0009] Through random mutation by error-prone PCR method, combined with high-throughput screening of mutant library, and modeling of maleic acid hydration based on LeuC amino acid sequence, some sites in the enzyme active center region were selected for directed evolution, and mutants with significantly improved enzyme activity were screened out, achieving efficient synthesis of D-malic acid. Specifically, the present invention includes the following technical solutions.

[0010] The first aspect of the present invention provides a maleate hydratase, which is a mutant formed by mutations at one or more, preferably two or more, and more preferably three or more sites in the isopropylmalate / citramalate isomerase large subunit LeuC amino acid sequence SEQ ID NO:1 derived from Methanococcus jannaschii: I226, E247, F85, and K294. The maleate hydratase has the function of catalyzing the conversion of maleic acid into D-malic acid.

[0011] Preferably, the above mutation is selected from I226T, E247G, F85S and K294R.

[0012] In this article, in order to highlight the maleate hydratase function of LeuC, it can be referred to as "wild maleate hydratase".

[0013] In one embodiment, the amino acid sequence of the maleate hydratase is SEQ ID NO: 3, which is a mutant formed by I226T and E247G mutations in the amino acid sequence SEQ ID NO: 1 of the wild maleate hydratase, i.e., LeuC (UniprotKB P81291); or the amino acid sequence is SEQ ID NO: 5, which is a mutant formed by the following site mutations in the amino acid sequence SEQ ID NO: 1 of the wild maleate hydratase, i.e., LeuC (UniprotKBP81291): I226T, E247G and F85S; or the amino acid sequence is SEQ ID NO: 7, which is a mutant formed by the following site mutations in the amino acid sequence SEQ ID NO: 1 of the wild maleate hydratase, i.e., LeuC (UniprotKB P81291): I226T, E247G, F85S and K294R.

[0014] The second aspect of the present invention provides a DNA molecule comprising a gene encoding the maleate hydratase.

[0015] In one embodiment, the nucleotide sequence of the gene encoding the maleate hydratase shown in the above amino acid sequence SEQ ID NO:3 is SEQ ID NO:4; the nucleotide sequence of the gene encoding the maleate hydratase shown in the amino acid sequence SEQ ID NO:5 is SEQ ID NO:6; the nucleotide sequence of the gene encoding the maleate hydratase shown in the amino acid sequence SEQ ID NO:7 is SEQ ID NO:8.

[0016] Accordingly, the present invention also provides a recombinant plasmid, which comprises the above DNA molecule. For example, the gene sequence SEQ ID NO: 4, SEQ ID NO: 6 or SEQ ID NO: 8 is cloned on the recombinant plasmid.

[0017] The plasmid vector of the above plasmid can be selected from pMAL series, pGEX series, pET series (such as pET22b, pET24a, pET28a), pQE series, pBAD series, pCAl series, pSH series, pRSFDuet series or other vectors.

[0018] The third aspect of the present invention provides a microorganism transformed with the above-mentioned recombinant plasmid, that is, a transformant (transformant) into which the above-mentioned recombinant plasmid has been transferred, which is an engineered bacterium expressing the above-mentioned maleate hydratase.

[0019] The microbial host of the transformant is selected from Escherichia coli, Bacillus subtilis, Pichia pastoris and Saccharomyces cerevisiae. Preferably, the microbial host is Escherichia coli BL21 (DE3).

[0020] The fourth aspect of the present invention provides use of the maleate hydratase or the microorganism in producing D-malic acid.

[0021] Specifically, the above use is to use maleic acid as a reaction substrate and to produce D-malic acid using the above maleic acid hydratase or the above microorganism for catalysis.

[0022] Optionally, the concentration of the substrate maleic acid in the reaction system may be above 200 g / L, preferably above 250 g / L, for example above 300 g / L.

[0023] In one application, when the microorganism expressing the maleate hydratase is used as a catalyst to catalyze the hydration reaction of the substrate, the microorganism is added to the reaction system in the form of bacteria or cell fragments thereof. The cell fragments are, for example, high-pressure broken bacteria or ultrasonic cell fragments.

[0024] The pH value of the reaction system is pH 7.0-8.0, for example, about pH 7.5.

[0025] In the above reaction system, the reaction temperature is 20-40°C, preferably 25-35°C, for example, room temperature of about 30°C.

[0026] It should be understood that when expressing numerical characteristics in this document, the term "approximately" or "around" means that the number represented may have an error range or floating range of ±10%, ±9%, ±8%, ±7%, ±6% or ±5%.

[0027] The present invention screens out a multifunctional enzyme LeuC having the function of maleate hydratase, and obtains some mutants with significantly improved enzyme activity and still maintaining stereoselectivity after genetic engineering mutation. For example, when the maleate hydratase shown in the amino acid sequence SEQ ID NO:7 catalyzes the hydration reaction of maleic acid, the substrate concentration can be as high as 300 g / L, the product D-malic acid concentration can reach 299.31 g / L, the conversion rate is 99.767%, and the optical purity is 99.8%, which has the feasibility of industrial application. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1It is a schematic diagram of the structure of the plasmid pET24a-leuC constructed by the present invention for expressing the wild enzyme LeuC.

[0029] Figure 2 It is the HPLC detection spectrum of the hydration reaction of maleic acid catalyzed by the maleate hydratase shown in the amino acid sequence SEQ ID NO:7. DETAILED DESCRIPTION

[0030] Extreme environment microorganisms are an important source for the research and development of new enzymes. In order to explore new varieties and unique maleate hydratase or its isozymes, based on bioinformatics data analysis, it is speculated that the large subunit of isopropylmalate / citramalate isomerase LeuC (UniprotKB P81291) from Methanocaldococcusjannaschii collected from the hydrothermal vents on the East Pacific Rise is a multifunctional enzyme that is not only heat-resistant, i.e., has high thermal stability, but also may have the function of maleate hydratase. This speculation was confirmed by experiments. Therefore, LeuC is also a new wild maleate hydratase; experiments also confirmed that it has high stereoselectivity, which is a favorable feature for the synthesis of D-malic acid. However, due to its low enzyme activity, it cannot be used in actual production practice.

[0031] The way to improve the activity of wild enzyme LeuC is to mutate its amino acid sequence and change the properties or microenvironment of its active center and / or pocket channel. Therefore, the inventors performed random mutations by error-prone PCR method, combined with high-throughput screening of mutant libraries, and selected amino acid sites around the active pocket for site-directed saturation mutations based on computer-simulated protein sequence 3D models, through rational analysis and semi-rational design, and obtained some mutants with significantly improved enzyme activity through high-throughput screening, so as to be used for efficient catalysis of maleic acid hydration reaction to produce D-malic acid.

[0032] In this article, the terms "wild (type)", "wild (maleate hydratase) enzyme" have the same meaning, all referring to the multifunctional enzyme LeuC (UniprotKB P81291) with an amino acid sequence of SEQ ID NO: 1. Correspondingly, the terms "mutant", "mutant enzyme", and "maleate hydratase mutant" have the same meaning, all referring to enzymes that still maintain the same catalytic reaction characteristics after amino acid sequence modification of the wild enzyme LeuC, especially enzymes with improved enzyme activity and / or enhanced enzyme activity stability, such as mutants with amino acid sequences of SEQ ID NO: 3, 5 and 7. For the sake of convenience, wild-type maleate hydratase and its mutants may be collectively referred to as "maleate hydratase" herein.

[0033] As used herein, the term "increase (enzyme activity)" means an increase of at least 100% compared to a reference level (e.g., the enzyme activity of LeuC), for example, an increase of at least 1-fold, at least 2-fold, or at least 3-fold, or at least 5-fold, or at least 10-fold, or at least 20-fold compared to a reference level.

[0034] It should be understood that the term "mutation" as used herein includes but is not limited to replacement, deletion, insertion, chemical modification of amino acid residues, preferably a forward mutation, i.e. a mutation that improves enzyme activity. The substitution can be a non-conservative substitution, a conservative substitution, or a combination of a non-conservative substitution and a conservative substitution. "Conservative" amino acid substitution or mutation refers to the interchangeability of residues with similar side chains, and therefore generally includes substitutions of amino acids in the same or similar amino acid definition categories in polypeptides. However, as used herein, if a conservative mutation can be replaced by aliphatic to aliphatic, non-polar to non-polar, polar to polar, acidic to acidic, alkaline to alkaline, aromatic to aromatic, or a restricted residue to a restricted residue, then a conservative mutation does not include a hydrophilic to hydrophilic, hydrophobic to hydrophobic, hydroxyl-containing to hydroxyl-containing or small residue to small residue substitution. It is well known in the art that common cases of conservative substitutions include: mutual substitution between aromatic amino acids F, W, and Y; mutual substitution between hydrophobic amino acids L, I, and V; mutual substitution between polar amino acids Q and N; mutual substitution between basic amino acids K, R, and H; mutual substitution between acidic amino acids D and E; and mutual substitution between hydroxyl amino acids S and T. In addition, A, V, L, or I can be conservatively mutated to another aliphatic residue or another non-polar residue. Exemplary conservative substitutions can be made, for example, according to the following table, in which amino acids belonging to the same partition in the second column can be substituted for each other, and in preferred cases, amino acids in the same row in the third column can be substituted for each other:

[0035]

[0036] "Non-conservative substitution" refers to the substitution or mutation of an amino acid in a polypeptide with an amino acid having significantly different side chain properties. Non-conservative substitutions may use amino acids between, rather than within, the defined groups listed above. In one embodiment, a non-conservative mutation affects (a) the structure of the peptide backbone in the area of ​​the substitution (e.g., proline for glycine), (b) charge or hydrophobicity, or (c) side chain bulk.

[0037] "Deletion" refers to the modification of a polypeptide by removing one or more amino acids from a reference polypeptide. Deletion can include removing 1 or more amino acids, 2 or more amino acids, 5 or more amino acids, 10 or more amino acids, 15 or more amino acids, or 20 or more amino acids, up to 10% of the total amino acids constituting the reference enzyme, while retaining enzymatic activity and / or retaining the improved properties of engineered maleic acid hydratase. Deletion can be directed to the interior and / or ends of a polypeptide. In a plurality of embodiments, deletion can comprise continuous sections or can be discontinuous.

[0038] "Insertion" refers to the modification of a polypeptide by adding one or more amino acids from a reference polypeptide. In some embodiments, the improved engineered maleate hydratase comprises inserting one or more amino acids into a naturally occurring maleate hydratase and inserting one or more amino acids into other improved maleate hydratase polypeptides. The insertion can be inside the polypeptide, or at the carboxyl or amino termini. Insertion as used herein includes fusion proteins as known in the art. The insertion can be a continuous amino acid segment or separated by one or more amino acids in a naturally occurring polypeptide.

[0039] Through multiple rounds of error-prone PCR random mutagenesis, some mutants were screened out, and the effective mutation sites included: F85, I226, E247 and K294. Among them, the enzyme activity and stability of the mutants with the following mutation sites were the best: F85S, I226T, E247G and K294R, and the amino acid sequence of the mutant was SEQ ID NO: 7.

[0040] The amino acid sequence of the maleate hydratase mutant of the present invention is clear, so those skilled in the art can easily obtain its encoding gene, expression cassettes and plasmids containing these genes, and transformants containing the plasmids.

[0041] In order to optimally express maleate hydratase or its mutants in Escherichia coli, which is most commonly used in genetic engineering, the expression genes of these enzymes can be codon-optimized.

[0042] Codon optimization is a kind of technology that can be used for maximizing protein expression in organism by increasing the translation efficiency of gene of interest.Different organisms usually show the special preference for one of some codons of the same amino acid being encoded due to mutation tendency and natural selection.For example, in fast-growing microorganisms such as Escherichia coli, the optimization codon reflects the composition of its genome tRNA library separately.Therefore, in fast-growing microorganisms, the low frequency codon of amino acid can be used for the codon displacement of the same amino acid but high frequency.Therefore, the expression of optimized DNA sequence is improved in fast-growing microorganisms.

[0043] For example, to express maleate hydratase in E. coli, the gene encoding the codon-optimized amino acid sequence SEQ ID NO:7 can be SEQ ID NO:8.

[0044] These genes, expression cassettes, plasmids, and transformants can be obtained by genetic engineering construction methods well known to those skilled in the art.

[0045] The transformant host can be any microorganism suitable for expressing maleate hydratase, including bacteria and fungi. Preferably, the microorganism is Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, or Escherichia coli, preferably Escherichia coli, more preferably Escherichia coli BL21 (DE3).

[0046] When used as a biocatalyst, the maleate hydratase of the present invention can be added to the reaction system in the form of an enzyme or in the form of a bacterial cell. The enzyme forms include free enzymes, immobilized enzymes, including purified enzymes, crude enzymes, fermentation broths, enzymes immobilized on carriers, etc.; the bacterial cells include living bacterial cells, dead bacterial cells, immobilized bacterial cells, etc.

[0047] When microorganisms such as Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae or Escherichia coli are no longer fermented and proliferated, but used for enzyme catalysis, they are themselves a natural immobilized enzyme, and do not need to be crushed or even extracted and purified, and can be used directly as an enzyme preparation for catalytic reactions. Since both the reaction substrate and the reaction product are small molecules, they can easily pass through the biological barrier of the bacteria - the cell membrane, so there is no need to crush the bacteria, which is economically beneficial.

[0048] The present invention is further described in detail below in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present invention and are not used to limit the scope of the present invention.

[0049] Example

[0050] This article involves the addition amount, content and concentration of various substances, and the percentages mentioned here refer to the mass percentages unless otherwise specified.

[0051] Materials and methods

[0052] The whole gene synthesis, primer synthesis and sequencing in the examples were commissioned to Anshengda Biotechnology Co., Ltd.

[0053] The molecular biology experiments in the embodiments include plasmid construction, enzyme digestion, ligation, competent cell preparation, transformation, culture medium preparation, etc., and are mainly carried out with reference to the third edition of Molecular Cloning Experiment Guide (J. Sambrook, DW Russell (USA), translated by Huang Peitang, etc., Science Press, Beijing, 2002). If necessary, the specific experimental conditions can be determined by simple experiments.

[0054] PCR amplification experiments were performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. If necessary, adjustments could be made through simple experiments.

[0055] LB medium: 10g / L tryptone, 5g / L yeast extract, 10g / L sodium chloride, pH 7.2. (LB solid medium plus 20g / L agar powder.)

[0056] TB medium: 24g / L yeast extract, 12g / L tryptone, 16.43g / L K2HPO4.3H2O, 2.31g / L KH2PO4, 5g / L glycerol, pH 7.0-7.5. (TB solid medium plus 20g / L agar powder.)

[0057] HPLC detection conditions of substrate maleic acid and product D-malic acid:

[0058] Agilent high performance liquid chromatograph 1260 (or equivalent); chromatographic column: Agilent SB-Aq, 4.6 mm×250 mm, 5 μm; mobile phase: 0.1% perchloric acid: acetonitrile = 95:5; flow rate: 1.0 mL / min; column temperature: 30°C; wavelength: 214 nm.

[0059] Polarimeter model: Rudolph Autopol V.

[0060] It should be noted that, for the sake of convenience of description, in the embodiments, the strain number, plasmid number, enzyme number, and enzyme encoding gene number may share one number, which is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.

[0061] Example 1: Cloning and codon optimization of wild enzyme leuC

[0062] According to the amino acid sequence SEQ ID NO:1 of the multifunctional enzyme LeuC (UniprotKB P81291) from Methanocaldococcusjannaschii, the coding gene SEQ ID NO:2 was designed through codon expression optimization based on E. coli preference. Anshengda Biotechnology Co., Ltd. was commissioned to synthesize the whole gene sequence, and restriction endonuclease sites NdeI and XhoI were designed at both ends of the gene. The gene was subcloned into the pET24a plasmid to obtain the expression vector pET24a-leuC expressing the wild enzyme LeuC (see Figure 1 ).

[0063] The following primer pairs were used for amplification of the LeuC gene:

[0064] Forward primer leuC-F:

[0065] CATATGATGGGCATGACTATCGTGGAAAAAATCCTG (SEQ ID NO: 9),

[0066] Reverse primer leuC-R:

[0067] CTCGAGCAGGTCGCGCGGGTCGACCAGTTCG (SEQ ID NO: 10).

[0068] PCR amplified a fragment of about 1.27 kb. The PCR reaction system included: 0.3 μM each of forward primer and reverse primer, 50 ng of gene template, 1× KOD Neo plus buffer, 0.2 mM dNTP, 1.5 mM MgSO4, KOD neo plus 1 U, and double distilled water to make the total system 50 μl.

[0069] PCR conditions: 94°C, 2 min; 98°C for 10 s, 55°C for 30 s, 68°C for 30 s, repeated for 30 cycles; 68°C for 10 min.

[0070] After the PCR reaction, the fragments were identified by agarose gel electrophoresis and recovered by gel recovery kit.

[0071] The plasmid vector pET24a and the leuC fragment were double-digested with NdeI and XhoI, respectively. The digestion system was: 37 μl of pET24a plasmid (or 37 μl of leuC fragment), 5 μl of 10× buffer, 1.5 μl of NdeI, and 1.5 μl of XhoI.

[0072] After the enzyme digestion, the fragments were recovered using a gel extraction kit, wherein the PCR enzyme KOD Neo plus was purchased from Toyobo (Shanghai) Biotechnology Co., Ltd., and the gel extraction kit OMEGA Gel Extraction Kit D2500 was purchased from Guangzhou Feiyang Biotechnology Co., Ltd.

[0073] The recombinant plasmid pET24a-leuC was transformed into an expression host such as Escherichia coli BL21 (DE3) competent cells (Invitrogen) by electrotransformation to obtain recombinant Escherichia coli expressing wild-type maleate hydratase.

[0074] The recombinant plasmid pET24a-leuC can also be transformed into other hosts such as Pichia pastoris, Bacillus subtilis, etc. to express wild-type maleate hydratase LeuC.

[0075] Example 2: Construction of a leuC random mutation library by error-prone PCR

[0076] The leuC random mutation library was constructed by error-prone PCR.

[0077] Using the gene sequence SEQ ID NO: 2 as a template, error-prone PCR primer pairs were designed as follows.

[0078] Forward primer MleuC-F:

[0079] ATGGGCATGACTATCGTGGAAAAAATCCTG (SEQ ID NO: 11),

[0080] Reverse primer MleuC-R:

[0081] CAGGTCGCGCGGGTCGACCAGTTCG (SEQ ID NO: 12).

[0082] The 50 μL error-prone PCR reaction system includes: 50 ng plasmid template pET24a-leuC, 30 pmol of a pair of primers MleuC-F and MleuC-R, 1X Taqbuffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, and 2.5 units of Taq enzyme (Fermentas).

[0083] PCR reaction conditions were: 95°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min / kbp; 30 cycles; 72°C for 10 min.

[0084] The 2.0 kb random mutation fragment was recovered from the gel as a large primer, and MegaPrimer PCR was performed using KOD-plus DNA polymerase: 94°C for 5 min; 98°C for 10 s, 60°C for 30 s, 68°C for 2 min / kbp, 25 cycles; 68°C for 10 min. The plasmid template was digested with DpnI and electroporated into E. coli BL21 (DE3), obtaining a random mutant library of more than 8,000 clones.

[0085] Example 3: High-throughput screening of mutant libraries

[0086] Transformants from the mutant library were selected and inoculated into a 96-well deep-well culture plate containing 700 μL of LB medium containing 100 μg / mL kanamycin. After culturing at 37°C for 6 hours, IPTG was added at a final concentration of 0.1 mM, and the temperature was lowered to 25°C for overnight culture. Centrifuge at 5000 rpm for 10 minutes, discard the supernatant, freeze at -70°C for 1 hour, and thaw at room temperature for 30 minutes. Add 200 μL of 50 mM Tris·HCl (pH 7.5) to resuspend the cells as an enzyme solution for determining the activity of maleate hydratase.

[0087] The enzyme activity assay reaction system includes: 2% v / v bacterial concentration of whole bacteria or broken cell crude enzyme solution, 100 mM maleic acid, 50 mM Tris·HCl, pH adjusted to 7.5, and reaction at 25°C.

[0088] Definition of enzyme activity unit: Under the conditions of pH 7.5 and 25°C, the amount of enzyme required to catalyze the substrate maleic acid to produce 1 micromole (μmol) of D-malic acid per minute is defined as 1 unit (U).

[0089] The determination and screening conditions of high enzyme activity mutants are described as follows.

[0090] Substrate reaction solution: add 100 mM maleic acid and adjust the pH with 50 mM Tris·HCl.

[0091] Termination solution: 1M NaOH solution.

[0092] 80 μL of enzyme solution was added to 80 μL of substrate reaction solution, reacted at 25°C for 2 h, 40 μL of termination reaction solution was added, and then centrifuged at 5000 rpm for 10 min. The supernatant was collected by centrifugation, and the D-malic acid production was detected by HPLC, and the enzyme activity was calculated.

[0093] About 8,000 mutant clones were screened, and strains with significantly improved enzyme activity were selected. Plasmids were extracted, and nucleic acid sequencing was commissioned to Anshengda Biotechnology Co., Ltd. The maleate hydratase-related fragments in the genome were compared with SEQ ID NO: 2 to determine the amino acid mutation sites. The strains with the highest activity improvement were used as the starting strains for the next round of mutant library construction.

[0094] Sequencing revealed that amino acid substitutions at some sites in the wild enzyme leuC amino acid sequence SEQ ID NO: 1 would result in significant changes in the enzyme activity of the mutant. Among the mutants with significantly improved enzyme activity, sites with higher mutation frequencies included Ile (I) at position 226, Glu (E) at position 247, Phe (F) at position 85, and Lys (K) at position 294, suggesting that these sites are located in important parts of the enzyme activity pocket.

[0095] Example 4: Saturation mutation of some sites

[0096] For the four sites F85, I226, E247 and K294 in the wild enzyme leuC amino acid sequence SEQ ID NO: 1, the wild enzyme leuC gene was subjected to site-directed saturation mutation using primer PCR mutagenesis technology. Taking the mutation of I226 as an example, the error-prone PCR primer pair was designed as follows.

[0097] Forward primer LeuC226-F: CGGTAAAACGGGTNNKATCGAGCCGGACG (SEQ ID NO: 13),

[0098] Reverse primer LeuC226-R: ACCCGTTTTACCGCCCATCTCGATTGC (SEQ ID NO: 14).

[0099] The 50 μL error-prone PCR reaction system included: 50 ng plasmid template pET24a-leuC, 30 pmol of a pair of primers LeuC226-F and LeuC226-R, 1X Taq buffer, 0.2 mM dGTP, 0.2 mM dATP, 1 mM dCTP, 1 mM dTTP, 7 mM MgCl2, (0 mM, 0.05 mM, 0.1 mM, 0.15 mM, 0.2 mM) MnCl2, and 2.5 units of Taq enzyme (Fermentas).

[0100] PCR reaction conditions were: 95°C for 5 min; 94°C for 30 s, 55°C for 30 s, 72°C for 2 min / kbp; 30 cycles; 72°C for 10 min.

[0101] The 2.0 kb random mutation fragment was recovered from the gel as a large primer, and MegaPrimer PCR was performed using KOD-plus DNA polymerase: 94°C for 5 min; 98°C for 10 s, 60°C for 30 s, 68°C for 2 min / kbp, 25 cycles; 68°C for 10 min. The plasmid template was digested with DpnI and electroporated into E. coli BL21 (DE3), obtaining a random mutant library of more than 130 clones.

[0102] The enzyme activity of each mutant was detected according to the method described in Example 3. Most mutants with little or no improvement in enzyme activity were discarded; mutant strains with enzyme activity improved by more than 50% were selected, plasmids were extracted, and through gene sequencing and amino acid site comparison, it was found that the I226T mutation could increase the enzyme activity of the wild enzyme leuC by nearly 4 times, which was the best result among the forward mutations.

[0103] Referring to the above method, saturation mutations were performed on F85, E247 and K294 sites respectively, and the forward mutations of these sites were superimposed and combined with the I226T mutation to screen a mutant library with significantly improved enzyme activity. The sequencing results of the main forward mutation mutants are shown in Table 1 below.

[0104] Table 1. Catalytic maleate conversion enzyme activity of various leuC mutants (enzyme specific activity: the ratio of the fermentation activity (U / ml) of the wild enzyme leuC to the bacterial concentration OD (OD / ml) is 100%)

[0105] Strain / enzyme number Amino acid mutation Amino acid sequence Relative activity % euC none SEQ ID NO:1 100 leuC-20-B9 I226T、E247G SEQ ID NO:3 1081 leuC-57-H3 I226T, E247G, F85S SEQ ID NO:5 5931 leuC-85-C12 I226T, E247G, F85S, K294R SEQ ID NO:7 8640

[0106] The results in Table 1 show that these four sites are important sites that affect enzyme activity; after multiple rounds of combined mutations, the maleate hydratase activity of the screened mutant leuC-85-C12 (I226T, E247G, F85S, K294R) was more than 85 times higher than that of the wild-type leuC, while the enzyme activity of the mutant leuC-20-B9 (I226T, E247G) was nearly 10 times higher than that of the wild-type leuC, and the enzyme activity of the mutant leuC-57-H3 (I226T, E247G, F85S) was more than 58 times higher than that of the wild-type leuC. The amino acid sequence of leuC-85-C12 is shown in SEQ ID NO:7, and the coding gene sequence is shown in SEQ ID NO:8.

[0107] Example 5: Fermentation and catalytic reaction of engineered strains

[0108] The obtained highly active strain leuC-85-C12 was activated on LB plates, single clones were selected, inoculated into 5ml LB medium, and cultured at 37℃; inoculated into a 1000ml shake flask containing 100ml TB medium at a ratio of 1% v / v, cultured at 37℃, 220rpm for 4-6h, and when the OD600 value reached 1.2-1.5, 0.2mM IPTG was added for induction; then the temperature was lowered to 25℃ and cultured for 10-16h, the bacteria were obtained by centrifugation, and frozen at -80℃ for 24 nights for use. (50μg / ml kanamycin was added during the strain culture)

[0109] The reaction system was 200 ml, the substrate maleic acid concentration was 300 g / L, the enzyme addition amount was 10% v / v of the bacterial concentration, the temperature was controlled at 25°C, 200 rpm, pH 7.5, and the reaction was performed for 5 hours. The detected product D-malic acid could reach 299.31 g / L, the conversion rate was 99.767%, and the optical purity ee value was 99.8%.

[0110] The above experiments show that LeuC (UniprotKB P81291) has the function of maleate hydratase, and the mutants SEQ ID NO: 3, 5 and 7 constructed on this basis have significantly improved enzyme activities in catalyzing the hydration reaction of maleic acid to produce D-malic acid, the substrate concentration can reach more than 300 g / L, and the optical purity ee value of the product exceeds 99%, showing good prospects for industrial application.

[0111] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any changes or substitutions that can be easily conceived by any technician familiar with the technical field within the technical scope disclosed by the present invention should be covered within the protection scope of the present invention.

Claims

1. A maleate hydratase, characterized in that The present invention is a mutant formed by mutations at one or more, preferably two or more, and more preferably three or more sites in the amino acid sequence SEQ ID NO:1 of LeuC (UniprotKB P81291) derived from Methanococcus jannaschii: F85, I226, E247, and K294. The maleate hydratase has the function of catalyzing the conversion of maleic acid into D-malic acid.

2. The maleic acid hydratase according to claim 1, wherein The mutation is selected from F85S, I226T, E247G and K294R.

3. The maleic acid hydratase according to claim 2, wherein The amino acid sequence is SEQ ID NO:3, SEQ ID NO:5 or SEQ ID NO:

7.

4. A DNA molecule comprising a gene encoding the maleate hydratase according to claim 3.

5. The DNA molecule according to claim 4, characterized in that The nucleotide sequence of the gene encoding the maleate hydratase shown in the amino acid sequence SEQ ID NO:3 is SEQ ID NO:4; the nucleotide sequence of the gene encoding the maleate hydratase shown in the amino acid sequence SEQ ID NO:5 is SEQ ID NO:6; and the nucleotide sequence of the gene encoding the maleate hydratase shown in the amino acid sequence SEQ ID NO:7 is SEQ ID NO:

8. A recombinant plasmid comprising the DNA molecule according to claim 4 .

7. A microorganism transformed with the recombinant plasmid as claimed in claim 6.

8. The microorganism according to claim 7, characterized in that The microbial host is selected from Escherichia coli, Bacillus subtilis, Pichia pastoris and Saccharomyces cerevisiae, preferably Escherichia coli BL21 (DE3).

9. Use of the maleate hydratase according to claim 1 or the microorganism according to claim 7 in producing D-malic acid.

10. The use according to claim 9, characterized in that Using maleic acid as a reaction substrate and using the maleic acid hydratase according to claim 3 or the microorganism according to claim 7 to catalyze the production of D-malic acid.

Images