Engineered cell-derived vesicle entrapped tumor immunotherapy nano vaccine and application thereof

Abstract

The invention discloses an engineered cell-derived vesicle entrapped tumor immunotherapy nano vaccine and application thereof, and belongs to the technical field of biological and medical new dosage forms and preparations. The nano vaccine is obtained by carrying out PEG (Polyethylene Glycol) modification on a tumor cell membrane anchored with ANX5 protein on the surface and then reacting with a photosensitizer. According to the nano vaccine, ANX5 protein surface anchoring is carried out on a cell membrane drug delivery carrier through a gene engineering technology, so that the traditional treatment immunogenicity is modified, and a polymer chain which is broken through reactive oxygen response in a tumor environment modified by material engineering is further combined to shield a carrier surface antigen in in-vivo circulation; the effectiveness and the in-vivo circulation safety of the nano vaccine are improved. The nano vaccine can improve the traditional cytotoxic chemotherapeutic drugs and photodynamic therapy, and further can be efficiently applied to cancer treatment.

Description

Technical Field

[0001] The present invention relates to the field of new biological and medical dosage forms and preparation technology, and in particular to a tumor immunotherapy nano vaccine encapsulated by an engineered cell-derived vesicle and its application. Background Art

[0002] In recent years, with the development of chimeric antigen receptor T cell therapy and immune checkpoint inhibitors, immunotherapy has shown great potential in cancer treatment. Cancer vaccines, i.e., active cancer immunotherapy, have also been intensively studied with the progress in the identification of tumor-specific neoantigens. However, in most cases, cancer vaccines are only effective in cancer prevention and are usually administered to healthy people. Although great efforts have been made to develop therapeutic cancer vaccines, it remains a major challenge to initiate a strong anti-tumor cytotoxic T cell immune response in patients who already have cancer, mainly due to the heterogeneity within and between tumors, as well as the immunosuppressive tumor microenvironment (TME).

[0003] Autologous tumor cells are the best source for vaccination because they display the full spectrum of TAEs and are able to trigger a global immune response, thus outperforming traditional vaccines that contain limited antigenic epitopes. The in vitro preparation of autologous tumor cell vaccines is complex and requires sufficient tumor samples, which limits the application of this technology to certain tumor types or stages. Therefore, in situ preparation of autologous tumor cell vaccines in vivo is a potentially attractive alternative that can effectively target individual patients' tumors and provide personalized vaccines.

[0004] Traditional therapies such as chemotherapeutic drugs (e.g., doxorubicin) and photodynamic therapy (PDT) can induce immunogenic cell death (ICD) of tumor cells, which is characterized by exposure of calreticulin (CRT) on the tumor cell surface and release of DAMPs such as HMGB1, ATP, and tumor DNA. These DAMPs help activate anti-tumor T cells, especially cytotoxic CD8 + T cells. It is a feasible solution to prepare in situ cancer vaccines by utilizing the immunogenicity generated by this traditional therapy. However, when these traditional treatments induce a large number of cell apoptosis, the outer layer of the cell membrane of the apoptotic cells exposes phosphatidylserine (PS) as a major "eat me" signal, which is transmitted to phagocytes such as macrophages, triggering the release of immunosuppressive factors, which inhibit inflammation and prevent the maturation of antigen-presenting dendritic cells (DCs) and inhibit subsequent T cell activation, resulting in an immunosuppressive microenvironment, thus hindering the effect of in situ vaccines.

[0005] By delivering drugs through specific nanomaterials, the tumor killing effect of traditional drugs can be enhanced, as well as the immunogenicity and biosafety can be improved, thereby more effectively activating immune pathways and the potential for cancer immunotherapy. The application of cell membranes as drug carriers in cancer treatment is a cutting-edge and active research field. In recent years, the function of cell membrane carriers can be flexibly improved by modifying cell membranes through genetic engineering and displaying proteins on the cell membrane surface. However, there are still some problems with cell membranes as carriers, such as the lack of specific targeting of tumor tissues, and the exposure of surface proteins to the in vivo environment may cause immunity of normal organs and tissues, resulting in adverse reactions.

[0006] Annexin V (ANX5) protein can strongly bind to PS exposed by apoptotic cells, thus blocking the transmission of PS signals and the effect on phagocytes. Therefore, adding Annexin V to the drug system may increase the immunogenicity of killed tumor cells by blocking PS. However, in addition to apoptotic cells, PS is also exposed to some healthy cells, such as myoblasts, mast cells, and megakaryocytes. Therefore, the scheme of achieving in situ immunity by blocking PS by Annexin V still needs to improve its biosafety. Summary of the invention

[0007] The purpose of the present invention is to provide an engineered cell-derived vesicle-encapsulated tumor immunotherapy nanovaccine and its application to solve the problems existing in the above-mentioned prior art. The nanovaccine significantly improves the killing effect on tumors and has high biosafety.

[0008] To achieve the above object, the present invention provides the following solutions:

[0009] The present invention provides a tumor immunotherapy nano vaccine encapsulated by an engineered cell-derived vesicle. The nano vaccine is obtained by PEG-modifying a tumor cell membrane with an ANX5 protein anchored on its surface and then reacting with a photosensitizer.

[0010] Optionally, the nano vaccine is prepared by the following method:

[0011] The coding gene of ANX5 protein is connected to a lentiviral expression vector to construct a recombinant lentiviral expression plasmid; the recombinant lentiviral expression plasmid is then transfected into tumor cells to screen for a stable cell line overexpressing ANX5;

[0012] Introducing the N3 group into the cell outer membrane of the ANX5 overexpressing stable cell line, extracting the cell membrane, and combining the cell membrane with PEG 5000-TK-DBCO to obtain ANX5-anchored PEG camouflaged nanoparticles through a click chemistry reaction;

[0013] ANX5-anchored PEG camouflaged nanoparticles and photosensitizer nanoparticles were ultrasonically reacted and extruded through a polycarbonate membrane to prepare engineered cell-derived vesicle-encapsulated tumor immunotherapy nanovaccines.

[0014] Optionally, the accession number of the gene encoding the ANX5 protein on NCBI is NM_009673.2, and the protein accession number is NP_033803.1; and / or the PEG includes PEG5000.

[0015] Optionally, the ANX5-overexpressing stable cell line is co-incubated with Ac4GalNAz to introduce the N3 group into the cell outer membrane of the ANX5-overexpressing stable cell line. The molar ratio of the N3 group in the cell membrane to the DBCO in the PEG 5000-TK-DBCO is 1:1; and the click chemistry reaction time is 10-12 hours.

[0016] Optionally, the mass volume ratio of the ANX5-anchored PEG camouflage nanoparticles and the photosensitizer nanoparticles is (1-5) mg:1 mL.

[0017] The preparation method of the photosensitizer nanoparticles comprises the following steps: dissolving the photosensitizer molecule and DSPE-PEG2000 in tetrahydrofuran, stirring, injecting into deionized water, removing the tetrahydrofuran, and centrifuging to obtain the photosensitizer nanoparticles. The ratio of the photosensitizer molecule, DSPE-PEG2000, tetrahydrofuran and deionized water is 1 mg: 4 mg: 600 μL: 6 mL.

[0018] Optionally, the tumor cell membrane comprises a breast cancer cell membrane.

[0019] The present invention also provides the use of the nano vaccine in any of the following:

[0020] (1) Application in the preparation of tumor immunotherapy products;

[0021] (2) Application in the preparation of products for in situ inhibition of tumor proliferation and growth;

[0022] (3) Application in the preparation of products for activating immune cell functions.

[0023] Optionally, the tumor comprises breast cancer.

[0024] The present invention also provides a product, comprising the nano vaccine and pharmaceutically acceptable adjuvants and carriers, wherein the product is used for inhibiting tumor proliferation and growth in situ and / or activating immune cell function.

[0025] Optionally, the tumor comprises breast cancer.

[0026] The present invention discloses the following technical effects:

[0027] The present invention discloses an engineered cell-derived vesicle-encapsulated tumor immunotherapy nano vaccine, which is obtained by PEG-modifying the tumor cell membrane with ANX5 protein anchored on the surface and then reacting with a photosensitizer. The preparation method of the nano vaccine is simple and efficient, and the genetic engineering modification and surface protein camouflage of the cell-derived nano vaccine are simultaneously achieved. In addition, the nano vaccine can be used as a carrier of PDT or chemotherapy drugs to achieve specific targeted delivery and immunotherapy of drugs, and then applied to cancer treatment.

[0028] Traditional chemotherapy and photodynamic therapy molecules work by directly killing cells. The new nano-vaccine obtained by the present invention can improve the targeted delivery and enrichment of therapeutic molecules by using the homologous targeting of the cell membrane, thereby improving the killing effect; at the same time, by anchoring the ANX5 protein on the surface to block the PS eversion of apoptotic cells to achieve in situ killing of tumor cells, the immunogenicity is improved, thereby activating the body's immune response and further killing tumor cells in the lesion. In addition, by modifying the cell membrane with a long-chain PEG that responds to ROS cutting, the cell membrane surface protein can be hidden, preventing the cell membrane carrier from non-specifically targeting and killing non-tumor cells in the circulation. The high ROS level in the tumor microenvironment and the ROS generated by PDT treatment are used to cut the long-chain PEG, exposing the ANX5 protein. This modification reduces the side effects of the nano-vaccine and improves biosafety. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 Schematic diagram of the process of constructing breast cancer 4T1 cells engineered to express Annexin V (ANX5);

[0031] Figure 2 This is a confocal microscopy image of the ANX5 membrane localization expression of 4T1-ANX5;

[0032] Figure 3 The results of ANX5 expression in 4T1-ANX5 were detected by flow cytometry;

[0033] Figure 4 Western blotting was used to detect the expression level of ANX5 in total protein (CL) and cell membrane (Mem) proteins of 4T1-ANX5 cells and control cells;

[0034] Figure 5 This is a confocal microscopy image of the binding of DBCO and N3 detected by FITC-DBCO after the N3 group was inserted into the 4T1-ANX5 cell membrane;

[0035] Figure 6 is the chemical structure of compound 1;

[0036] Figure 7 For compound 1 1 H NMR spectrum;

[0037] Figure 8 For compound 1 13 C NMR spectroscopy;

[0038] Fig. 9 is the chemical structure of compound 2;

[0039] Fig.10 For compound 2 1 H NMR spectrum;

[0040] Fig.11 For compound 2 13 C NMR spectroscopy;

[0041] Fig.12 is the chemical structure of compound 3;

[0042] Fig.13 For compound 3 1 H NMR spectrum;

[0043] Fig.14 For compound 3 13 C NMR spectroscopy;

[0044] Fig.15 The morphology of NT@M, NT@ANX5, and NT@ANX5-P nanovaccines observed by transmission electron microscopy;

[0045] Fig.16 The particle size distribution of NT, NT@M, NT@ANX5, and NT@ANX5-P nanovaccines;

[0046] Fig.17 is the Zeta potential of NT, NT@M, NT@ANX5, and NT@ANX5-P nanovaccines;

[0047] Fig.18 NT, NT@M, NT@ANX5, and NT@ANX5-P were placed in water for 7 days, and the particle size was measured at different time points to analyze the stability of the nanoparticles;

[0048] Fig.19Flow cytometric detection and statistical graphs to verify the correlation between ROS response breakage of TK bonds on the surface of nanovaccines and ANX5 exposure in vitro;

[0049] Fig. 20 Confocal microscopy was used to capture the localization of the nanovaccine in 4T1 cells after incubation for different time periods;

[0050] Fig.21 Fluorescence quantitative graph of nanovaccine accumulation in 4T1 cells after incubation for different time periods;

[0051] Fig. 22 Flow cytometry was used to analyze the uptake of nanovaccines in 4T1 cells;

[0052] Fig.23 The results of CCK-8 analysis show the survival of 4T1 cells induced by light therapy after treatment with different nanovaccines;

[0053] Fig.24 Representative CLSM images of living cells stained with Calcein-AM;

[0054] Fig.25 Flow cytometry was used to analyze the phagocytosis of apoptotic 4T1 cells by BMDM;

[0055] Fig.26 Flow cytometry was used to analyze the level of BMDM polarization into M2 macrophages;

[0056] Fig. 27 ELISA was used to analyze the level of immunosuppressive factor TGF-β secreted by BMDM cells;

[0057] Fig.28 ELISA was used to analyze the level of IL-β secreted by BMDM cells;

[0058] Fig.29 To analyze the localization of ecto-CRT on the surface of 4T1 cells after nanovaccine treatment by immunofluorescence;

[0059] Fig.30 Western blot analysis of the levels of HMGB1 and HSP70 in the cell supernatant after nanovaccine treatment;

[0060] Fig.31 It is a tumor growth curve;

[0061] Fig.32 This is a picture of the final size of the tumor;

[0062] Fig.33 The flow cytometric analysis and statistical graph of DC maturation in mouse draining lymph node tumours.

[0063] Fig.34 Flow cytometry detection graph and statistical graph for analyzing T cell infiltration in mouse tumor tissues by flow cytometry;

[0064] Fig.35 HE staining of major organs of healthy mice after nanovaccine treatment. DETAILED DESCRIPTION

[0065] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0066] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0067] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0068] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0069] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0070] The present invention proposes a novel cell-derived nanovesicle that combines in situ antigen generation induced by photodynamic therapy (PDT) or chemotherapy drugs with phosphatidylserine (PS) blocking to enhance antigen-specific immunization and overcome immune tolerance. (1) First, the present invention constructs tumor cells with surface-anchored ANX5 by engineering modification. (2) PEG5000 with a TK bond that can respond to cleavage is inserted into the cell membrane surface through a bioorthogonal reaction to shield ANX5 on the cell membrane and prevent it from nonspecifically binding to normal cells, thereby minimizing the off-target accumulation of nanoparticles and ensuring safety after intravenous injection. (3) The surface-modified cell vesicles are extracted and used to encapsulate photosensitizer molecules or chemotherapy drug nanoparticles to obtain the final therapeutic nanovaccine. (4) After the nanoparticles aggregate at the tumor site, the ROS in the tumor microenvironment and the ROS generated by drug treatment jointly trigger the cleavage of the TK bond and the shedding of PEG, exposing the surface ANX5. (5) Drug-induced cytotoxicity transforms tumor cells into a reservoir of tumor-specific antigens. At the same time, ANX5 on the cell membrane selectively blocks PS on the surface of apoptotic cells, inhibiting the early phagocytic clearance of apoptotic tumor cells, thereby enhancing the presentation of tumor antigens. Apoptotic cells blocked by photosensitizers will further undergo secondary necrosis, a highly immunogenic form of cell death that can generate damage-associated molecular patterns (DAMPs), further enhancing the immune response. (6) In mouse tumor models, these nanovesicles not only inhibited the growth of primary and metastatic tumors, but also prolonged overall survival and induced lasting immune protection by restoring strong anti-tumor immunity. In addition, the nanovesicles also reversed the immunosuppressive immune microenvironment and reprogrammed macrophage function, further amplifying the immunogenic effects induced by PDT or chemotherapy drugs. By combining the effects of traditional treatments (PDT or chemotherapy drugs) with genetically engineered membrane vesicles, this multifunctional nanoplatform significantly enhanced the efficacy of personalized in situ cancer vaccines.

[0071] Example 1 Preparation of an engineered cell-derived vesicle-encapsulated tumor immunotherapy nanovaccine (ANX5 nanovaccine)

[0072] 1. ANX5 anchors the cell membrane

[0073] The construction process of breast cancer 4T1 cells engineered to express Annexin V (ANX5), such as Figure 1 As shown, the specific steps are:

[0074] First, a recombinant lentivirus (LV)-ANX5 expression plasmid (pCDH-CMV-ANX5) was constructed to express full-length ANX5 (Gene ID: 11747) on the cell membrane. The C-terminus of ANX5 was linked to the N-terminus of the PDGFR transmembrane domain, and an mCherry tag was inserted into the vector to analyze positive ANX5 overexpressing cells. Next, the LV-ANX5 plasmid was mixed with vesicular stomatitis virus G protein (VSVG) and cytomegalovirus (CMV) packaging plasmid at a mass ratio of 1:3:4 and transfected into HEK 293T cells using PEI transfection reagent. The cells were replaced with fresh medium after incubation for 10 hours. After 48 hours of incubation, the medium containing the lentivirus was collected, and the collected medium was combined and centrifuged at 300g for 10 minutes to remove cell debris.

[0075] To construct a stable cell line overexpressing ANX5, 2 mL of infection medium containing LV-ANX5 and 0.5 mL of fresh medium were added to the target 4T1 cells cultured in 6-well plates. After 24 h of incubation, the virus-containing medium was replaced with fresh medium. After the cells were fluorescently labeled, ANX5-overexpressing stable cells (4T1-ANX5) were selected by adding 2 μg / mL of puromycin, and then monoclonal cells were collected and expanded. The established ANX5-overexpressing cells were maintained in complete medium containing 1 to 2 μg / mL puromycin. ANX5-overexpressing cells were evaluated by flow cytometry and confocal laser scanning microscopy (CLSM).

[0076] The results are as follows Figure 2-Figure 3 As shown, the results showed that 4T1 cells stably expressing ANX5 were successfully constructed.

[0077] Western blotting was used to detect the expression level of ANX5 in total protein and cell membrane proteins of 4T1-ANX5 cells and control cells. Figure 4 As shown, the detection results of total cell lysate samples (CL) and cell membrane samples (Mem) showed that the total amount and cell membrane localization amount of ANX5 in 4T1-ANX5 cells were significantly higher than those in 4T1 cells.

[0078] The nucleotide sequence of the PDGFR transmembrane domain (SEQ ID NO: 1) is: AATGCTGTGG GCCAGGACAC GCAGGAGGTCATCGTGGTGCCACACTCCTTGCCCTTTAAGGTGGTGGTGATCTCAGCCATCCTGGCCCTGGTGGTGCTCACCATCATCTC CCTTATCATCCTCATCATGCTTTGGCAGAAGAAGCCACGTTAGGCGGCCG.

[0079] 2. ANX5 cell membrane surface modification

[0080] To obtain DSPE-PEG-modified disguised ANX5 nanocarriers, 4T1-ANX5 cells were incubated with 10 µM Ac4GalNAz to introduce the N3 group into the glycoconjugate on the outer membrane. After obtaining cells that stably expressed membrane-anchored ANX5 and embedded the N3 group, the cell membrane was extracted using a hypotonic lysis buffer and high-speed centrifugation method. The cell membrane vesicles containing the N3 group were combined with PEG 5000-TK-DBCO (5 mg / mL) (at a molar ratio of N3 to DBCO of 1:1), and ANX5-anchored PEG-disguised nanoparticles (ANX5-P) were formed between the N3 and DBCO functional groups through a click chemistry reaction. The reaction time was 12 hours. Afterwards, the excess PEG 5000-TK-DBCO was removed by ultrafiltration.

[0081] Confocal microscopy detection of the binding of DBCO and N3 using FITC-DBCO, see Figure 5 The results showed that 4T1 cells were co-incubated with Ac4GalNAz to achieve N3 insertion in the cell membrane. FITC-DBCO was then used to treat the cells, which combined with N3 on the cell membrane through a click chemistry reaction. Under a microscope, the green fluorescence of FITC was observed on the cell membrane, while no fluorescent labeling was observed in cells treated with PBS.

[0082] 3. Preparation of ANX5 Nanovaccine

[0083] Preparation of photosensitizer drug molecule (NTPN):

[0084] (1) Bromoaniline (2 g, 11.63 mmol) and 1-methylnaphthol (3.3 g, 23.25 mmol) were dissolved in toluene (30 mL). Subsequently, tri(dibenzylideneacetone)dipalladium (212.96 mg, 0.23 mmol) and tributylphosphine tetrafluoroborate (168 mg, 0.58 mmol) were added, and the system was heated to 110 °C under an argon atmosphere for overnight reaction. After the reaction was completed, the mixture was cooled to room temperature and ultrapure water (30 mL) was added to terminate the reaction. The resulting two-phase mixture was extracted three times with dichloromethane (CH2Cl2). The combined organic phases were dried over anhydrous magnesium sulfate (MgSO4) and concentrated under reduced pressure. The crude product was purified by silica gel column chromatography using dichloromethane / n-hexane (volume ratio 1:4) as the elution solvent to obtain compound 1, whose chemical structure is as follows: Figure 6 shown.

[0085] Compound 1 in CDCl3 1 H NMR spectrum, 13 C NMR spectrum Figure 7 and Figure 8 . 1 H NMR (400 MHz, Chloroform-d) δ 8.00 (d, J = 7.4 Hz, 2H), 7.88 (d, J = 7.9 Hz, 2H), 7.71 (d,J = 8.2 Hz, 2H), 7.47 (t, J = 6.9 Hz, 2H), 7.41 – 7.32 (m, 4H), 7.24 (d, J =6.2 Hz, 2H), 7.21 – 7.16 (m, 2H), 6.59 – 6.53 (m, 2H). 13 C NMR (101 MHz, Chloroform-d) δ 144.29, 138.08, 134.74, 132.17, 128.63, 126.30, 126.02,125.95, 123.90, 121.94, 118.45, 117.14, 111.99).

[0086] (2) Compound 1 (2 g, 4.73 mmol) and 4,4,4',4',5,5,5',5'-octamethyl-2,2'-bi(1,3,2-dioxaborolane) (3 g, 11.82 mmol) were dissolved in tetrahydrofuran (THF, 30 mL). Subsequently, [1,1'-bis(diphenylphosphino)ferrocene]dichloropalladium dichloromethane complex (127.47 mg, 0.16 mmol) and potassium acetate (1.96 g, 20.01 mmol) were added, and the mixture was heated to 65 °C under an argon atmosphere for overnight reaction. After the reaction was completed, the mixture was cooled to room temperature and ultrapure water (30 mL) was added to terminate the reaction. The resulting mixture was extracted three times with dichloromethane (CH2Cl2). The combined organic phase was dried over anhydrous MgSO4 and concentrated. The crude product was purified by silica gel column chromatography using dichloromethane / n-hexane (volume ratio 1:1) as the elution solvent to obtain compound 2 (yield: 34%). The chemical structure of compound 2 is shown in Fig. 9 .

[0087] Compound 2 in CDCl3 at 298 K 1 H NMR spectrum, 13 C NMR spectrum Fig.10 and Fig.11 . 1 H NMR (400MHz, Chloroform-d) δ 8.01 (d, J = 8.5 Hz, 2H), 7.87 (d, J = 8.2 Hz, 2H), 7.71(d, J = 8.1 Hz, 2H), 7.58 – 7.50 (m, 2H), 7.45 (t, J = 7.5 Hz, 2H), 7.34 (q,J = 7.3 Hz, 4H), 7.27 (d, J = 7.3 Hz, 2H), 6.63 (d, J = 8.1 Hz, 2H), 1.30 (s,12H). 13 C NMR (101 MHz, Chloroform-d) δ 152.82, 144.10, 135.80, 135.21, 130.32,128.53, 126.44, 126.17, 126.09, 125.36, 124.42, 118.54, 83.44, 24.89).

[0088] (3) Compound 2 (1 g, 2.12 mmol) and 4,9-dibromonaphthothiadiazole (243.11 mg, 0.71 mmol) were dissolved in toluene (20 mL). Subsequently, potassium carbonate (314 mg, 2.27 mmol) dissolved in 908 μL of water was added. Then, tetrakis(triphenylphosphine)palladium(0) (27.08 mg, 0.023 mmol) was added, and the mixture was heated to 110°C under an argon atmosphere to react overnight. After the reaction was completed, the mixture was cooled to room temperature and ultrapure water (30 mL) was added to terminate the reaction. The resulting mixture was extracted three times with dichloromethane (CH2Cl2). The combined organic phases were dried over MgSO4 and concentrated. The crude product was purified by silica gel column chromatography using dichloromethane / n-hexane (volume ratio 2:1) as the elution solvent to obtain compound 3 (yield: 23%). The chemical structure of compound 3 is shown in Fig.12 .

[0089] Chemical 3 [N, N'-(naphthalene [2,3-c] [1,2,5] thiadiazole-4,9-diyl bis (4,1-phenyl)) bis (N- (naphthalen-1-yl) naphthalen-1-amine)] in CDCl3 1 H NMR spectrum Fig.13 . 1 H NMR (400 MHz, Chloroform-d) δ 8.35(d, J = 9.1 Hz, 2H), 8.15 (d, J = 8.4 Hz, 4H), 8.02 (d, J = 9.0 Hz, 2H), 7.85(d, J = 8.2 Hz, 4H), 7.68 (d, J = 7.2 Hz, 4H), 7.44 – 7.31 (m, 20H), 6.81 (d,J = 8.2 Hz, 4H).

[0090] [N,N′-(naphthalene[2,3-c][1,2,5]thiadiazole-4,9-diylbis(4,1-phenyl))bis(N-(naphthalen-1-yl)naphthalen-1-amine)] in CDCl3 at 298 K 13 C NMR spectrum Fig.14 . 13 C NMR (101 MHz, Chloroform-d) δ 151.07,150.40, 144.08, 135.27, 133.11, 132.39, 132.10, 131.14, 130.42, 128.63,128.23, 127.85, 127.40, 126.52, 126.45, 126.28, 126.23, 126.18, 125.50,124.41, 118.99).

[0091] 1 mg of photosensitizer drug molecule (NTPN) with photodynamic properties and 4 mg of DSPE-PEG2000 were completely dissolved in 600 μL of tetrahydrofuran (THF). Subsequently, the drug solution was injected into 6 mL of deionized water through a syringe under rapid stirring. Stir overnight at room temperature in a fume hood to remove THF from the solution. The photosensitizer nanoparticles (NT) were collected by centrifugation using a centrifugal filter with a molecular weight cutoff of 100 kDa. The prepared nanoparticles (1 mL, 1 mg / mL in terms of NTPN) were mixed with 2 mg of ANX5-P cell membrane carriers under ultrasonic conditions (100 W, 50 Hz, 10 minutes). Then, they were extruded through a polycarbonate membrane to generate NT@ANX5-P nanoparticles, which were engineered cell-derived vesicle-encapsulated tumor immunotherapy nanovaccines NT@ANX5-P. The prepared NT@ANX5-P nanovaccine was stored at 4°C.

[0092] At the same time, using the same method, the photosensitizer nanoparticles were mixed with 4T1 cell membranes and 4T-ANX5 cell membranes under ultrasonic conditions to prepare NT@M nanovaccine and NT@ANX5 nanovaccine, respectively.

[0093] Transmission electron microscopy (TEM) images revealed the typical core-shell structure of these nanovaccines, with a distinct membrane layer surrounding the nanovaccine core ( Fig.15 Dynamic light scattering (DLS) measurements ( Fig.16 ) showed that the average diameter of all nanovaccines was about 150 nm, among which the NT@ANX5-P nanovaccine was slightly larger than the other nanovaccines due to the addition of a PEG layer. In addition, after cell membrane camouflage, the zeta potential of the NT@M nanovaccine dropped from -22.37 mV to -30.67 mV, which was due to the addition of a negatively charged cell membrane, while the surface charge of the NT@ANX5-P nanovaccine further decreased after weakly charged PEG modification ( Fig.17 ).

[0094] Example 2 ANX5 nano vaccine performance determination

[0095] 1. Evaluation of the stability of ANX5 nanovaccine

[0096] This example evaluates the stability of different nanovaccines over time. When incubated in PBS, the hydrodynamic size of the NT nanovaccine, NT@M nanovaccine, and NT@ANX5-P nanovaccine remained almost unchanged over 7 days ( Fig.18 ), indicating that they have high stability under physiological conditions.

[0097] 2. Verification of ROS-responsive cleavage of TK bonds and ANX5 exposure on the nanovaccine surface in vitro

[0098] The chemotherapeutic drug doxorubicin (Dox) was used to induce the exposure of phosphatidylserine PS on the surface of 4T1 tumor cells. Fluorescently labeled Annexin V-APC700 was used to compete with ANX5 exposed on the surface of nanovesicles to analyze the TK bond breakage and ANX5 exposure caused by ROS generated by H2O2 treatment.

[0099] After the NT@ANX5-P nanovaccine was treated with H2O2, the binding of NT@ANX5-P nanovaccine to PS was restored. In addition, the chemotherapeutic drug doxorubicin (Dox) was used to induce the exposure of PS on the surface of 4T1 tumor cells. Flow cytometry imaging ( Fig.19 ), it was observed that NT@ANX5 nanovaccine was able to effectively bind to PS exposed on the surface of tumor cells, while NT@ANX5-P nanovaccine showed weaker binding ability due to the protective PEG layer. Notably, H2O2 treatment significantly restored this binding ability. These results suggest that ROS-triggered cleavage of the PEG layer can regulate the exposure of ANX5, thereby promoting the binding of PS.

[0100] 3. Detection of Nanovaccine’s Tumor Targeting Ability in Vitro

[0101] The uptake of various nanoformulations by 4T1 cells was evaluated by confocal laser scanning microscopy (CLSM), with the red fluorescence of NTPN as an indicator. After 6 h of co-incubation with nanoparticles (10 μM) at 37°C (NT+L group, NT@M group, NT@ANX5-P group), cells treated with NT@M or NT@ANX5-P nanoparticles showed significantly stronger red fluorescence than those treated with uncoated NT nanoparticles ( Fig. 20 and Fig.21 Flow cytometry analysis further confirmed that the ability of nanoparticles disguised with homologous tumor cell membranes to be phagocytosed by tumor cells (79.5%) was significantly higher than that of the uncoated NT nanoparticle group (51.3%), while the addition of a PEG protective layer did not significantly affect the ability of nanoparticles to be taken up by tumor cells ( Fig. 22 There was no significant difference between the NT@M group and the NT@ANX5-P group, indicating that ANX5 modification did not affect the endocytosis of nanoparticles by target cells.

[0102] 4. Analysis of the ability of nanovaccines to inhibit tumor proliferation in vitro

[0103] CCK-8 analysis of 4T1 cell survival induced by light treatment (+ L) after treatment with different nanoparticles; C: PBS, C2: PBS + L, C3: NT + L, C4: NT@M + L, C5: NT@ANX5-P + L.

[0104] CCK-8 cell viability assay showed that all nanovaccines exhibited dose-dependent cytotoxicity against 4T1 cells under light irradiation (0.3 W / cm², 2 minutes) Fig.23 ). It is worth noting that NT@M and NT@ANX5-P nanoparticles showed significantly higher light-induced toxicity than the bare nanoparticle group. Cell viability was further evaluated by live-dead cell co-staining experiments. Fig.24 As shown, under light irradiation conditions, the proportion of green live cells stained with Calcein-AM was significantly reduced in cells treated with NT@M or NT@ANX5-P, indicating a high level of cell death.

[0105] 5. Analysis of the function of immune cells activated by nanovaccines in vitro

[0106] To evaluate the phagocytic clearance of tumor cell death under different conditions, bone marrow-derived macrophages (BMDMs) were collected and co-cultured with tumor cells treated with different treatments. The results showed that tumor cells treated with "NT + L" or "NT@M + L" exhibited significant macrophage phagocytosis, with approximately 70% to 80% of BMDMs actively participating in the clearance of dead tumor cells ( Fig.25 However, in the “NT@ANX5-P + L” group, phagocytosis was significantly reduced (approximately 50%), indicating that PS blockade inhibited the phagocytic activity of BMDMs.

[0107] Subsequently, the present invention evaluated the effect of PS blockade on macrophage phenotypic polarization and cytokine secretion. Flow cytometric analysis showed that phagocytosis of dead cancer cells induced by PDT treatment polarized BMDMs into immunosuppressive M2 (CD206 + ) phenotype ( Fig.26 ). However, for BMDMs co-cultured with dead tumor cells treated with “NT@ANX5-P + L”, the proportion of immunosuppressive M2 phenotype was significantly reduced. Subsequently, the supernatants of these BMDMs were collected and analyzed for cytokine secretion using ELISA kits. Fig. 27As shown, BMDMs co-cultured with dead 4T1 cells treated with "NT NPs + L" or "NT@M NPs + L" secreted a large amount of immunosuppressive cytokines, including TGF-β. In contrast, when co-cultured with cells treated with "NT@ANX5-P + L", the levels of immunosuppressive cytokines secreted by BMDMs were significantly reduced. At the same time, blocking phagocytosis by PS blockade led to BMDMs secreting more pro-inflammatory mediators, including IL-1β ( Fig.28 ).

[0108] 6. Analysis of tumor cell immunogenicity after nanoparticle treatment

[0109] Immunofluorescence staining showed that compared with other treatment groups, the expression of cell surface immunogenic marker ecto-CRT was significantly increased after tumor cells treated with NT@ANX5-P and light were co-cultured with BMDMs ( Fig.29 ), indicating that the inhibition of phagocytic clearance of dead tumor cells by PS blockade promoted the expression of ecto-CRT. The release of HMGB1 in the cell supernatant was further analyzed by Western blot, and the results showed that after "NT@ANX5-P + light" treatment, the release of HMGB1 in 4T1 cells was significantly increased ( Fig.30 ). Compared with other treatment groups, the concentration of HSP70 in the supernatant of 4T1 cells treated with "NT@ANX5-P + light" was also the highest ( Fig.30 ).

[0110] 7. Analysis of the tumor inhibition ability of nano-vaccines in vivo

[0111] The present invention further evaluated its anti-tumor effect in vivo. 4T1 cells were injected subcutaneously into the right abdomen of mice, and when the tumor volume reached 100 mm³ 7 days later, the mice were then randomly divided into five groups (n = 5 in each group) and treated with the following formulations: PBS, L, NT + L, NT@M + L, and NT@ANX5-P + L. In the "L" group, the tumor site was treated with light (0.5 W / cm²) for 10 minutes 12 hours after the injection of the respective formulation. This injection and irradiation procedure was repeated on days 1, 4, and 7. During the entire treatment period, the tumor volume of mice in different treatment groups was monitored, and tumor samples were taken for analysis on day 14. The tumors of mice in the PBS and L groups grew rapidly throughout the treatment process, indicating that laser treatment alone has limited anti-tumor effect ( Fig.31 and Fig.32). After treatment in the NT + L or NT@M + L groups, tumor growth was significantly inhibited compared with the PBS control group, but there was still moderate tumor growth. These results suggest that photodynamic therapy (PDT) has some anti-tumor effects when used alone, but the effect is not satisfactory. NT@ANX5-P combined with light significantly delayed tumor growth, with one of the five mice completely regressing, a result not seen in any other group ( Fig.32 On day 14, the average tumor volume of the “NT@ANX5-P + L” group (146.82 mm³) was approximately 7.57-, 6.87-, 5.07-, and 3.21-fold smaller than those of the PBS (1111.33 mm³), L (1008.99 mm³), NT+ L (743.99 mm³), and NT@M + L (471.27 mm³) groups ( Fig.31 ). These results suggest that the combination of potent PDT and PS blocking achieved the most effective tumor growth inhibition.

[0112] 8. Analysis of in vivo immune activation by nanovaccine therapy

[0113] To confirm that PDT-induced tumor antigen production and DAMP release can enhance the immunogenicity of tumor cells and promote dendritic cell (DC) maturation in an in vivo model, the present invention collected the tumor-draining lymph nodes of mice for flow cytometry analysis. + CD86 + , CD11c + The proportion of NT@M+L group (gated) was about 23.5%, compared with that of PBS group (3.29%), L group (4.54%), NT+L group (9.88%) and NT@M+L group (16.3%). Fig.33 ). The present invention then investigated whether the combination of NT@ANX5-P-mediated downregulation of immune suppression and upregulation of immune activation could enhance local antitumor immune response. Compared with the PBS control group or the light-only group, it was observed that in the tumor tissues of mice treated with "NT+ L" and "NT@M + L", cytotoxic CD8 + T cells (CD45 + CD3 + CD8 + ) has increased ( Fig.34 ). This finding suggests that PDT may stimulate immune responses in part by enhancing tumor immunogenicity. Notably, NT@ANX5-P + light therapy further enhanced the expression of CD8 +The T cell response was 7.32 times that of the PBS treatment group and 2.11 times that of the NT@M + light treatment group ( Fig.34 ).

[0114] 9. In vivo safety assessment of nanovaccines

[0115] At the same time, in order to verify the in vivo biological safety of the nanovaccine, healthy mice were injected with NT@ANX5-P nanovaccine or PBS as a control through the tail vein, and the hearts, livers, spleens, lungs, and kidneys of each group of mice were stained with HE to observe whether there was tissue damage. Fig.35 As shown, there was no obvious histological damage, indicating the biological safety of the drug.

[0116] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A tumor immunotherapy nanovaccine encapsulated by engineered cell-derived vesicles, characterized in that: The nano vaccine is obtained by PEG-modifying the tumor cell membrane with ANX5 protein anchored on the surface and then reacting with a photosensitizer.

2. The nanovaccine according to claim 1, characterized in that The nano vaccine is prepared by the following method: The coding gene of ANX5 protein is connected to a lentiviral expression vector to construct a recombinant lentiviral expression plasmid; the recombinant lentiviral expression plasmid is then transfected into tumor cells to screen for a stable cell line overexpressing ANX5; Introducing the N3 group into the cell outer membrane of the ANX5 overexpressing stable cell line, extracting the cell membrane, and combining the cell membrane with PEG 5000-TK-DBCO to obtain ANX5-anchored PEG camouflaged nanoparticles through a click chemistry reaction; ANX5-anchored PEG camouflaged nanoparticles and photosensitizer nanoparticles were ultrasonically reacted and extruded through a polycarbonate membrane to prepare engineered cell-derived vesicle-encapsulated tumor immunotherapy nanovaccines.

3. The nanovaccine according to claim 2, characterized in that The accession number of the gene encoding the ANX5 protein in NCBI is NM_009673.2; and / or the PEG includes PEG5000.

4. The nanovaccine according to claim 2, characterized in that The molar ratio of the N3 group in the cell membrane to the DBCO in the PEG 5000-TK-DBCO is 1:1; and the click chemistry reaction time is 10-12 hours.

5. The nanovaccine according to claim 2, characterized in that The mass volume ratio of the ANX5-anchored PEG camouflaged nanoparticles and the photosensitizer nanoparticles is 1-5 mg:1 mL.

6. The nanovaccine according to claim 1, characterized in that The tumor cell membrane includes a breast cancer cell membrane.

7. Use of the nanovaccine according to any one of claims 1 to 6 in any of the following: (1) Application in the preparation of tumor immunotherapy products; (2) Application in the preparation of products for in situ inhibition of tumor proliferation and growth; (3) Application in the preparation of products for activating immune cell functions.

8. The use according to claim 7, characterized in that The tumor includes breast cancer.

9. A product, characterized in that The nano vaccine according to claim 1 and pharmaceutically acceptable adjuvants and carriers are included, and the product is used to inhibit tumor proliferation and growth in situ and / or activate immune cell function.

10. The product according to claim 9, characterized in that The tumor includes breast cancer.

Images