An engineered bacterium with high yield of beta-alanine using a cryptic plasmid as an expression vector and a double-carbon-source fermentation method

Abstract

The application discloses a kind of high-yield beta-alanine engineering bacteria with secret plasmid as expression vector and double-carbon-source fermentation method, the engineering bacteria knock out one or more of pckA gene, lacI gene, asnA gene, ygeA gene, gldA gene, nadB gene, dhaK gene in the genome of chassis bacteria, and / or overexpress one or more of glpF gene, glpD gene, yddG gene, ydcZ gene, rocG gene, glnA gene are constructed to obtain;The yddG gene, ydcZ gene, rocG gene are overexpressed using high-copy secret plasmid pMUT1.The present application uses glucose and glycerol as carbon source, increases the yield of beta-alanine engineering bacteria to about 3 times of the original yield, reduces the cost of adding inducer in the fermentation process, and the fermentation production process is safe and pollution-free.

Description

(I) Technical Field

[0001] This invention relates to an engineered bacterium that produces high levels of β-alanine using a cryptic plasmid as an expression vector and a dual-carbon-source fermentation method. (II) Background Technology

[0002] Escherichia coli Nissle 1917 (EcN) is a Gram-negative probiotic that can prevent pathogen infection by strengthening the intestinal mucosal barrier and stimulating the immune system. It can be used for the prevention and treatment of gastrointestinal dysfunction and immune diseases. In addition, EcN has the characteristics of rapid growth and is considered an ideal platform for the production of metabolites, suitable for industrial fermentation.

[0003] Currently, research on the development of *Escherichia coli* (EcN) as a chassis cell is relatively limited. The metabolic pathway for β-alanine production in EcN differs from that of other chassis strains, increasing the difficulty of research. Furthermore, as a probiotic, EcN does not produce virulence factors, a characteristic that allows engineered strains to be directly applied to livestock feed and used as a nutritional additive. Preliminary experiments have shown that EcN has a relatively fast growth rate and a high OD... 600 The value is higher than other E. coli strains, and it exhibits extremely high tolerance to β-alanine, which further highlights the development potential of EcN as a chassis cell. Finally, wild-type EcN contains two recessive plasmids, pMUT1 and pMUT2. Plasmid-free EcN, which removes these two recessive plasmids, is the preferred choice for constructing metabolically engineered strains, mainly because recessive plasmids have better compatibility than other plasmids, thereby reducing cellular burden. Therefore, the development of plasmid-free strains can promote the further application of EcN.

[0004] Beta-alanine is the only beta-amino acid in nature, which exists in some plants and bacteria. It also plays a role in animal physiological function and metabolism. It is a limiting amino acid for the synthesis of endogenous imidazole dipeptides in humans and mammals, and has the effects of increasing the content of imidazole dipeptides in muscles, improving antioxidant capacity and anti-fatigue. Beta-alanine can improve animal production performance, regulate muscle growth and muscle-derived active peptide content, improve meat quality, and can also be used for the synthesis of pantothenic acid, calcium pantothenate, carnosine, pamidronate sodium and bacto-bil, and applied to electroplating, lead poisoning antidote, synthesis of sweeteners, and synthesis of flocculants. In the past, beta-alanine was mainly produced by fermentation using glucose as the carbon source. However, as a six-carbon carbon source, glucose has a long metabolic pathway for producing beta-alanine as a three-carbon compound, and has the disadvantages of large carbon flux loss and low conversion rate. As a three-carbon carbon source, glycerol has a shorter metabolic pathway for producing beta-alanine, lower carbon flux loss rate, and higher conversion rate. By using glycerol and glucose as dual carbon sources, the advantages of both can be combined: glucose can provide abundant energy and intermediate metabolites to promote microbial growth and metabolic activity; and glycerol can be more effectively converted to beta-alanine, improving carbon source utilization and product conversion rate. This dual-carbon-source fermentation method is expected to further optimize the fermentation process and make the industrial production of beta-alanine more efficient and economical. (III) SUMMARY

[0005] The purpose of the present application is to provide a high-yield beta-alanine engineering bacteria using cryptic plasmid as expression vector and a dual-carbon-source fermentation method. The present application uses a method of adjusting the upstream metabolic module of glycerol, adjusting the L-aspartic acid byproduct module, adjusting the L-glutamic acid module, and screening the beta-alanine efflux protein module, and uses a cryptic plasmid as an expression vector for key enzyme genes to construct a high-yield beta-alanine bacteria. Finally, the fermentation is carried out by using glucose as the main carbon source and glycerol as the auxiliary carbon source through medium optimization, which improves the ability of EcN to produce beta-alanine. The engineering bacteria not only have strong tolerance to high-concentration beta-alanine, but also can produce high-yield beta-alanine through optimization of medium formula and other methods. The engineering bacteria can be safely used for microbial fermentation to produce beta-alanine, and the fermentation broth can also be used as probiotic nutrients for animal breeding to improve animal meat quality.

[0006] The technical scheme adopted by the present application is:

[0007] The present application provides a high-yield beta-alanine engineering bacteria using cryptic plasmid as expression vector, which is constructed by E. coli Nissle 1917 ΔcycA ΔfumB 1 ΔaspC Δpyk / pGLO-P J23100 - panD K43Y-aspB / pSU19-P J23100 - ppC - aspA For the chassis fungus (denoted EcN-6, which has been disclosed in patent application CN115927142A), one or more of the following genes in the genome are knocked out: pckA the gene, lacI the gene, asnA the gene, ygeA the gene, gldA the gene, nadB the gene, dhaK the gene, and / or one or more of the following genes are overexpressed: glpF the gene, glpD the gene, yddG the gene, ydcZ the gene, rocG the gene, glnA the gene are constructed; the yddG gene, ydcZ gene, rocG gene is overexpressed using high-copy cryptic plasmid pMUT1.

[0008] Preferably, the yddG gene, ydcZ gene, rocG gene is expressed using promoter P J23100 , and the promoter P J23100 nucleotide sequence is the same as that in patent application CN115927142A. The glpF gene, glpD gene, glnA gene is expressed using promoter P tac , and the promoter P tac nucleotide sequence is shown in SEQ ID NO. 1.

[0009] Preferably, the glpF gene, glpD gene, glnA gene is overexpressed using medium-copy plasmid pSU19 (refer to Hu, S et al. Appl Microbiol Biotechnol 107, 2277-2288 (2023) for construction).

[0010] Preferably, the yddG gene nucleotide sequence is shown in NCBI NZ_CP007799.1 (1667167-1668048), ydcZ gene nucleotide sequence is shown in NCBI NZ_CP007799.1 (1636228-1636677), rocGThe gene nucleotide sequence is shown in NCBI CP147877.1 (3882132-3883439).

[0011] Preferably, the pMUT1 plasmid nucleotide sequence is shown in SEQ ID NO. 2. glpF The gene nucleotide sequence is shown in NCBI NZ_CP007799.1 (4540078-4540923), glpD The gene nucleotide sequence is shown in NCBI NZ_CP007799.1 (3918024-3919529), glnA The gene nucleotide sequence is shown in NCBI NZ_CP007799.1 (4483254-4484663).

[0012] Preferably, the pMUT1 plasmid nucleotide sequence is shown in SEQ ID NO. 2.

[0013] Preferably, pckA The gene, lacI The gene, asnA The gene, ygeA The gene, gldA The gene, nadB The gene, dhaK The gene accession numbers in Genbank are 915899, 914500, 915329, 916475, 915010, 914886, and 913158, respectively.

[0014] Preferably, the engineering bacteria are one of the following: (1) EcN-6 as the chassis bacteria, knocking out the pckA gene in the genome, i.e. engineering bacteria ECN-7.

[0015] (2) On the basis of engineering bacteria ECN-7, knocking out the lacI gene in the genome, i.e. engineering bacteria ECN-8.

[0016] (3) On the basis of engineering bacteria ECN-8, using plasmid pSU19 and promoter P tac overexpression glpF gene, i.e. engineering bacteria ECN-9.

[0017] (4) On the basis of engineering bacteria ECN-9, knocking out the asnA gene in the genome, i.e. engineering bacteria ECN-10.

[0018] (5) On the basis of engineering bacteria ECN-10, knocking out the ygeA gene in the genome, i.e. engineering bacteria ECN-11.

[0019] (6) On the basis of the engineering bacteria ECN-11, the plasmid pSU19 and the promoter P tac overexpressing glpD gene, namely the engineering bacteria ECN-12.

[0020] (7) On the basis of the engineering bacteria ECN-12, the gene in the genome is knocked out gldA gene, namely the engineering bacteria ECN-13.

[0021] (8) On the basis of the engineering bacteria ECN-13, the gene in the genome is knocked out nadB gene, namely the engineering bacteria ECN-14.

[0022] (9) On the basis of the engineering bacteria ECN-14, the gene in the genome is knocked out dhaK gene, namely the engineering bacteria ECN-15.

[0023] (10) On the basis of the engineering bacteria ECN-15, the plasmid pGLO and the promoter P J23100 overexpressing ydcZ gene, namely the engineering bacteria ECN-16.

[0024] (11) On the basis of the engineering bacteria ECN-16, the plasmid pGLO and the promoter P J23100 overexpressing yddG gene, namely the engineering bacteria ECN-17.

[0025] (12) On the basis of the engineering bacteria ECN-17, the plasmid pGLO and the promoter P J23100 overexpressing rocG gene, namely the engineering bacteria ECN-18.

[0026] (13) On the basis of the engineering bacteria ECN-18, the plasmid pSU19 and the promoter P tac overexpressing glnA gene, namely the engineering bacteria ECN-19.

[0027] (14) On the basis of the engineering bacteria ECN-19, the pMUT1 plasmid in the genome is eliminated, and the pMUT1 is used as a carrier to replace the pGLO plasmid to overexpress panD, aspB, yddG, ydcZ, rocG gene, namely the engineering bacteria ECN-20.

[0028] The engineering bacteria ECN-20 with high yield of beta-alanine is most preferred in the application and is constructed by the following method:

[0029] (1) the Bacillus subtilis gene from panD and the P J23100The promoter was linearized by one-step cloning and ligation using the CloneExpress II One Step Cloning Kit to obtain pGLO-P. J23100 - panD ;

[0030] (2) The pGLO plasmid vector was loaded onto the vector. Bacillus subtilis Source panD By using PCR point mutation of amino acid 43 encoded by the gene, plasmid pGLO-P, which can express L-aspartate-α-decarboxylase with high enzyme activity, was obtained. J23100 - panD K43Y ;

[0031] (3) Using the λ-RED recombination system, the EcN genome was recombined. cycA Gene knockout yielded EcN with enhanced tolerance to intracellular β-alanine concentrations. ΔcycA ;

[0032] (4) Apply the λ-RED recombination system to EcN ΔcycA In the genome fumB 1 Gene, aspC Genes and pyk Gene knockout yields EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ;

[0033] (5) The EcN genome aspA Genes and P J23100 The promoter was ligated to the pSU19 vector using a one-step cloning method to obtain pSU19-P. J23100 - aspA ;

[0034] (6) From Corynebacterium glutamicum On the genome ppC After the gene was amplified using primers, it was then compared with pSU19-P J23100 - aspA pSU19-P was obtained by ligation using a one-step cloning method. J23100 - aspA- ppC ;

[0035] (7) From Corynebacterium glutamicum On the genome aspB The gene fragment obtained by PCR and the vector pGLO-PJ23100 - panD K43Y pGLO-P was obtained by ligation using a one-step cloning method. J23100 - panD K43Y - aspB ;

[0036] (8) Plasmid pSU19-P J23100 - aspA-ppC P on J23100 The promoter was replaced with P using PCR technology and a one-step cloning method. tac Promoter, resulting in pSU19-P tac - aspA-ppC ;

[0037] (9) The EcN genome glpF Genes and P tac The promoter was ligated to the pSU19 vector using a one-step cloning method to obtain pSU19-P. tac - aspA-ppC-glpF ;

[0038] (10) Apply the λ-RED recombination system to EcN ΔcycA ΔfumB 1 ΔaspC Δpyk In the genome lacI Gene, pckA Gene, asnA Gene, ygeA Genes were knocked out sequentially to obtain EcN. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔlacI ΔpckA ΔasnA ΔygeA strain;

[0039] (11) The EcN genome glpD Genes and P tac The promoter was ligated to the pSU19 vector using a one-step cloning method to obtain pSU19-P. tac - aspA-ppC-glpF-glpD ;

[0040] (12) Applying the λ-RED recombination system to EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔlacI Δ pckA ΔasnA ΔygeA In the genome nadB Gene, gldA Gene, dhaK The gene and pMUT1 plasmid were knocked out sequentially to obtain EcN. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔlacI ΔpckA ΔasnA ΔygeA ΔnadB ΔgldA ΔdhaK Δ pMUT1;

[0041] (13) The fragment from EcN genome on ydcZ gene was ligated with vector pGLO-P J23100 - panD K43Y -aspB by one-step cloning, pGLO-P J23100 - panD K43Y -aspB-ydcZ ;

[0042] (14) The fragment from EcN genome on yddG gene was ligated with vector pGLO-P J23100 - panD K43Y -aspB-ydcZ by one-step cloning, pGLO-P J23100 - panD K43Y -aspB-ydcZ-yddG ;

[0043] (15) The fragment from Bacillus subtilis gene on genome was ligated with vector pGLO-P rocG J23100 - panD K43Y -aspB-ydcZ-yddG by one-step cloning, pGLO-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG ;

[0044] (16) The fragment from EcN genome on glnA gene and P tac promoter was ligated with pSU19 vector by one-step cloning, pSU19-P tac - aspA-ppC-glpF-glpD-glnA ;

[0045] (17) The fragment from plasmid pGLO-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG gene was ligated with vector pMUT1 by one-step cloning, pMUT1-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG ;

[0046] ​(18) The plasmid pMUT1-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG and the plasmid pSU19-P tac - aspA-ppC - glpF-glpD-glnA into EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔlacI ΔpckA Δ asnA ΔygeA ΔnadB ΔgldA ΔdhaK Δ pMUT1, to obtain the engineered bacteria EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔlacI ΔpckA ΔasnA ΔygeA ΔnadB ΔgldA ΔdhaK Δ pMUT1 / pMUT1-P J23100 - panD K43Y - aspB-ydcZ-yddG-rocG / pSU19-P tac - aspA-ppC-glpF-glpD-glnA , i.e. the engineered bacteria with high yield of beta-alanine.

[0047] The present application also provides a method for producing beta-alanine by double carbon source fermentation using the engineered bacteria with high yield of beta-alanine, which comprises the following steps:

[0048] The engineered bacteria are inoculated into a fermentation medium and cultured at 37°C and 200 rpm to obtain a fermentation broth containing beta-alanine; the fermentation medium comprises 8 g / L of glucose, 2 g / L of glycerol, 14 g / L of K2HPO4·3H2O, 5.2 g / L of KH2PO4, 0.3 g / L of MgSO4, 1 g / L of NH4Cl, 1 g / L of tryptone, 2 g / L of urea, 2 g / L of glutamine and 2 g / L of ammonium succinate, and the solvent is ddH2O, and the pH value is 7.0.

[0049] Preferably, the engineered bacteria are inoculated into a fermentation tank medium, the culture temperature is 37°C, the pH value is 7.0, and the dissolved oxygen value is maintained at 20%; after 8 h of fermentation, glucose is supplemented to 10-15 g / L by feeding medium according to the consumption of glucose every 2 h, so that the residual sugar is controlled at 3-5 g / L, until the end of fermentation, to obtain a fermentation broth containing beta-alanine, preferably the total fermentation time is 60 h, and the total consumption of the feeding medium is 1 L;

[0050] Fermentation tank medium composition: 20 g / L glucose, K2HPO4·3H2O 28 g / L, KH2PO4 10.4 g / L, NH4Cl 4 g / L, MgSO4 0.6 g / L, tryptone 2 g / L, yeast extract 4 g / L, amine succinate 2 g / L, glutamine 2 g / L, urea 5 g / L, 1 mL / L 10x metal ions, 1 mL / L silicone antifoam agent, solvent is water; 10x metal ion formula: 10 g CaCl2, 10 g FeSO4·7H2O, 1 g ZnSO4·7H2O, 0.2 g CuSO4 and 0.02 g NiCl2·7H2O are dissolved into 100 mL ddH2O;

[0051] Fed-batch medium composition: glucose 400 g / L, glycerol 200 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, (NH4)2SO4 30 g / L, MgSO4 0.6 g / L, amine succinate 6 g / L, glutamine 6 g / L, antifoam agent 1 mL / L, antifoam agent is silicone antifoam agent, solvent is water.

[0052] Preferably, the engineering bacteria are activated on a slope and seed expanded culture before fermentation, and then the seed liquid is inoculated into the fermentation medium or the fermentation tank medium at a volume concentration of 2-5%, and the seed liquid culture method is:

[0053] (1) The engineering bacteria are inoculated on an LB plate containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate culture medium: tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 2 g / L, solvent is water, pH value is natural;

[0054] (2) The single colony of step (1) is inoculated into LB liquid medium and cultured in a 37°C incubator at a speed of 220 rpm overnight to obtain the seed liquid.

[0055] The application is first reformed on the basis of EcN-6, in order to strengthen the utilization rate of glycerol in the medium by EcN, the glpF gene, glpD gene, glnA gene on the genome of EcN is transcribed on a medium copy plasmid pSU19 and a P tac strong promoter. In order to further expand the L-aspartate pool, the asnA 、 nadB 、 ygeAThe genes block the flow of L-aspartate to L-aspartate byproducts. Since the generation of L-aspartate requires a large amount of NH4 + and L-glutamate and NADPH, in order to maintain the intracellular NH 4+ and L-glutamate and NADPH, the amount of Bacillus subtilis The genes on the genome rocG are transcribed by using P J23100 strong promoters on a high-copy plasmid pMUT1. And among the DMT family transport proteins, the proteins with transport function for beta-alanine are screened out, which are encoded by ydcZ and yddG The genes on the genome ydcZ , yddG are transcribed by using P J23100 strong promoters on a high-copy plasmid pMUT1. Then, in order to further reduce the consumption of phosphoenolpyruvate, by knocking out the pckA , gldA, dhaK genes on the genome of EcN, glycerol is prevented from participating in the glycerol micro-aerobic oxygen pathway and consuming phosphoenolpyruvate, so that more phosphoenolpyruvate flows to oxaloacetate. Finally, by knocking out the lacI gene on the genome of EcN, the fermentation cost is reduced.

[0056] Compared with the prior art, the present application has the following beneficial effects: first, the chassis bacteria EcN-6 adopted in the present application has higher tolerance to beta-alanine than other conventional Escherichia coli strains in the fermentation production process, and the tolerance to beta-alanine of the constructed EcN-20 is further improved, which is superior to the EcN-6 chassis bacteria; second, the present application modifies the glycerol upstream pathway, increases the utilization rate of glycerol and reduces the consumption of phosphoenolpyruvate, and further enhances the supply amount of beta-alanine precursor L-aspartate by modifying the asnA gene, nadB gene and ygeA gene through metabolic engineering, thereby improving the yield of beta-alanine; third, the present application screens two proteins with transport function for beta-alanine from the DMT family transport proteins, which are encoded by ydcZ gene and yddG gene, and overexpressing the ydcZ gene and yddG gene on the pMUT1 plasmid can significantly improve the yield of beta-alanine; fourth, the present application optimizes the alpha-ketoglutarate, L-glutamate, L-glutamine cycle, improves NADPH and NH4 +supply, increase the L-aspartic acid pool by enhancing the effect of L-aspartate transaminase, and further improve the production of beta-alanine. Fifth, the present application increases the production of beta-alanine to about 3 times the original level by adding glutamine, amine succinate and fumaric acid and other medium optimization means in the culture medium, and reduces the cost of adding the inducer (IPTG) in the fermentation process by knocking out the gene in the genome lacI , and establishes a beta-alanine production strain small test fermentation production process; Sixth, the present application uses probiotic engineering bacteria to ferment beta-alanine, and the fermentation production process is safe and pollution-free. The fermentation broth can not only be used to prepare industrial and food-grade beta-alanine chemical raw materials, but also can be directly used for animal breeding. (Four) Brief Description of the Drawings

[0057] Figure 1 is a metabolic pathway diagram of beta-alanine in Escherichia coli EcN.

[0058] Figure 2 is a colony PCR detection electrophoresis map of the Escherichia coli EcN ΔcycA ΔfumB 1 ΔaspC Δpyk strain knockout pckA Figure 3 is a comparison chart of the biomass and beta-alanine production of the engineering strains EcN-7 and EcN-6 in Example 1. Statistics use two-tailed t-test (P < 0.05; pckA

[0059] P < 0.05; P < 0.01).

[0060] Figure 4 is a colony PCR detection electrophoresis map of the Escherichia coli EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA strain knockout lacI Figure 5 is a comparison chart of the biomass and beta-alanine production of the engineering strains EcN-7 and EcN-8 in Example 2. Statistics use two-tailed t-test (P < 0.05; lacI

[0061] P < 0.05; P < 0.01).

[0062] ​​​​Figure 6 represents pSU19-P tac -aspA-ppC-glpF-glpD Recombinant vector construction process and map.

[0063] Figure 7 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-9, EcN-8 in Example 3. Statistics use two-tailed t-test (p < 0.05) P < 0.05; P < 0.01).

[0064] Figure 8 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-10, EcN-9 in Example 4. Statistics use two-tailed t-test (p < 0.05) ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI Strain knockout asnA Electrophoresis map of colony PCR detection after knocking out the gene and eliminating resistance; lane 1 represents EcN, lanes 2-3 represent asnA Gene knockout strain, lane 4 represents 5K Marker.

[0065] Figure 9 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-11, EcN-10 in Example 5. Statistics use two-tailed t-test (p < 0.05) P < 0.05; P < 0.01).

[0066] Figure 10 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-12, EcN-11 in Example 6. Statistics use two-tailed t-test (p < 0.05) ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA Strain knockout ygeA Electrophoresis map of colony PCR detection after knocking out the gene and eliminating resistance; lane 1 represents EcN, lanes 2-11 represent ygeA Gene knockout strain, lane 12 represents 5K Marker.

[0067] Figure 11 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-11, EcN-10 in Example 5. Statistics use two-tailed t-test (p < 0.05) P < 0.05; P < 0.01).

[0068] Figure 12 is a graph of the biomass and beta-alanine production of engineered bacteria EcN-12, EcN-11 in Example 6. Statistics use two-tailed t-test (p < 0.05) P < 0.05; P < 0.01).

[0069] Figure 13 is a gel electrophoresis of the engineered bacteria EcN-12, EcN-13 of Example 7 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA Strain knockout gldA Gel electrophoresis of colony PCR for detection of gene deletion; Lane 1 represents 5K Marker, Lanes 2-3 represent EcN. gldA Gene knockout strain, Lane 8 represents EcN.

[0070] Figure 14 is a gel electrophoresis of the engineered bacteria EcN-12, EcN-13 of Example 7 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0071] Figure 15 is a gel electrophoresis of the engineered bacteria EcN-14, EcN-13 of Example 8 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA Δ lacI ΔasnA ΔygeA ΔgldA Strain knockout nadB Gel electrophoresis of colony PCR for detection of gene deletion; Lane 1 represents 5K Marker, Lanes 2-7 represent nadB Gene knockout strain, Lane 8 represents EcN.

[0072] Figure 16 is a gel electrophoresis of the engineered bacteria EcN-14, EcN-13 of Example 8 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0073] Figure 17 is a gel electrophoresis of the engineered bacteria EcN-15, EcN-14 of Example 9 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB Strain knockout dhaK Gel electrophoresis of colony PCR for detection of gene deletion; Lane 1 represents 5K Marker, Lane 2 represents EcN, Lanes 3-5 represent dhaK Gene knockout strain.

[0074] Figure 18 is a gel electrophoresis of the engineered bacteria EcN-15, EcN-14 of Example 9 and a graph of biomass and beta-alanine production. Statistics were performed using a two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0075] Figure 19 is a pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG Recombinant vector construction process and map.

[0076] Figure 20 is a graph of biomass and beta-alanine production of engineered bacteria EcN-15, EcN-16, EcN-17 in Example 10. Statistics using two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0077] Figure 21 is a pGLO-P J23100 -panD K43Y -aspB-ydcZ-yddG-rocG Recombinant vector construction process and map.

[0078] Figure 22 is a pSU19-P tac -aspA-ppC-glpF-glpD-glnA Recombinant vector construction process and map.

[0079] Figure 23 is a graph of biomass and beta-alanine production of engineered bacteria EcN-17, EcN-18, EcN-19 in Example 12. Statistics using two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0080] Figure 24 is a map of the pMUT1 plasmid elimination site and plasmid map of engineered bacteria EcN-20 in Example 13.

[0081] Figure 25 is a graph of biomass and beta-alanine production of engineered bacteria EcN-20, EcN-19 in Example 14. Statistics using two-tailed t-test (p < 0.05; P < 0.05; P < 0.01).

[0082] Figure 26 is a graph of biomass and beta-alanine production of chassis bacteria EcN-6 and engineered bacteria EcN-20 in shake flask fermentation media in Example 15. Statistics using two-tailed t-test (p < 0.05; P < 0.05; P< 0.01).

[0083] Figure 27 Biomass and beta-alanine production of the engineered strain EcN-20 with different carbon sources in Example 15.

[0084] Figure 28 Biomass and beta-alanine production of the engineered strain EcN-20 with different nitrogen sources in Example 15.

[0085] Figure 29 High performance liquid chromatogram of different concentrations of beta-alanine standard.

[0086] Figure 30 High performance liquid chromatogram of the culture solution of the engineered strain EcN-20 in Example 15 in the optimized fermentation medium.

[0087] Figure 31 Biomass and beta-alanine production of the chassis strain EcN-6 and the engineered strain EcN-20 in the optimized fermentation medium in Example 15.

[0088] Figure 32 is the biomass and beta-alanine production of the engineered strain EcN-20 in Example 16 in the 5L fermentation tank fermentation medium without glycerol. Statistics uses two-tailed t-test (P < 0.05; P < 0.05; P < 0.01).

[0089] Figure 33 is the biomass and beta-alanine production of the engineered strain EcN-20 in Example 16 in the 5L fermentation tank fermentation medium with glycerol. Statistics uses two-tailed t-test (P < 0.05; P < 0.05; P < 0.01). (V) SPECIFIC EMBODIMENTS

[0090] The application will be further described below in conjunction with specific embodiments, but the scope of protection of the application is not limited to this:

[0091] The experimental methods in the examples are all conventional methods unless otherwise specified. The test materials used in the examples are all conventional biochemical reagents unless otherwise specified.

[0092] The application uses E.coli The Nissle 1917 (EcN) strain is purchased from Hangzhou Fenghai Biological Technology Co., Ltd., and the strain is identified by Zhejiang Tianke High-tech Development Co., Ltd.

[0093] The pMUT1 plasmid used in the application is purchased from the addgene website.

[0094] bottom chassis E. coli Nissle 1917 ΔcycA ΔfumB 1 ΔaspC Δpyk / pGLO-P J23100 - panD K43Y -aspB / pSU19-P J23100 - ppC - aspA , which has been disclosed in patent application CN115927142A, denoted as EcN-6.

[0095] LB liquid medium composition: proteose peptone 10 g / L, yeast powder 5 g / L, sodium chloride 10 g / L, ddH2O, pH value is natural; LB plate medium is added in the LB liquid medium with a final concentration of 2 g / L agar.

[0096] Basic salt M9 medium composition: glucose 10 g / L, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH value is 7.0.

[0097] Example 1: Knockout of oxaloacetate recharging PEP related genes in the bottom chassis EcN-6 pckA gene

[0098] In order to make more oxaloacetate flow to L-aspartate, the E. coli Nissle1917 ΔcycA ΔfumB 1 ΔaspC Δpyk / pGLO-P J23100 - panD K43Y -aspB / pSU19-P J23100 - ppC - aspA Oxaloacetate recharging PEP related genes in the strain pckA Knockout, enhance the phosphoenolpyruvate to oxaloacetate metabolic pathway, construct the beta-alanine engineering strain EcN-7 which enhances the phosphoenolpyruvate to oxaloacetate pathway. The specific steps are as follows:

[0099] (1) Taking EcN genome as template, respectively using primer pckA -UP-F, primer pckA -UP-R, primer pckA-down-F, primer pckA- down-R, PCR amplification of the target gene pckA The fragment of the upstream and downstream homologous arms, the nucleotide sequence is shown in NCBI NZ_CP007799.1 (3887355-3888331), NZ_CP007799.1 (3889955-3890958).

[0100] (2) Resistance fragment amplification: using pKD4 plasmid (donated by Kirill A. Datsenko & Barry L. Wanner) as a template, using the primer pckA -Kan-F, primer pckA -Kan-R, PCR amplification of the kanamycin resistance fragment with FRT site on pKD4 plasmid, the nucleotide sequence is shown in NCBI AY048743.1 (25-1540), wherein 27-60 bp and 1420-1453 bp are FRT sites; 435-1229 bp is the kanamycin resistance nucleotide sequence.

[0101] (3) Preparation of Donor DNA: using the primer pckA- UP-F 、 primer pckA- down-R, three-fragment ligation of the kanamycin resistance fragment with FRT site in step (2) and the upstream and downstream homologous arms in step (1), to obtain the kanamycin resistance gene fragment containing the upstream and downstream homologous arms, i.e. Donor DNA.

[0102] (4) Competent cells: by the method of electroporation, the pKD46 plasmid (donated by Kirill A. Datsenko & Barry L. Wanner) was transformed into E. coli Nissle 1917 ΔcycA ΔfumB 1 ΔaspC Δpyk , to obtain the E. coli Nissle 1917 ΔcycA ΔfumB 1 ΔaspC Δpyk , inoculated into LB medium containing 0.1 mg / mL ampicillin and 30 mM L-arabinose, cultured at 30°C, 220 rpm to OD 600 0.6, centrifuged the bacterial suspension at 9000 rpm for 5 min, the pellet was washed four times with sterile distilled water, to obtain the competent cells.

[0103] (5) Knockout strain of target gene: the Donor DNA fragment of step (3) was electroporated into the competent cells of step (4) at 1.8 KV, and the electroporated bacterial solution was incubated at 30°C for 2 h. After centrifugation of 1 mL bacterial solution at 9000 rpm for 1 min, 900 µL supernatant was discarded, and 50 µL of the precipitate was spread on an LB plate containing 0.05 mg / mL kanamycin and 0.1 mg / mL ampicillin resistance, and incubated at 30°C overnight. A single colony was picked as a template for PCR with primers pckA -PCR was performed with primers F and K an-R-detect. Under the same conditions, EcN was used as a control, and agarose gel electrophoresis analysis was performed, and the results are shown in Figure 2 . It was observed that the knockout strain had a DNA band in the 1.0% agarose gel, and EcN had no band to confirm the deletion of the gene. The knockout pckA strain was obtained by screening. cycA 、 fumB 1 、 aspC 、 pyk, pckA

[0104] (6) Elimination of plasmid: the strain of step (5) was inoculated in LB liquid medium containing 0.05 mg / mL kanamycin resistance and incubated at 37°C for 12 h to eliminate pKD46, and then inoculated in LB plates containing 0.05 mg / mL kanamycin resistance and LB plates containing 0.1 mg / mL ampicillin and 0.05 mg / mL kanamycin resistance, and incubated at 37°C for 12 h to screen the knockout strain with pKD46 plasmid eliminated. The competent cells were prepared according to the method of step (4).

[0105] (7) Elimination of resistance: the pCP20 (DATSENKO K A. Proceedings of the National Academy of Sciences, 2000, 97(12): 6640-5.) plasmid was introduced into the competent cells of step (6), and the transformants were screened by incubating at 30°C for 12 h on LB plates containing 0.025 mg / mL chloramphenicol resistance. The transformants were incubated at 37°C for 12 h in LB liquid medium containing 0.025 mg / mL chloramphenicol resistance to eliminate kanamycin resistance on the genome; the bacterial solution was diluted 10 4 ​The bacteria were spread on LB plates containing 0.025 mg / mL chloramphenicol resistance and incubated at 30°C for 12 h. The obtained single colonies were first streaked on LB plates containing 0.05 mg / mL kanamycin resistance and 0.025 mg / mL chloramphenicol resistance and incubated at 30°C for 12 h. The colonies on the double-antibiotic plate were then streaked on LB plates containing 0.025 mg / mL chloramphenicol resistance and incubated at 30°C for 12 h. The colonies that did not grow on the double-antibiotic plate but grew on the single-antibiotic plate were used for colony PCR with primers pckA -UP-F and primer pckA -down-R. The agarose gel electrophoresis analysis was performed under the same conditions with EcN as a control. It was observed that the DNA band of the knockout strain was just the size of the target gene missing compared with the band size of the wild type pckA , which eliminated the kanamycin resistance on the genome of EcN.

[0106] (8) Elimination of pCP20 plasmid: the colonies that did not grow on the double-antibiotic plate but grew on the single-antibiotic plate in step (7) were inoculated into LB plates containing 0.025 mg / mL chloramphenicol resistance and LB plates without 0.025 mg / mL chloramphenicol resistance, respectively, and incubated at 37°C for 12 h. The antibiotic-free knockout strain EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA that did not grow on the LB plate containing 0.025 mg / mL chloramphenicol resistance but grew on the LB plate without 0.025 mg / mL chloramphenicol resistance was obtained. J23100 - panD K43Y -aspB tac - aspA-ppC The recombinant plasmid pGLO-P ΔcycA ΔfumB 1 ΔaspC Δpyk Δ pckA was introduced into EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA / pGLO-P J23100 - panD K43Y -aspB / pSU19-P J23100 - aspA-ppC , which was named as the engineering bacteria EcN-7.

[0107] (9) Determination of biomass and β-alanine yield

[0108] ​EcN-6 and EcN-7 were streaked on LB plates and incubated in 37℃ incubator overnight, single colony was picked and inoculated into 5 mL LB liquid medium and incubated in 37℃ incubator at 200 rpm overnight to obtain seed liquid. 1 mL seed liquid was inoculated into 250 mL flask with 50 mL minimal salt M9 medium. Then the flask was incubated in 37℃ incubator at 200 rpm for 24 hours, 1 mL liquid was taken from the flask to measure OD 600 .

[0109] Meanwhile, 1 mL liquid was taken from the flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken and derivatized, then the filtrate was analyzed by HPLC to determine the content of β-alanine in the fermentation broth, the results are shown in Figure 3 .

[0110] HPLC detection conditions: Wan instrument high performance liquid chromatograph; chromatographic column: XB-C18 chromatographic column (250 mm x 4.6 nm); mobile phase: methanol: 0.05 mol / L acetic acid-sodium acetate buffer solution (55:45, V / V); flow rate: 1.0 mL / min; column temperature: room temperature.

[0111] Derivatization of the sample: take 100 μL of the sample, add 100 μL of 0.5 mol / L NaHCO3 aqueous solution and 0.1 mL of 1% 2,4-dinitrofluorobenzene in acetonitrile, react at 60℃ in the dark for 2 h, then add 700 μL of 0.2 mol / L pH 7 phosphate buffer.

[0112] The results show that blocking oxaloacetate back-supply PEP can improve the yield of β-alanine, which is 1.2 times higher than that of EcN-6 strain, and the yield reaches 1.2 g / L.

[0113] Table 1: Primer sequences

[0114]

[0115] Example 2: Knockout of lacI gene in engineered strain EcN-7

[0116] In order to relieve the inhibition of P tac promoter and reduce the cost of adding inducer during fermentation, λ-RED recombination system was used to knockout P ΔcycA ΔfumB 1 Δ pGLO-P J23100 - aspC Δpyk ΔpckA ΔlacI K43Y panD pSU19-PJ23100 - -aspB - aspA-ppC Strain lactose operon encoding repressor gene Figure 5 Knockout, construct an economically viable β-alanine-producing engineering strain EcN-8, the specific steps are as follows:

[0117] Using EcN genome as a template, using primers lacI -UP-F, primer glpF -UP-R, primer glpF down-F, primer glpF down-R for PCR amplification, obtain the target gene Dpn The nucleotide sequence of the upstream and downstream homologous arm fragments is shown in NCBI NZ_CP007799.1 (452324-453322), NZ_CP007799.1 (450086-451239);

[0118] The kanamycin resistance fragment with FRT site is obtained by pKD4 plasmid as in Example 1, and the Donor DNA is prepared, after obtaining the target strain, the pKD46 plasmid is eliminated and the kanamycin resistance gene is eliminated by pCP20 plasmid, the electrophoresis map is shown in glpF . Finally, the pCP20 plasmid is successfully eliminated, and the final target strain EcN without resistance is obtained ppC 1 aspA aspA-ppC / pGLO-P J23100 - Dpn K43Y aspA-ppC / pSU19-P tac - aspA-ppC , which is engineering strain EcN-8.

[0119] The biomass and β-alanine yield of engineering strain EcN-8 are determined by the method of Example 1, and the results are shown in glpF . The results show that knocking out the repressor gene aspA-ppC , compared with EcN-7 strain, does not affect the yield.

[0120] Table 2: Primer sequences

[0121]

[0122] Example 3: Construction of recombinant plasmid expressing glycerol uptake protein encoding gene glpF ) and the corresponding engineering strain EcN-9.

[0123] (1) Using EcN genome as a template, using primers Figure 6 -F, primer aspA-ppCThe PCR product was detected by 1.0% agarose gel electrophoresis and purified by QIAquick Gel Extraction Kit. glpF I The template was removed, and the purified PCR product fragment was obtained to obtain the target gene ΔcycA ΔfumB ( nucleotide sequence as shown in NZ_CP007799.1 (4540078-4540923) in NCBI ). And by replacing pSU19-P J23100 - ΔaspC - Δpyk ΔpckA ΔlacI in P J23100 is P tac ( nucleotide sequence as shown in SEQ ID NO. 1 ).

[0124] ( 2 ) The pSU19-P tac - ΔcycA ΔfumB vector was used as the template, and the primer pSU19-vector-R and the primer pSU19-vector-F in Table 3 were used for PCR amplification. The PCR product was detected by 1.0% agarose gel electrophoresis and purified by QIAquick Gel Extraction Kit. ΔaspC Δpyk Δ I The template was removed, and the purified PCR product fragment was obtained to obtain pSU19-P tac - pckA ΔlacI linearized vector.

[0125] ( 3 ) The pSU19-P tac - panD linearized vector was connected with the target gene -aspB fragment by using a one-step cloning kit to obtain the cloned recombinant plasmid pSU19-P tac - aspA-ppC - glpF ( the construction process and the map are shown in Figure 7 ). After sequencing, it was verified to be a correct plasmid.

[0126] ( 4 ) The recombinant plasmid pSU19-P tac - asnA - ΔcycA ΔfumB was introduced into the strain EcN ΔaspC Δpyk ΔpckA ΔlacI 1 panD -aspB , and the strain EcN aspA-ppC 1 glpF asnA / pGLO-P J23100 - asnA K43Y asnA was obtained by using the method in Example 1. tac - asnA - asnA , which was recorded as the engineering strain EcN-9.

[0127] The biomass and beta-alanine production of the engineering bacteria EcN-9 and EcN-8 were detected by the method of Example 1, and the results are shown in Table 2. asnA The results show that the enhancement of the PEP to OAA pathway can further improve the production of beta-alanine. Compared with the EcN-8 strain, the production is increased by 1.33 times, and the yield reaches 1.60 g / L at 72 hours.

[0128] SEQ ID NO.1 P tac Promoter sequence: TTGACAATTAATCATCGGCTCGTATAATG

[0129] Table 3: Primer sequences

[0130]

[0131] Example 4: Knockout of the L-aspartate synthetase encoding gene in the engineering bacteria EcN-9 Figure 8 Gene

[0132] In order to reduce the consumption of L-aspartate in the engineering bacteria EcN-9 and enhance the L-aspartate pool, the L-aspartate synthetase encoding gene in EcN-9 was knocked out by the λ-RED recombination system, and the L-aspartate consumption was reduced to produce L-asparagine. The beta-alanine engineering strain EcN-10 was constructed to enhance the L-aspartate to beta-alanine pathway, and the specific steps are as follows: ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA / pGLO-P J23100 - panD K43Y -aspB pSU19-P tac - aspA - ppC-glpF L-aspartate synthetase encoding gene in the strain ΔcycA ΔfumB Knockout, reduce L-aspartate consumption to produce L-asparagine, construct beta-alanine engineering strain EcN-10 to enhance L-aspartate to beta-alanine pathway, the specific steps are as follows:

[0133] (1) Taking EcN genome as template, using primers ΔaspC Δpyk ΔpckA ΔlacI ΔasnA -UP-F, ΔcycA ΔfumB -UP-R, ΔaspC Δpyk ΔpckA ΔlacI ΔasnA down-F, panD down-R for PCR amplification, obtaining the fragments of the target gene -aspB upstream and downstream homologous arms, the nucleotide sequence is shown in NCBI NZ_CP007799.1 (4322989-4323934), NZ_CP007799.1 (4324842-4325836);

[0134] The kanamycin resistance fragment with FRT sites was obtained by pKD4 plasmid as example 1, and the Donor DNA preparation was carried out. After obtaining the target strain, the pKD46 plasmid was eliminated and the kanamycin resistance gene was eliminated by PCP20 plasmid. The electropherogram is shown in aspA-pp The PCP20 plasmid was successfully eliminated at last, and the final antibiotic-free target strain EcN glpF 1 Figure 9 .

[0135] The method of example 1 was used to introduce recombinant plasmid pGLO-P J23100 - asnA K43Y ygeA and pSU19-P tac - ΔcycA ΔfumB into EcN ΔaspC Δpyk ΔpckA ΔlacI ΔasnA 1 panD , and obtain the engineering strain EcN -aspB 1 aspA-ppC / pGLO-P J23100 - glpF K43Y ygeA / pSU19-P tac - ygeA C- ygeA , which is called engineering strain EcN-10.

[0136] The biomass and β-alanine yield of engineering strains EcN-10 and EcN-9 were determined by the method of example 1, and the results are shown in ygeA The results show that knocking out the L-asparagine synthetase encoding gene ygeA reduces the consumption of L-aspartate, and constructing an enhanced L-aspartate to β-alanine pathway can improve the yield of β-alanine. Compared with EcN-9 strain, the yield is increased by 1.05 times, reaching 1.68 g / L.

[0137] Table 4: Primer sequences

[0138]

[0139] Example 5: Knocking out the ygeA gene in engineering strain EcN-10

[0140] In order to make the engineering strain EcN-10 reduce more L-aspartate and L-glutamate into D-aspartate and D-glutamate, and accumulate L-aspartate and L-glutamate pool for the production of β-alanine, the λ-RED recombination system was used to knock out the Figure 10 ΔcycA ΔfumB 1ΔaspC Δpyk ΔpckA ΔlacI ΔasnA Δ / pGLO-P J23100 - ygeA K43Y panD pSU19-P tac - -aspB - aspA-ppC-glpF Strain specific amino acid racemase gene Figure 11 Knockout, construct the beta-alanine production strain EcN-11 which blocks the L-aspartate and L-glutamate consumption pathway, the specific steps are as follows:

[0141] (1) Using EcN genome as template, using primers ygeA -UP-F, glpD -UP-R, glpD down-F, glpD down-R for PCR amplification, obtain the target gene Dpn upstream and downstream homologous arm fragments, nucleotide sequence as shown in NCBI NZ_CP007799.1 (3223294-3224270), NZ_CP007799.1 (3224961-3226001).

[0142] The same as example 1, the kanamycin resistance fragment with FRT site was obtained by pKD4 plasmid, nucleotide sequence as shown in NCBI AY048742.1 (1733-2800) and Donor DNA preparation was carried out, after obtaining the target strain, eliminating pKD46 plasmid and using PCP20 plasmid to eliminate kanamycin resistance gene, electrophoresis as shown in glpD . Finally, PCP20 plasmid was successfully eliminated, and the final target strain EcN aspA-ppC-glpF 1 Dpn aspA-ppC-glpF / pGLO-P J23100 - aspA-ppC-glpF K43Y glpD / pSU19-P tac - aspA-ppC , recorded as engineering bacteria EcN-11.

[0143] Using the method of example 1 to determine the biomass and beta-alanine yield of engineering bacteria EcN-11, EcN-10, the results are shown in glpF-glpD . The results show that the specific amino acid racemase gene Figure 6 , accumulation of L-aspartate and L-glutamate pool to produce beta-alanine, compared with EcN-11 strain, increased by 1.07 times, the yield reached 1.92 g / L at 72 hours.

[0144] Table 5: primer sequence

[0145]

[0146] Example 6: Construction of a gene expressing glycerol-3-phosphate dehydrogenase (GSH) aspA-ppC The recombinant plasmid and the corresponding engineered bacteria EcN-12.

[0147] (1) Using the EcN genome as a template, the primers in Table 6 were used. glpF -F, primers glpD PCR amplification was performed using -R. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... panD First, the template is removed, and the PCR product fragment is purified to obtain the target gene. -aspB The fragment (nucleotide sequence is shown in NZ_CP007799.1 (3918024-3919529) in NCBI).

[0148] (2) pSU19-P tac - ΔcycA ΔfumB Using the vector as a template, PCR amplification was performed using primers pSU19-vector-R and pSU19-vector-F as listed in Table 6. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA I. Template elimination, purification of PCR product fragments, and obtaining pSU19-P tac - ΔcycA ΔfumB Linearized carrier.

[0149] (3) Using a one-step cloning kit, the pSU19-P from step (2) was cloned using one-step cloning. tac - ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA Linearization vector and steps (1) Target gene panD The fragments were ligated to obtain the cloning recombinant plasmid pSU19-P. tac - -aspB - aspA-ppC (See the construction process and diagrams) glpF The plasmid was confirmed to be correct after sequencing.

[0150] (4) The recombinant plasmid pSU19-P tac - glpD - Figure 12 - ​ and pGLO-P J23100 - ​ K43Y ​ Imported strain EcN ​ 1 ​ strain EcN was obtained ​ 1 ​ / pGLO-PJ23100 - ​ K43Y - ​ pSU19-P tac - ​ - ​ - ​ It is denoted as engineered bacteria EcN-12.

[0151] The biomass and β-alanine production of engineered bacteria EcN-12 and EcN-11 were detected using the method described in Example 1. The results are as follows: ​ As shown in the figure. The results indicate that further enhancing DHAP accumulation can further increase the yield of β-alanine. Using glycerol as a carbon source, compared with strain EcN-11, the yield was increased by 1.05 times, reaching 2.01 g / L.

[0152] Table 6: Primer Sequences

[0153]

[0154] Example 7: Knocking out engineered bacteria EcN-12 gldA Gene

[0155] To reduce carbon metabolism consumption in the engineered strain EcN-12, directing the metabolic flux towards phosphoenolpyruvate for β-alanine production, the λ-RED recombination system was used to modify EcN-12. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA / pGLO-P J23100 - panD K43Y -aspB pSU19-P tac - aspA-ppC - glpF-glpD glycerol dehydrogenase gene in strain gldA Knockout and construction of β-alanine-producing engineered strain EcN-13, which blocks carbon metabolism and PEP consumption pathways, were carried out through the following steps:

[0156] (2) Using the EcN genome as a template, primers were used. gldA -UP-F、 gldA -UP-R、 gldA- down-F, gldA- Down-R PCR amplification was performed to obtain the target gene. gldA The nucleotide sequences of the upstream and downstream homologous arms are shown in NCBI as NZ_CP007799.1 (4571694-4572689) and NZ_CP007799.1 (4573794-4574812).

[0157] Similar to Example 1, a kanamycin resistance fragment with an FRT site was obtained using the pKD4 plasmid, and Donor DNA was prepared. After obtaining the target strain, the pKD46 plasmid was eliminated, and the kanamycin resistance gene was eliminated using the PCP20 plasmid. Electrophoresis results are shown in the figure. Figure 13 Finally, the PCP20 plasmid was successfully eliminated, resulting in the antibiotic-free target strain EcN. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA / pGLO-P J23100 - panD K43Y -aspB / pSU19-P tac - aspA-ppC-glpF-glpD It is designated as engineered bacteria EcN-13.

[0158] The biomass and β-alanine production of engineered bacteria EcN-13 and EcN-12 were determined using the method described in Example 1. The results are as follows: Figure 14 As shown. The results indicate that knocking out the gene encoding glycerol dehydrogenase... gldA Blocking the microaerophilic pathway of glycerol uptake can increase the yield of β-alanine. Using glycerol as a carbon source, compared with strain EcN-12, the yield increased by 1.08 times, reaching 2.17 g / L.

[0159] Table 7: Primer Sequences

[0160]

[0161] Example 8: Knockout of engineered bacteria EcN-13 nadB Gene

[0162] To further reduce L-aspartic acid consumption and enhance the L-aspartic acid pool in the engineered strain EcN-13, the λ-RED recombination system was used to modify EcN-13. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA Δ gldA / pGLO-P J23100 - panD K43Y -aspB pSU19-P tac - aspA-ppC - glpF-glpD L-Aspartate Oxidase Encoding Gene in the Strains nadB Knockout reduces L-aspartate consumption into the TCA cycle, leading to the construction of the β-alanine-producing engineered strain EcN-14, which enhances the L-aspartate-to-β-alanine pathway. The specific steps are as follows:

[0163] (1) Using the EcN genome as a template, primers were used. nadB -UP-F、nadB - UP-R, nadB- - down-F, nadB- - down-R to obtain the target gene nadB The fragment of the upstream and downstream homologous arms has a nucleotide sequence shown in NZ_CP007799.1 (2944352-2945351), NZ_CP007799.1 (2946975-2947971) in NCBI;

[0164] The kanamycin resistance fragment with FRT sites was obtained by pKD4 plasmid as in Example 1, and the Donor DNA preparation was performed. After obtaining the target strain, the pKD46 plasmid was eliminated and the kanamycin resistance gene was eliminated by using PCP20 plasmid. The electrophoresis is shown in Figure 15 . Finally, the PCP20 plasmid was successfully eliminated, and the final target strain EcN-14 without resistance was obtained. ΔcycA ΔfumB 1 Δ aspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB , and the recombinant plasmid pGLO-P J23100 - panD K43Y -aspB and pSU19-P tac - aspA-ppC-glpF-glpD , to obtain the engineering strain EcN-14. ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB / pGLO-P J23100 - panD K43Y -aspB / pSU19-P tac - aspA-pp C- glpF-glpD , which is recorded as the engineering strain EcN-14.

[0165] The biomass and β-alanine yield of the engineering strain EcN-14 were determined by the method of Example 1, and the results are shown in Figure 16 . The results show that the knockout of L-aspartate oxidase gene nadB reduces the consumption of L-aspartate, enhances the L-aspartate pool to improve the yield of β-alanine. Compared with the EcN-13 strain, the use of glycerol as carbon source is increased by 1.09 times, and the yield reaches 2.37 g / L.

[0166] Table 8: Primer sequences

[0167]

[0168] Example 9: Knockout of dhaK gene in the engineering strain EcN-14

[0169] In order to reduce the consumption of PEP of the engineering bacteria EcN-14, enhance the PEP pool, the PEP-dependent dihydroxyacetone kinase encoding gene in the strain was knocked out by a λ-RED recombination system EcN Δ cycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB / pGLO-P J23100 - panD K43Y -aspB pSU19-P tac - aspA-ppC - glpF-glpD PEP-dependent dihydroxyacetone kinase encoding gene in the strain was knocked out dhaK The glycerol to 3-phosphoglycerol metabolic pathway was enhanced, the consumption of PEP was reduced, and the beta-alanine engineering strain EcN-15 with enhanced glycerol to 3-phosphoglycerol aerobic pathway was constructed. The specific steps are as follows:

[0170] (1) The genomic DNA was used as a template, and primers EcN -UP-F, dhaK -UP-R, dhaK down-F, dhaK- down-R were used for PCR amplification to obtain the fragments of the target gene dhaK- The nucleotide sequences of the upstream and downstream homologous arms are shown in NCBI NZ_CP007799.1 (1417886-1418907), NZ_CP007799.1 (1419979-1420979); dhaK The kanamycin resistance fragment with FRT sites was obtained by pKD4 plasmid as in Example 1, and the Donor DNA was prepared. After obtaining the target strain, the pKD46 plasmid was eliminated, and the kanamycin resistance gene was eliminated by using the PCP20 plasmid. The electrophoresis is shown in

[0171] . Finally, the PCP20 plasmid was successfully eliminated, and the final antibiotic-free target strain EcN Figure 17 ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pGLO-P J23100 - panD K43Y - aspB / pSU19-P tac - aspA-pp C- glpF-glpD , which is the engineering strain EcN-15.

[0172] The biomass and beta-alanine yield of the engineering strains EcN-15 and EcN-14 were determined by the method of Example 1, and the results are shown in Figure 18 ​As shown. The results indicate that knocking out the gene encoding PEP-dependent dihydroxyacetone kinase... dhaK The study enhanced the glycerol-to-glycerol-3-phosphate metabolic pathway, reduced PEP consumption, and constructed an enhanced aerobic pathway to increase β-alanine production. Using glycerol as a carbon source, the yield was increased by 1.05 times compared to strain EcN-14, reaching 2.49 g / L.

[0173] Table 9: Primer Sequences

[0174]

[0175] Example 10: Construction of a gene encoding a DMT family intima protein ( ydcZ The recombinant plasmid and the corresponding engineered bacteria EcN-16.

[0176] (1) Using the EcN genome as a template, the primers in Table 10 were used. ydcZ -F, primers ydcZ PCR amplification was performed using -R. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn First, the template is removed, and the PCR product fragment is purified to obtain the target gene. ydcZ The fragment (nucleotide sequence is shown in NZ_CP007799.1 (1636228-1636677) in NCBI).

[0177] (2) pGLO-P J23100 - panD K43Y -aspB Using the vector as a template, PCR amplification was performed using primers pGLO-vector-R and pGLO-vector-F (listed in Table 10). PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn I. Template elimination, purification of PCR product fragments, and obtaining pGLO-P J23100 - panD K43Y -aspB Linearized carrier.

[0178] (3) Using a one-step cloning kit, pGLO-P was cloned in one step. J23100 - panD K43Y -aspB Linearized vector and target gene ydcZ The fragments were ligated to obtain the cloning recombinant plasmid pGLO-P. J23100 - panD K43Y -aspB-ydcZ (See the construction process and diagrams) Figure 19 The plasmid was confirmed to be correct after sequencing.

[0179] (4) The recombinant plasmid pGLO-P J23100 - panD K43Y -aspB-ydcZ Imported strain EcN ΔcycA ΔfumB 1 Δ aspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pSU19-P tac - aspA- ppC - glpF - glpD strain EcN was obtained ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA Δ ygeA ΔgldA ΔnadB ΔdhaK / pGLO-P J23100 - panD K43Y -aspB-ydcZ pSU19-P tac - aspA-ppC - glpF - glpD It is designated as engineered bacteria EcN-16.

[0180] The biomass and β-alanine production of engineered bacteria EcN-16 and EcN-15 were detected using the method described in Example 1. The results are as follows: Figure 20 As shown. The results indicate that overexpression of the endometrial protein encoding gene ydcZ It can increase the yield of β-alanine. Using glycerol as a carbon source, it increased the yield by 1.04 times compared with EcN-15 strain, reaching a yield of 2.59 g / L.

[0181] Table 10: Primer Sequences

[0182]

[0183] Example 11: Construction of a gene encoding an aromatic amino acid transporter ( yddG The recombinant plasmid and the corresponding engineered bacteria EcN-17.

[0184] (1) Using the EcN genome as a template, the primers in Table 11 were used. yddG -F, primers yddG PCR amplification was performed using -R. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn First, the template is removed, and the PCR product fragment is purified to obtain the target gene. yddG The fragment (nucleotide sequence is shown in NZ_CP007799.1 (1667167-1668048) in NCBI).

[0185] (2) pGLO-P J23100 - panDK43Y -aspB-ydcZ The vector was used as a template for PCR amplification with primers pGLO-vector-R and pGLO-vector-F in Table 11. The PCR product was detected by 1.0% agarose gel electrophoresis and purified by using a QIAquick Gel Extraction Kit. Dpn I removed the template, and purified the PCR product fragment to obtain pGLO-P J23100 - panD K43Y - aspB - ydcZ Linearize the vector.

[0186] (3) Use the One Step Cloning Kit to clone pGLO-P J23100 - panD K43Y - aspB - ydcZ Linearize the vector and connect it with the target gene fragment in step (1) to obtain the recombinant plasmid pGLO-P yddG J23100 - panD K43Y - aspB - ydcZ - yddG (Construction process and map see Figure 19 ). After sequencing, it was verified as a correct plasmid.

[0187] (4) Introduce the recombinant plasmid pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG into the strain EcN ΔcycA Δ fumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pSU19-P tac - aspA-ppC - glpF - glpD , and obtain the strain EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB Δdha / pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG / pSU19-P tac - aspA-ppC - glpF - glpD , and record it as the engineering strain EcN-17.

[0188] Using the method of Example 1, the biomass and β-alanine yield of the engineering strains EcN-17, EcN-16, and EcN-15 were detected, and the results are shown in Figure 20 . The results show that overexpression of the aromatic amino acid transporter gene yddG ​It can increase the yield of β-alanine. Using glycerol as a carbon source, it increased the yield by 1.06 times compared with EcN-16 strain, reaching a yield of 2.74 g / L.

[0189] Table 11: Primer Sequences

[0190]

[0191] Example 12: Construction of a gene expressing NAD-specific glutamate dehydrogenase (NAD) for catabolic metabolism rocG The recombinant plasmid and the corresponding engineered bacteria EcN-18.

[0192] (1) with Bacillus subtilis Using the genome as a template, primers from Table 12 were used. rocG -F, primers rocG PCR amplification was performed using -R. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn First, the template is removed, and the PCR product fragment is purified to obtain the target gene. rocG The fragment (nucleotide sequence is shown in NCBI CP147877.1 (3882132-3883439)).

[0193] (2) pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG Using the vector as a template, PCR amplification was performed using primers pGLO-vector-R and pGLO-vector-F (listed in Table 12). PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn I. Template elimination, purification of PCR product fragments, and obtaining pGLO-P J23100 - panD- aspB - ydcZ - yddG Linearized carrier.

[0194] (3) Using a one-step cloning kit, the pGLO-P from step (2) was cloned using one-step cloning. J23100 - panD K43Y - aspB - ydcZ - yddG Linearization vector and steps (1) Target gene rocG The fragments were ligated to obtain the cloning recombinant plasmid pGLO-P. J23100 - panD K43Y - aspB - ydcZ - yddG - rocG (See the construction process and diagrams) Figure 21 The plasmid was confirmed to be correct after sequencing.

[0195] (4) The recombinant plasmid pGLO-P J23100 - panDK43Y - aspB - ydcZ - yddG - rocG Imported strain EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pSU19-P tac - aspA-ppC - glpF - glpD strain EcN was obtained ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG - rocG / pSU19-P tac - aspA-ppC - glpF - glpD It is designated as engineered bacteria EcN-18.

[0196] The biomass and β-alanine production of engineered bacteria EcN-18 and EcN-17 were detected using the method described in Example 1. The results are as follows: Figure 23 As shown. The results indicate that overexpression of the NAD-specific glutamate dehydrogenase gene responsible for catabolism... rocG It can increase the yield of β-alanine. Using glycerol as a carbon source, it increased the yield by 1.03 times compared with EcN-17 strain, reaching a yield of 2.82 g / L.

[0197] Table 12: Primer sequences

[0198]

[0199] Example 13: Construction of a gene expressing glutamine synthase ( glnA The recombinant plasmid and the corresponding engineered bacteria EcN-19.

[0200] (1) Using the EcN genome as a template, the primers in Table 13 were used. glnA -F, primers glnA PCR amplification was performed using -R. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn First, the template is removed, and the PCR product fragment is purified to obtain the target gene. glnA The fragment (nucleotide sequence is shown in NZ_CP007799.1 (4483254-4484663) in NCBI).

[0201] (2) pSU19-P tac - aspA-ppc-glpF-glpDThe vector as a template, using the primer pSU-vector-R, primer pSU-vector-F in Table 13 for PCR amplification. PCR product was detected by 1.0% agarose gel electrophoresis and used Dpn I template, purified PCR product fragments, obtained pSU19-P tac - aspA-ppc-glpF-glpD Linearization of the vector.

[0202] (3) using one-step cloning kit, using one-step cloning step (2) pSU19-P tac - aspA-ppc-glpF- glpD Linearization of the vector and step (1) of the gene glnA fragment was connected to obtain cloned recombinant plasmid pSU19-P tac - aspA-ppc-glpF-glpD-glnA (Construction process and map see Figure 22 ). After sequencing test for the correct plasmid.

[0203] (4) the recombinant plasmid pSU19-P tac - aspA-ppc-glpF-glpD-glnA into the strain EcN ΔcycA Δ fumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG - rocG , obtain strain EcN ΔcycA ΔfumB 1 ΔaspC Δpyk Δ pckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK / pGLO-P J23100 - panD K43Y - aspB - ydcZ - yddG - rocG / pSU19-P tac - aspA-ppC - glpF - glpD-glnA , recorded as engineering bacteria EcN-19.

[0204] The method of Example 1, detection of engineering bacteria EcN-19, EcN-18 biomass and β-alanine production, results as Figure 23 shown. The results show that overexpression of glutamine synthetase encoding gene glnA can improve the yield of β-alanine, using glycerol as carbon source, compared with EcN-18 strain, increased by 1.03 times, the yield reached 2.90 g / L.

[0205] Table 13: primer sequence

[0206]

[0207] Example 14: Construction of engineered strain EcN-20 with secret plasmid pMUT1 as expression vector.

[0208] To overexpress the key genes for beta-alanine production using the secret plasmid pMUT1 carried by EcN itself, the pMUT1 on the genome of EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA Δ ygeA ΔgldA ΔnadB ΔdhaK was knocked out by CRISPR / Cas system to avoid the incompatibility of pMUT1 plasmid we constructed to be transformed into EcN-19. The specific steps are as follows:

[0209] (1) Competent cells: pCas9 plasmid (Multigene editing in the Escherichia coli genome via the CRISPR-Cas9 system. Applied and environmental microbiology 81.7 (2015): 2506-2514.) was transformed into EcN ΔcycA ΔfumB 1 ΔaspC Δpyk Δ pckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK by electroporation to obtain EcN containing pCas9 plasmid, which was inoculated into LB medium containing 0.1 mg / mL kanamycin and 30 mM L-arabinose, and cultured at 30°C, 220 rpm until the OD 600 reached 0.6. The bacterial suspension was centrifuged at 5000 rpm for 5 min, and the precipitate was washed four times with sterile distilled water to obtain competent cells.

[0210] (2) pMUT1-knocking-out strain: pTargetF (targeting pMUT1) plasmid was transformed into EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK+ containing pCas9 plasmid by electroporation to obtain EcN containing pCas9 and pTargetF plasmids on LB plates containing 0.1 mg / mL spectinomycin and 0.05 mg / mL kanamycin.

[0211] (3) Plasmid elimination: The strain from step (2) was inoculated into LB liquid medium containing 20 mM IPTG and cultured at 37°C for 12 h to eliminate pCas9 and pTargetF plasmids. Then, it was inoculated into LB plates containing 0.05 mg / mL kanamycin resistance, 0.1 mg / mL spectinomycin resistance, and LB plates containing both 0.1 mg / mL spectinomycin and 0.05 mg / mL kanamycin resistance, respectively, and cultured at 37°C for 12 h to screen for knockout strains that eliminated pCas9 and pTargetF plasmids.

[0212] (4) Using recombinant plasmid pGLO-P J23100 - panD K43Y -aspB-ydcZ-yddG - rocG Using primers JG-F and JG-R from Table 14 as templates, PCR amplification was performed. The PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn First, the template is removed, and the PCR product fragment is purified to obtain the target gene P. J23100 - panD K43Y -aspB-ydcZ-yddG-rocG Excerpt.

[0213] (5) Using pMUT1 vector ( Figure 24 Using pMUT1-vector-R and pMUT1-vector-F as templates, PCR amplification was performed using primers pMUT1-vector-R and pMUT1-vector-F from Table 14. PCR products were detected by 1.0% agarose gel electrophoresis and analyzed using... Dpn I. Eliminate template, purify PCR product fragment, and obtain pMUT1 linearized vector (nucleotide sequence as shown in SEQ ID NO.2).

[0214] (6) Using a one-step cloning kit, the linearized pMUT1 vector from step (2) and the target gene P from step (1) were cloned using one-step cloning. J23100 - panD K43Y -aspB-ydcZ-yddG-rocG The fragments were ligated to obtain the cloning recombinant plasmid pMUT1-P. J23100 - panD K43Y -aspB-ydcZ-yddG-rocG Sequencing confirmed that it was the correct plasmid.

[0215] (7) The recombinant plasmid pMUT1-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG Imported strain EcN Δ cycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔasnA ΔygeA ΔgldA ΔnadB ΔdhaK ΔpMUT1 / pSU19-P tac - aspA-ppC - glpF - glpD-glnA , and the strain EcN ΔcycA ΔfumB 1 ΔaspC Δ pyk ΔpckA ΔlacI ΔygeA ΔgldA ΔdhaK ΔasnA ΔnadB ΔdhaK Δ pMUT1 / pMUT1-P J23100 - panD K43Y -aspB-ydcZ-yddG-rocG / pSU19-P tac - aspA-ppC - glpF - glpD-glnA , and the strain EcN-20.

[0216] The biomass and the production of beta-alanine of the engineered strains EcN-20 and EcN-19 were detected by the method of Example 1, and the results are shown in Table 5. Figure 25 The results show that replacing the pGLO plasmid with the cryptic plasmid pMUT1 as an expression vector can improve the production of beta-alanine. Using glycerol as a carbon source, the production of beta-alanine is increased by 1.05 times compared with the EcN-19 strain, and the yield reaches 3.04 g / L.

[0217] Table 14: Primer sequences

[0218]

[0219] Example 15: Optimization of the shake flask culture conditions of the engineered strain EcN-20 and the process of fermenting to produce beta-alanine.

[0220] 1. The ability of different engineered strains to produce beta-alanine

[0221] The chassis strain EcN-6 and the engineered strain EcN-20 constructed in Example 14 were respectively subjected to fermentation experiments in shake flasks to compare the ability of the strains to produce beta-alanine before and after modification. The shake flask fermentation experiments were performed according to the following scheme:

[0222] Each strain was streaked onto an LB plate containing 0.1 mg / mL ampicillin resistance and incubated in a 37°C incubator overnight. A single colony was picked and inoculated into 5 mL of LB liquid medium, and incubated in a 37°C incubator at a speed of 200 rpm overnight to obtain a seed solution. The LB plate medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 2 g / L, pH natural. The LB liquid medium: peptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH natural.

[0223] In 250 mL of shake flask, 50 mL of basic salt M9 medium was added, and 1 mL of seed liquid was inoculated into the basic salt M9 medium of the shake flask. Then the shake flask was cultured in a 37°C incubator at a rotation speed of 200 rpm for 24 hours, 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken, and then it was derivatized, filtered through an organic membrane with a pore size of 0.45 μm, and then the filtrate was analyzed by HPLC to analyze the content of β-alanine in the fermentation broth as described in Example 1. Finally, the amount of β-alanine obtained by the strain before and after modification was compared, and the results are shown in Table 1. Figure 26 .

[0224] The composition of the basic salt M9 medium is: K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH value is 7.0.

[0225] After fermentation, it was found that the modified strain had the ability to produce β-alanine, and the modification of the β-alanine transport system significantly improved the tolerance of the strain to high-concentration β-alanine. The strain after modification had 1.6 g / L improvement in the production of β-alanine compared with the original strain.

[0226] 2. Carbon source optimization

[0227] The carbon source optimization medium is: 10 g / L carbon source, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, (NH4)2SO4 2 g / L, MgSO4 0.3 g / L, tryptone 1 g / L, solvent is ddH2O, pH value is 7.0. The carbon source is a mixture of glucose and glycerol with a mass ratio of 1:1, 2:1, 3:1, 4:1, and 5:1.

[0228] In 250 mL of shake flask, 50 mL of carbon source optimization medium was added, 1 mL of seed liquid prepared in step 1 was added, and it was cultured in a 37°C incubator at a rotation speed of 200 rpm for 24 hours. 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken, and the content of β-alanine in the fermentation broth was analyzed by the method of step 1. The results are shown in Table 2. Figure 2 .

[0229] 3. Nitrogen source optimization

[0230] Nitrogen source optimized medium: 2-6 g / L nitrogen source, 8 g / L glucose, 2 g / L glycerol, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, MgSO4 0.3 g / L, solvent is ddH2O, pH value is 7.0.

[0231] Select 2 g / L urea, 2 g / L glutamine, 2 g / L ammonium succinate, 2 g / L urea + 2 g / L glutamine, 2 g / L urea + 2 g / L glutamine, 2 g / L ammonium succinate + 2 g / L glutamine, 2 g / L urea + 2 g / L glutamine + 2 g / L ammonium succinate as nitrogen source.

[0232] Add 50 mL of nitrogen source optimized medium to a 250 mL shake flask, add 1 mL of seed liquid prepared in step 1, cultivate in a 37℃ incubator at a speed of 200 rpm for 24 hours, take 1 mL of liquid from the shake flask, centrifuge at 9000 rpm for 1 min, take the supernatant, and analyze the biomass and β-alanine content in the fermentation broth by the method of step 1, the results are shown in Figure 28 The optimal nitrogen source is 2 g / L urea + 2 g / L glutamine + 2 g / L ammonium succinate combination.

[0233] Therefore, the optimized fermentation medium composition is: 8 g / L glucose, glycerol 2 g / L, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, MgSO4 0.3 g / L, NH4Cl 1 g / L, tryptone 1 g / L, 2 g / L urea, 2 g / L glutamine, 2 g / L ammonium succinate, solvent is ddH2O, pH value is 7.0.

[0234] 4. Optimized fermentation medium

[0235] Respectively, 1 ml of seed liquid of EcN-6 and EcN-20 prepared in step 1 was inoculated into a shake flask containing 50 mL of optimized fermentation medium, and cultivated in a 37℃ incubator at a speed of 200 rpm for 24 hours, 1 mL of liquid was taken from the shake flask, centrifuged at 9000 rpm for 1 min, the supernatant was taken, and the biomass and β-alanine content in the fermentation broth were analyzed by the method of step 1, wherein the HPLC chart of EcN-20 fermentation broth is shown in Figure 30 The high performance liquid chromatogram of β-alanine standard with different concentrations (1 mM, 5 mM, 10 mM, 20 mM, 40 mM) is shown in Figure 29 .

[0236] The most optimal strain EcN-20 after modification in the optimized fermentation medium for the production of beta-alanine was increased from 2.05 ± 0.1 g / L to 3.54 ± 0.1 g / L compared to EcN-6. Figure 31 ).

[0237] Example 16, fed-batch fermentation culture of engineered strain EcN-20 in a 5 L fermenter.

[0238] (1) Activation culture:

[0239] The -80℃ glycerol-preserved EcN-20 was activated and cultured in LB liquid medium at 37℃ for 12 h. EcN ΔcycA ΔfumB 1 ΔaspC Δpyk ΔpckA ΔlacI ΔgldA ΔdhaK ΔygeA ΔasnA ΔnadB ΔdhaK Δ pMUT1 / pMUT1 - P J23100 -panD K43Y -aspB-ydcZ- yddG-rocG / pSU19 -P tac -aspA-ppC-glpF-glpD-glnA The strain was streaked on LB plate medium and cultured overnight at 37℃ in an incubator to obtain activated bacteria; LB plate medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, 2 g / L of agar, solvent is water, and pH value is natural.

[0240] (2) Seed culture: Fresh activated bacteria of step (1) were picked and inoculated into LB liquid medium test tubes and cultured overnight at 37℃ with a shaking speed of 220 r / min, and then the culture was transferred to a 250 mL flask containing 50 mL of LB liquid medium with a volume concentration of 1% inoculation amount, and cultured overnight at 37℃ with a shaking speed of 220 r / min, to obtain a seed liquid. LB liquid medium: 10 g / L of proteose peptone, 5 g / L of yeast extract, 10 g / L of NaCl, solvent is water, and pH value is natural.

[0241] (3) Fed-batch fermentation culture:

[0242] According to the volume concentration of 5%, the seed liquid of step (2) was inoculated into a 5 L fermenter with a liquid volume of 2 L in the fermenter medium, the culture temperature was 37℃, the pH value was 7.0, and the dissolved oxygen value was maintained at 20%. After 8 h of fermentation, the glucose was supplemented to 10-15 g / L every 2 h according to the consumption of glucose by adding a feed medium (without adding glycerol as a control), so that the residual sugar was controlled at 3-5 g / L, until the end of fermentation, to obtain a fermentation liquid containing beta-alanine, the total fermentation time was 60 h, and the total consumption of feed medium was 1 L. During the feeding process, the cell growth OD was measured every 2 h.600 glucose residual sugar amount (residual sugar analyzer), and beta-alanine concentration (same as Example 1 HPLC). As shown in Table 1, OD Figure 32 600 When grown to about 28.4, the beta-alanine production reached 42.5 g / L. As shown in Table 1, OD Figure 33 600 When grown to about 22.5, the beta-alanine production reached 58.4 g / L.

[0243] Fermentation tank medium: 20 g / L glucose, K2HPO4 3H2O 28 g / L, KH2PO4 10.4 g / L, NH4Cl 4 g / L, MgSO4 0.6 g / L, tryptone 2 g / L, yeast extract 4 g / L, succinate amine 2 g / L, glutamine 2 g / L, urea 5 g / L, 1 mL / L 10x metal ions, 1 mL / L silicone antifoam agent, solvent is water; 10x metal ion formula: 10 g CaCl2, 10 g FeSO4 7H2O, 1 g ZnSO4 7H2O, 0.2 g CuSO4 and 0.02 g NiCl2 7H2O dissolved in 100 mL ddH2O;

[0244] The composition of the feed medium: glucose 400 g / L, glycerol 200 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, (NH4)2SO4 30 g / L, MgSO4 0.6 g / L, succinate amine 6 g / L, glutamine 6 g / L, antifoam agent 1 mL / L, antifoam agent is silicone antifoam agent, solvent is water.​​

Claims

1. An engineered bacterium with high β-alanine production using a cryptic plasmid as an expression vector, characterized in that, The engineered bacteria are constructed as follows: E. coli Nissle 1917 ΔcycA ΔfumB 1 ΔaspCΔpyk / pGLO-P J23100 - panD K43Y -aspB / pSU19-P J23100 - ppC - aspA The engineered bacteria are constructed as follows: (1) knocking out the gene in the genome of the chassis strain, i.e. engineering strain ECN-7; pckA gene, i.e. engineering strain ECN-7; (2) On the basis of engineering bacteria ECN-7, the genome of the lacI gene is knocked out, that is, engineering bacteria ECN-8; (3) On the basis of the engineering bacteria ECN-8, plasmid pSU19 and promoter P tac overexpression glpF gene, namely engineering bacteria ECN-9; (4) Based on the engineered bacteria ECN-9, knock out the genome asnA The gene, namely the engineered bacteria ECN-10; (5) On the basis of the engineering bacteria ECN-10, the gene in the genome is knocked out, that is, engineering bacteria ECN-11; ygeA gene, that is, engineering bacteria ECN-11; (6) On the basis of the engineering bacteria ECN-11, plasmid pSU19 and promoter P tac overexpression glpD gene, namely engineering bacteria ECN-12; (7) On the basis of engineering bacteria ECN-12, the gene in the genome is knocked out, that is, engineering bacteria ECN-13; gldA gene, that is, engineering bacteria ECN-13; (8) On the basis of engineering bacteria ECN-13, the gene in the genome is knocked out, that is, engineering bacteria ECN-14; nadB gene, that is, engineering bacteria ECN-14; (9) On the basis of engineering bacteria ECN-14, the gene in the genome is knocked out, that is, engineering bacteria ECN-15; dhaK gene, that is, engineering bacteria ECN-15; (10) On the basis of the engineering bacteria ECN-15, plasmid pGLO and promoter P J23100 overexpression ydcZ gene, namely engineering bacteria ECN-16; (11) On the basis of the engineering bacteria ECN-16, plasmid pGLO and promoter P J23100 overexpression yddG gene, namely engineering bacteria ECN-17; (12) On the basis of engineering bacteria ECN-17, plasmid pGLO and promoter P J23100 overexpression rocG gene, namely engineering bacteria ECN-18; (13) On the basis of the engineering bacteria ECN-18, the plasmid pSU19 and the promoter P tac overexpression glnA gene, namely engineering bacteria ECN-19; (14) On the basis of engineering bacteria ECN-19, eliminate pMUT1 plasmid in the genome, and replace pGLO plasmid overexpression with pMUT1 as a carrier panD, aspB, yddG, ydcZ, rocG The gene is engineering bacteria ECN-20; The yddG gene nucleotide sequence is shown as 1667167-1668048 of NZ_CP007799.1 in NCBI, ydcZ gene nucleotide sequence is shown as 1636228-1636677 of NZ_CP007799.1 in NCBI, rocG gene nucleotide sequence is shown as 3882132-3883439 of CP147877.1 in NCBI; the glpF gene nucleotide sequence is shown as 4540078-4540923 of NZ_CP007799.1 in NCBI, glpD gene nucleotide sequence is shown as 3918024-3919529 of NZ_CP007799.1 in NCBI, glnA gene nucleotide sequence is shown as 4483254-4484663 of NZ_CP007799.1 in NCBI.

2. The engineered bacterium of claim 1, wherein, The promoter P tac The nucleotide sequence is shown in SEQ ID NO.

1.

3. The engineered bacterium of claim 1, wherein, The nucleotide sequence of the pMUT1 plasmid is shown as SEQ ID NO.

2.

4. A method for producing β-alanine by double carbon source fermentation using the engineered bacteria of claim 1, wherein the engineered bacteria of claim 1 is used. The method is: The engineering bacteria are inoculated into a fermentation medium, and fermentation culture is carried out at 37℃ and 200 rpm to obtain a fermentation liquor containing beta-alanine; the fermentation medium consists of: glucose 8 g / L, glycerol 2 g / L, K2HPO4·3H2O 14 g / L, KH2PO4 5.2 g / L, MgSO4 0.3 g / L, NH4Cl 1 g / L, tryptone 1 g / L, 2 g / L urea, 2 g / L glutamine, 2 g / L ammonium succinate, and the solvent is ddH2O, and the pH value is 7.

0.

5. The method of claim 4, wherein, The engineering bacteria are inoculated into a fermentation tank medium, the culture temperature is 37℃, the pH value is 7.0, and the dissolved oxygen value is maintained at 20%; after 8 hours of fermentation, glucose is supplemented to 10-15 g / L by feeding medium according to the consumption of glucose every 2 hours, so that the residual sugar is controlled at 3-5 g / L, until the end of fermentation, to obtain a fermentation liquor containing beta-alanine; The fermentation tank medium consists of: 20 g / L glucose, K2HPO4·3H2O 28 g / L, KH2PO4 10.4 g / L, NH4Cl 4 g / L, MgSO4 0.6 g / L, tryptone 2 g / L, yeast extract 4 g / L, amine succinate 2 g / L, glutamine 2 g / L, urea 5 g / L, 1 mL / L 10 × metal ions, 1 mL / L silicone antifoam agent, and the solvent is water; the 10 × metal ion formula is: 10 g CaCl2, 10 g FeSO4·7H2O, 1 g ZnSO4·7H2O, 0.2 g CuSO4 and 0.02 g NiCl2·7H2O dissolved in 100 mL ddH2O; The feeding medium consists of: glucose 400 g / L, glycerol 200 g / L, yeast extract 4 g / L, KH2PO4 14 g / L, (NH4)2SO4 30 g / L, MgSO4 0.6 g / L, amine succinate 6 g / L, glutamine 6 g / L, antifoam agent 1 mL / L, and the solvent is water.

6. The method of claim 5, wherein, The engineering bacteria are inoculated into a fermentation medium or a fermentation tank medium at an inoculation amount of 2-5% by volume concentration after performing slope activation and seed amplification culture before fermentation, and the seed liquid preparation method is: (1) The engineering bacteria are inoculated on LB plates containing 0.1 mg / mL ampicillin resistance and cultured in a 37°C incubator overnight; the LB plate culture medium: 10 g / L proteose peptone, 5 g / L yeast extract, 10 g / L NaCl, 2 g / L agar, solvent is water, pH value is natural; (2) Single colonies of step (1) are inoculated into LB liquid medium and cultured in a 37°C incubator at a speed of 220 rpm overnight to obtain a seed solution.

Images