HPV (human papillomavirus) neutralizing antibody pseudovirus as well as preparation method and application thereof

Abstract

The invention provides an HPV (human papillomavirus) neutralizing antibody pseudovirus as well as a preparation method and application thereof, and belongs to a transgenic technology. The method comprises the following steps: firstly, constructing a 293TT cell strain capable of stably and highly expressing SV40 large T antigen, wherein the 293TT cell strain is used as an HPV (human papillomavirus) neutralizing antibody pseudovirus packaging tool cell; then fusing a 6X His tag at the N end or the C end of the L1 and L2 genes of the main capsid protein of the HPV virus to construct plasmids; the constructed plasmids and reporter gene plasmids jointly transfect 293TT cells, and after transfection, a Ni column is combined with a His tag for purification to obtain the neutralizing antibody pseudovirus. The pseudovirus is purified by using the Ni column, which is simple and efficient; the purified pseudovirus is high in purity, high in infection activity and complete in structure, and the particle size of the pseudovirus is consistent with that of the HPV live virus, and the structure is similar to that of the HPV live virus.

Description

Technical Field

[0001] The present invention belongs to transgenic technology, relates to HPV neutralizing antibody pseudovirus, and specifically relates to an HPV neutralizing antibody pseudovirus and a preparation method and application thereof. Background Art

[0002] Human papillomavirus (HPV) is a non-enveloped double-stranded circular DNA virus belonging to the family Papillomaviridae. Currently, the International Human Papillomavirus Reference Center has confirmed 231 types of HPV and assigned type numbers to them, and established a clone information library. Different HPVs can cause different harms to the human body due to their own characteristics. According to their carcinogenicity, they can be divided into three types: low-risk, medium-risk, and high-risk. In most cases, the virus will be cleared by the immune system in time after entering the human body, but HPV viruses that are not cleared will induce human lesions. If they are not discovered and treated in time, they will eventually develop into cervical cancer.

[0003] HPV is a type of small dsDNA virus, about 8000bp in size. Human skin, oral cavity and genital mucosa are the main sites of damage. Each HPV virus particle is composed of an icosahedral capsid of about 60nm in size. The HPV genome coding region generally contains 8 ORFs, which encode different proteins. According to the different expression times, it is divided into: early region (early, E), late region (late, L) and noncoding region (noncoding region, NCR). Among them, the early region is located downstream and encodes non-structural proteins involved in the replication and transcription of the virus, which are: E1, E2, E4, E5, E6 and E7. The late region is about 2500bp long and encodes L1 and L2 structural proteins. L1 and L2 proteins together constitute the capsid of the virus. The noncoding region is about 850bp in size and is located upstream, between the ORFs of L1 and E6. It is also called the upstream regulatory region. Although this region does not encode proteins, it contains many regulatory elements including ori, most of which are related to the replication and transcription of viral DNA.

[0004] The L1 protein of papillomavirus is the main capsid protein. It can be assembled into virus-like particles (VLP) when expressed alone. Immunization with this VLP can produce high titers of neutralizing antibodies, which means that papillomavirus VLP can be used as an ideal preventive vaccine. Experiments conducted on experimental animals have shown that papillomavirus VLP vaccines can effectively protect experimental animals from papillomavirus infection. Transferring the serum of immunized animals to non-immunized animals can also prevent the animals receiving the serum from being infected by papillomavirus, which shows that the protective effect after VLP immunization is mediated by neutralizing antibodies. Clinical trials conducted on humans have shown that HPV VLP can induce strong humoral and cellular immune responses.

[0005] L2 is a minor capsid protein besides L1, with a protein size of about 72kDa and a lower conservation than L1. L2 and L1 together form the outer shell of the virus particle. Unlike L1, the amount of L2 involved in the formation of the viral capsid is still uncertain. The L2 minor capsid protein has many functions, including packaging DNA, participating in viral infection of cells, conformational changes of the capsid during entry into cells, destroying the intracellular membrane, and subcellular transport of the viral genome into the cell.

[0006] The capsid of the virus is composed of L1 and L2 proteins. L1 protein is encoded by L1ORF. Since L1ORF is highly conserved, it is used as the basis for HPV typing. L1 protein is about 55-60kDa in size and is the main capsid protein of the virus particle. Generally, 5 L1 proteins polymerize to form a pentamer, and 72 pentamers and a certain number of L2 proteins together form a viral capsid with a 20-hedral structure of T=7. L1 protein contains 12 cysteine ​​residues, of which Cys174 and Cys428 are highly conserved. The outward extension of the C-terminal of L1 protein is also called the C-terminal arm. The interaction of two adjacent L1 proteins through the C-terminal arm leads to the formation of a disulfide bond between Cys175 and Cys428 between the two adjacent L1 proteins. This disulfide bond is very important for the formation of the outer shell of the virus particle and is also of great significance for maintaining the stability of the virus particles.

[0007] The codons used in the genes encoding the structural proteins L1 and L2 of HPV are very different from those in mammalian cells, resulting in very low expression efficiency of L1 and L2 in mammalian cells. This strict restriction of gene expression is a way for HPV to evade detection by the host's immune system. In order to improve the efficiency of gene expression, the researchers humanized and optimized the L1 gene of HPV16. After transfection, its expression in cells increased by more than 100 times, laying the foundation for a new pseudovirus production method.

[0008] A method of utilizing HPV VLP for gene transduction is to form a complex with the target DNA and VLP, and this complex is also referred to as a pseudotype virus or a pseudovirus. There are multiple specific methods for producing VLP-DNA complexes. One of them is to treat the purified HPV VLP with polylysine and then mix it with a reporter plasmid to form a VLP-DNA complex, which can enter a variety of cells and express the reporter plasmid in the target cells. Producing pseudoviruses by direct action of VLP and DNA is a convenient and efficient method, and the pseudoviruses can also be used for neutralizing the evaluation of monoclonal antibodies and polyclonal antibodies.

[0009] The above pseudovirus production methods, especially the direct action method, can easily produce HPV pseudoviruses with high purity for research. However, the expression and purification of VLPs require a long cycle and multiple ultracentrifugation, resulting in high cost of pseudovirus production and difficulty in mass production. Therefore, it is not suitable for large-scale monoclonal antibody and polyclonal antibody serum neutralization evaluation.

[0010] HPV preventive vaccination is considered the most fundamental means to prevent HPV infection and cervical cancer. There are different HPV vaccines on the market, which can be divided into three types, namely bivalent (preventing 2 HPV subtypes, HPV16 / HPV18), quadrivalent (preventing 4 HPV subtypes, HPV6 / HPV11 / HPV16 / HPV18) and nine-valent HPV vaccine (preventing 9 HPV subtypes, HPV6 / HPV11 / HPV16 / HPV18 / HPV31 / HPV33 / HPV45 / HPV52 / HPV58). Among them, the only nine-valent HPV vaccine is GARDASIL 9 produced by MSD (MerckSharp & Dohme) in the United States. Taking the production process of the nine-valent HPV preventive vaccine as an example, the human papillomavirus major capsid protein L1 gene is integrated into the yeast genome or insect virus genome using recombinant DNA technology.

[0011] The key to the success of preventive vaccines is whether they can induce effective humoral immunity. Only by producing neutralizing antibodies against HPV can we resist infection with foreign HPV. Therefore, establishing a stable and effective vaccine evaluation system to detect the protective effect of vaccine immune response is of great significance for vaccine development and quality control. However, since the life cycle of HPV is closely related to the differentiation state of cells, it cannot grow and reproduce in vitro through traditional cell culture systems, and the amount of virus extracted from infected pathological tissues is too small to meet the needs of neutralization tests.

[0012] Buck et al. took advantage of the ability of papillomavirus to non-specifically package DNA and co-transfected the plasmid containing the optimized papillomavirus L1 and L2 genes with a reporter plasmid expressing GFP. After 48 hours, the cells were harvested and lysed to successfully produce high titer BPV1 and HPV16 pseudoviruses, with the highest titer reaching 10 9 PFU / mL, which is 107 times the expression efficiency of the recombinant SFV system used earlier (Buck CB, Pastrana DV, Lowy DR, et al. Efficient Intracellular Assembly of Papillomaviral Vectors [J]. Journal of Virology, 2004). The disadvantage of this technology is that it requires OptiPrep gradient centrifugation for concentration and purification, which is cumbersome and requires the addition of additional substances.

[0013] Chen Hongwei and others improved the insect cell expression and purification system of HPV16L1 protein, and disclosed an economical, simple and time-saving method for preparing HPV16 virus-like particles (VLP) vaccine. The method is to recombinantly insert the L1 gene of HPV16 into the baculovirus genome with a 6xHis tag, and transfect the insect cell SF9 for expression. The expressed protein was purified by nickel column, the protein biological activity was identified by mouse red blood cell agglutination test and agglutination inhibition test, and the VLP formation was observed by transmission electron microscopy (Chen Hongwei, Zheng Jin, Yang Xiaofeng, et al. Preparation of HPV16L1VLP using His-baculovirus expression system [J]. Journal of Northwest University: Natural Science Edition, 2005). The disadvantages of this technology are that the expression efficiency of L1 protein in insect cells is low, and the prepared VLP is only formed by self-assembly of L1 protein, lacking L2 protein and contained genes, and the particle diameter is smaller than that of native virus particles, and the ability to produce neutralizing antibodies is poor. Summary of the invention

[0014] The present invention aims at the problems of low in vitro synthesis yield of HPV neutralizing antibody pseudovirus and cumbersome concentration and purification methods in the prior art, and provides an HPV neutralizing antibody pseudovirus and its preparation method and application. The present invention first constructs a 293TT cell line that stably and highly expresses SV40 large T antigen, which is used as a tool cell for packaging HPV neutralizing antibody pseudovirus; then, 6X His tags are fused to the N-termini of the HPV virus major capsid protein L1 and L2 genes respectively, and the constructed plasmid and the double reporter gene plasmid are co-transfected into 293TT cells. After transfection, the neutralizing antibody pseudovirus can be purified by combining the His tag with a Ni column. The present application uses a Ni column to purify pseudovirus, which is simple and efficient; the purified neutralizing antibody pseudovirus has high purity, high infection activity, and complete structure, and is consistent with the HPV live virus particle size and similar structure.

[0015] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0016] In one aspect, the present invention provides a method for preparing a HPV neutralizing antibody pseudovirus, comprising the following steps:

[0017] S1. Construction of stable cell lines;

[0018] S2, construction of structural plasmid and reporter gene plasmid;

[0019] The structural plasmid is any one of the following three situations:

[0020] (1) HPV capsid protein L1 gene containing an N-terminal or C-terminal fused His tag;

[0021] (2) HPV viral capsid protein L2 gene containing an N-terminal or C-terminal fused His tag;

[0022] (3) A combination of the above two;

[0023] S3, co-transfecting the structural plasmid and reporter gene plasmid in S2 into the stable cell line in S1, and culturing the cells;

[0024] S4, collecting the cells cultured in S3, lysing them, and centrifuging them to obtain a supernatant;

[0025] S5. Filter the supernatant in S4 and purify it using nickel column affinity chromatography to obtain HPV neutralizing antibody pseudovirus.

[0026] Preferably, the step S1 comprises the following steps:

[0027] The DNA sequence of SV40 large T antigen fused with 3×FLAG tag at the C-terminus was inserted into the vector plasmid to construct the target plasmid.

[0028] Preferably, the DNA sequence of the SV40 large T antigen fused with a 3×FLAG tag at the C-terminus is the sequence shown in SEQ ID NO.1.

[0029] Preferably, the step S1 comprises the following steps:

[0030] The above-mentioned target plasmid and the auxiliary plasmid were co-transfected into 293T cells to obtain 293TT cells expressing SV40 large T antigen.

[0031] Preferably, the sequence of the HPV virus capsid protein L1 gene in step S2 is the sequence shown in SEQ ID NO.4, and the sequence of the HPV virus capsid protein L2 gene is the sequence shown in SEQ ID NO.2.

[0032] Preferably, the structural plasmid in step S2 contains both the HPV virus capsid protein L1 gene fused to the N-terminus with a His tag and the HPV virus capsid protein L1 gene fused to the N-terminus with a His tag.

[0033] Preferably, the N-terminus of the HPV virus capsid protein L2 gene in step S2 is fused with a 6×His tag, and the HPV virus capsid protein L2 gene after the N-terminus of the His tag is fused includes the sequence shown in SEQ ID NO.3.

[0034] Preferably, in step S2, the N-terminus of the HPV virus capsid protein L1 gene is fused with a 6×His tag, and the HPV virus capsid protein L1 gene after the N-terminus of the His tag is fused includes the sequence shown in SEQ ID NO.5.

[0035] Preferably, the reporter gene plasmid in step S2 contains a fluorescent protein gene or a luciferase gene.

[0036] Preferably, the fluorescent protein includes GFP, RFP, YFP or BFP.

[0037] Preferably, the fluorescent protein is GFP, and the gene of the GFP is the sequence shown in SEQ ID NO.7.

[0038] Preferably, the luciferase comprises firefly luciferase, Gaussia luciferase, Renilla luciferase or nanoluciferase.

[0039] Preferably, the luciferase is firefly luciferase, and the gene of the firefly luciferase is the sequence shown in SEQ ID NO.8.

[0040] Preferably, the nickel column affinity chromatography method in step S5 comprises using Ni-NTA column material for chromatography.

[0041] In another aspect, the present invention provides a pseudovirus prepared by the above preparation method.

[0042] In another aspect, the present invention provides the above preparation method or the use of the above pseudovirus, wherein the use comprises infecting mammalian cells to prepare the pseudovirus.

[0043] Preferably, the mammalian cell includes a human cell line, a Chinese hamster cell line or a rat cell line.

[0044] Preferably, the mammalian cell is a HEK293 cell, a CHO cell, a Vero cell or a Hela cell.

[0045] Compared with the prior art, the present invention has the following beneficial effects:

[0046] 1. By fusing and expressing 6x His tags at the N-termini of the major capsid protein L1 and minor capsid protein L2 genes, and expressing them in combination, it was proved that the combination can form a neutralizing antibody pseudovirus;

[0047] 2. HPV neutralizing antibody pseudovirus purification can be achieved by using nickel column with His tag, which is simple and efficient;

[0048] 3. The purified HPV neutralizing antibody pseudovirus has high purity, high infection activity, and complete structure. It is consistent with the HPV live virus particle size and similar structure. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] Figure 1 The pseudovirus silver staining test results of p6 L1-6x His L2 neutralizing antibody purified by Ni purification kit.

[0050] Figure 2 Pseudovirus silver staining test results for p6 6x His-L1 L2 neutralizing antibody purified by Ni purification kit.

[0051] Figure 3 Pseudovirus silver staining test results for p6 L1 6x His-L2 neutralizing antibody purified by Ni purification kit.

[0052] Figure 4 Pseudovirus silver staining test results of p6 6x His-L1 6x His-L2 neutralizing antibody purified by Ni purification kit.

[0053] Figure 5 The expression of reporter gene ZsGreen after different samples infected 293T cells.

[0054] Figure 6 This is the luciferase expression of samples from each link of the p6 6x His-L1 6x His-L2 group after infecting 293T cells.

[0055] Figure 7 This is the standard test report for the pseudovirion size of the p6 6x His-L1 6x His-L2 neutralizing antibody.

[0056] Figure 8 This is the standard test report for the pseudovirion size of the p6 6x His-L1 6x His-L2 neutralizing antibody. DETAILED DESCRIPTION

[0057] It is worth noting that the raw materials used in the present invention are all common commercially available products, and their sources are not specifically limited.

[0058] The following sources of raw materials are provided for illustrative purposes:

[0059] Example 1: Construction of 293TT cell line

[0060] 1) The SV40 large T antigen sequence was obtained by the whole gene synthesis method (Tianlin Biotechnology Wuxi Co., Ltd.), as shown in Table 1.

[0061] Table 1 Description of gene sequence

[0062]

[0063] SEQ ID NO.1:

[0064] ATGGACAAGGTGCTGAATAGAGAGGAGAGCCTGCAACTGATGGATCTGCTGGGCC

[0065] TGGAGAGGTCCGCCTGGGGAAATATCCCCCTGATGAGGAAGGCTTATCTGAAGAAGTG

[0066] CAAGGAGTTCACCCTGATAAGGGCGGCGATGAGGAGAAGATGAAGAAGATGAATAC

[0067] CCTGTATAAAAAGATGGAGGACGGCGTGAAGTACGCCCACCAGCCTGACTTTGGCGGC

[0068] TTCTGGGATGCCACAGAGATCCCCACCTACGGCACCGATGAGTGGGAGCAGTGGTGGA

[0069] ACGCCTTCAATGAGGAGAACCTGTTCTGTAGCGAGGAGATGCCTTCCTCCGATGACGA

[0070] GGCCACAGCCGACAGCCAGCACTCCACCCCTCCCAAGAAGAAGAGAAAGGTGGAGGA

[0071] CCCCAAGGACTTCCCCTCCGAGCTGCTGAGCTTTCTGAGCCACGCCGTGTTCTCCAACA

[0072] GAACACTGGCCTGTTTCGCCATCTACACCACAAAGGAGAAGGCCGCCCTGCTGTATAA

[0073] AAAAATCATGGAGAAGTACAGCGTGACCTTTATCAGCAGACACAACTCCTACAACCAC

[0074] AACATCCTGTTCTTCCTGACCCCTCACAGACACAGAGTGAGCGCCATCAATAATTACGC

[0075] CCAGAAGCTGTGTACCTTTAGCTTTCTGATCTGTAAGGGCGTGAACAAGGAGTACCTG

[0076] ATGTACTCCGCCCTGACCAGGGACCCTTTCTCCGTGATCGAGGAGTCCCTGCCTGGCGG

[0077] CCTGAAGGAGCACGACTTCAACCCCGAGGAGGCCGAGGAGACAAAGCAGGTGTCCTG

[0078] GAAGCTGGTGACCGAGTACGCTATGGAAACCAAGTGCGACGACGTGCTGCTGCTGCTG

[0079] GGCATGTACCTGGAGTTTCAGTACAGCTTTGAGATGTGCCTGAAGTGTATCAAGAAGG

[0080] AGCAGCCTAGCCACTACAAGTACCACGAGAAGCACTACGCCAACGCCGCCATCTTTGC

[0081] CGATTCCAAGAACCAGAAGACCATCTGTCAGCAGGCCGTGGATACCGTGCTGGCCAAG

[0082] AAGAGAGTGGATTCCCTGCAACTGACAAGAGAGCAGATGCTGACAAACAGGTTCAAT

[0083] GATCTGCTGGACAGGATGGACATCATGTTCGGCAGCACAGGCTCCGCCGACATCGAGG

[0084] AGTGGATGGCCGGCGTGGCCTGGCTGCACTGTCTGCTGCCCAAGATGGACAGCGTGGT

[0085] GTACGACTTCCTGAAGTGTATGGTGTATAATATCCCCAAGAAGAGGTACTGGCTGTTTA

[0086] AGGGACCTATCGACTCCGGCAAGACCACACTGGCCGCCGCCCTGCTCGAACTGTGTGG

[0087] CGGAAAGGCCCTGAATGTGAACCTGCCCCTGGATAGACTGAATTTCGAGCTGGGCGTG

[0088] GCCATCGACCAGTTTCTGGTGGTGTTTGAGGACGTGAAGGGCACCGGCGGCGAGAGCA

[0089] GGGACCTGCCTAGCGGACAGGGCATCAACAATCTGGACAACCTGAGAGATTACCTGGA

[0090] TGGCTCCGTGAAGGTGAATCTGGAGAAGAAGCACCTGAATAAGAGGACACAGATTTTT

[0091] CCCCCCGGCATCGTGACAATGAACGAGTACTCCGTGCCCAAGACCCTGCAAGCCAGGT

[0092] TTGTGAAGCAGATCGACTTTAGGCCAAAGGATTACCTGAAGCACTGTCTGGAGAGATC

[0093] CGAGTTCCTGCTGGAGAAGAGGATCATCCAGAGCGGCATCGCCCTGCTGCTGATGCTG

[0094] ATCTGGTACAGGCCAGTGGCCGAGTTTGCCCAGAGCATCCAGTCCAGGATCGTGGAGT

[0095] GGAAGGAGAGACTGGATAAGGAGTTCTCCCTGTCCGTGTACCAGAAGATGAAGTTCAA

[0096] TGTGGCTATGGGTATCGGCGTGCTGGATTGGCTGAGGAACAGCGACGATGATGATGAG

[0097] GATTCCCAGGAGAATGCCGACAAGAATGAGGATGGCGGCGAGAAGAACATGGAGGAC

[0098] AGCGGCCACGAGACAGGCATCGATAGCCAGAGCCAGGGCTCCTTCCAGGCCCCTCAGA

[0099] GCAGCCAGTCCGTGCACGACCACAACCAGCCTTACCACATCTGTAGGGGCTTTACATG

[0100] CTTTAAGAAGCCTCCTACCCCCCCTCCTGAGCCCGAGACAAGCGGCCGCGGAATGGAC

[0101] TACAAGGATGACGATGACAAGGATTACAAAGACGACGATGATAAGGACTATAAGGATGATGACGACAAATGA.

[0102] 2) The vector pLVX-CMV-MCS (plasmid purchased from Addgene, catalog number 164589) was double-digested with restriction endonucleases XbaI and NotI to obtain a linearized vector, and the linearized vector was ligated with the synthesized SEQ ID NO.1 by homologous recombination technology to obtain the pLVX-CMV-SV40 Large T Antigen-3xFLAG-IRES-Puromycin plasmid, as shown in the map Figure 1 As shown, plasmid synthesis, construction and sequencing were completed by Tianlin Biotechnology Wuxi Co., Ltd.

[0103] 3) The target plasmid pLVX-CMV-SV40 Large T Antigen-3xFLAG and auxiliary plasmid psPAX2 (purchased from Addgene, catalog number #12260) and pMD2.G (purchased from Addgene, catalog number #12259) were used for 293T cell transfection at a ratio of 4.5 μg: 2.5 μg: 2 μg per d = 10 cm cell culture dish (purchased from NEST Wuxi Nice Life Science Co., Ltd., catalog number 704001). The transfection reagent was 1X PEI (purchased from PolySciences, catalog number 24765-1), and the total amount of plasmid and 1X PEI ratio was 1 μg: 3 μL; 24 hours after transfection, the culture supernatant was collected and replaced with fresh 2% FBS (Fetal Bovine Serum, fetal bovine serum, purchased from ExCell, catalog number FSP500) in DMEM culture medium (purchased from BasalMedia Shanghai Yuanpei Biotechnology Co., Ltd., catalog number L110KJ); 48 hours after transfection, the culture supernatant was collected again and the cells were discarded.

[0104] 4) The collected lentiviral supernatant was filtered using a 0.22 μm disposable syringe filter (purchased from Millipore, catalog number SLGP033RB). After filtration, 4.5 mL of the lentiviral supernatant was added to 293T cells (d=10 cm cell culture dish), supplemented with 0.5 mL of FBS, and the cells were digested and passaged 24 hours after infection.

[0105] 5) 24 hours after passage, 7 μL of puromycin (Puromycin, purchased from Solarbio, catalog number P8230) was added to the 293T cells infected with the lentivirus, and the final working concentration was 3.5 μg / mL;

[0106] 6) 48 hours after passage, the 293T cells infected with lentivirus were digested again and passaged again;

[0107] 7) Repeat the above steps 5) and 6) twice to finally obtain a 293TT cell line that highly expresses SV40 Large T Antigen.

[0108] Example 2: Preparation of HPV6 neutralizing antibody pseudovirus solution

[0109] 1) The whole gene synthesis method (synthesis company) obtained the relevant sequences for synthesizing pseudoviruses, as shown in Table 2.

[0110] Table 2 Description of gene sequence

[0111]

[0112]

[0113] SEQ ID NO.2:

[0114]

[0115] SEQ ID NO.3:

[0116]

[0117] SEQ ID NO.4:

[0118]

[0119] SEQ ID NO.5

[0120]

[0121] SEQ ID NO.6

[0122]

[0123] SEQ ID NO.7:

[0124] ATGGCCCAGTCCAAGCACGGCCTGACCAAGGAGATGACCATGAAGTACCGCATGGAGGGCTGCGTGGACGGCCACAAGTTCGTGATCACCGGCGAGGGCATCGGCTACCCCTTCAAGGGCAAGCAGGCCATCAACCTGTGCGTGGTGGAGGGCGGCCCCTTGCCCTTCGCCGAGGACATCTTGTCCGCCGCCTTCATGTACGGCAACCGCGTGTTCACCGAGTACCCCCAGGACATCGTCGACTACTTCAAGAACTCCTGCCCCGCCGGCTACACCTGGGACCGCTCCTTCCTGTTCGAGGACGGCGCCGTGTGCATCTGCAACGCCGACATCACCGTGAGCGTGGAGGAGAACTGCATGTACCACGAGTCCAAGTTCTACGGCGTGAACTTCCCCGCCGACGGCCCCGTGATGAAGAAGATGACCGACAACTGGGAGCCCTCCTGCGAGAAGATCATCCCCGTGCCCAAGCAGGGCATCTTGAAGGGCGACGTGAGCATGTACCTGCTGCTGAAGGACGGTGGCCGCTTGCGCTGCCAGTTCGACACCGTGTACAAGGCCAAGTCCGTGCCCCGCAAGATGCCCGACTGGCACTTCATCCAGCACAAGCTGACCCGCGAGGACCGCAGCGACGCCAAGAACCAGAAGTGGCACCTGACCGAGCACGCCATCGCCTCCGGCTCCGCCTTGCCCTGA;

[0125] SEQ ID NO.8:

[0126]

[0127] 2) The vector pUC-p16L1L2 (purchased from MIAOLING BIOLOGY, catalog number P13637) was double-digested with restriction endonucleases NotI and NheI to obtain a linearized vector, and the linearized vector was connected to the synthetic SEQ ID NO.2 and SEQ ID NO.5 by homologous recombination technology to obtain the pUC-p6 6x His-L1 L2 plasmid, and the linearized vector was connected to the synthetic SEQ ID NO.2 and SEQ ID NO.6 by homologous recombination technology to obtain the pUC-p6 L1-6x His L2 plasmid, and the linearized vector was connected to the synthetic SEQ ID NO.3 and SEQ ID NO.4 by homologous recombination technology to obtain the pUC-p6L16x His-L2 plasmid, and the linearized vector was connected to the synthetic SEQ ID NO.3 and SEQ ID NO.6 by homologous recombination technology to obtain the pUC-p6 6x His-L1 6x His-L2 plasmid, all plasmid synthesis, construction, sequencing and identification were completed by Tianlin Biotechnology Wuxi Co., Ltd.

[0128] 3) PCNDA3.1(+)eGFP vector (purchased from MIAOLING BIOLOGY, catalog number P64303) was double-digested with restriction endonucleases EcoRI and BstBI to obtain a linearized vector, and the linearized vector was connected with the synthesized SEQ ID NO.7 and SEQ ID NO.8 by homologous recombination technology to obtain the pCDNA3.1-ZsGreen-IRES-LUC2 plasmid. The plasmid synthesis, construction, sequencing and identification were all completed by Tianlin Biotechnology Wuxi Co., Ltd.

[0129] 4) HPV6 neutralizing antibody pseudovirus packaging and production:

[0130] a) resuscitation and amplification of the 293TT cell line constructed in Example 1. Before transfection, the cell confluence was observed under a microscope to be 80%, with clear cell edges and good growth status;

[0131] b) Before transfection, 293TT cells were cultured in 10 mL of DMEM containing 2% FBS per d = 10 cm dish to reduce the inhibition of serum on plasmid transfection;

[0132] c) Plasmids pUC-p6 6x His-L1 L2, pUC-p6 L1-6x His L2, pUC-p6 L1 6x His-L2, and pUC-p6 6xHis-L1 6x His-L2 were respectively used with reporter gene plasmid pCDNA3.1-ZsGreen-IRES-LUC2 at a ratio of 5.0 μg:5.0 μg per d=10 cm cell culture dish for 293TT cell transfection. The transfection reagent was 1X PEI, and the total amount of plasmid and the ratio of 1X PEI were 1 μg:3 μL. They were divided into 4 groups, and 12 dishes of 293TT cells were packaged in each group. The specific instructions are shown in Table 3. After 24 hours of transfection, the old culture supernatant was discarded and replaced with fresh DMEM culture medium containing 2% FBS. After 48 hours of transfection, the cells were collected and the clean culture medium was discarded.

[0133] Table 3 HPV6 neutralizing antibody pseudovirus packaging system

[0134]

[0135] d) The collected cell pellet was added with lysis buffer (main components: 2 mL 1x DPBS (purchased from Thermo Fisher Scientific, catalog number 14040133), 105 μL 0.35% Brij58 (purchased from Merck, product number P5884, catalog number 9004-95-9) and 30 μL 100× protease inhibitor mixture PIC (purchased from Solarbio, catalog number P6730)) for resuspending, placed in a CO2 superimposed constant temperature oscillator (purchased from Yonglian Biotechnology (Shanghai) Co., Ltd., model UL3L12C) at 37°C, and incubated at 120 rpm for 24 h.

[0136] e) The cell lysate was centrifuged using a high-speed desktop centrifuge (purchased from Hunan Xiangyi Laboratory Instrument Development Co., Ltd., model H1750R). After centrifugation at 5000 g for 5 min, the supernatant was removed and sterilized by filtering through a 0.22 μm disposable syringe filter to obtain four different groups of Pseudovirus-HPV6-ZsGreen-LUC neutralizing antibody pseudovirus solutions.

[0137] Example 3: Purification of different pseudovirus-HPV6-ZsGreen-LUC neutralizing antibody pseudovirus solutions

[0138] 1) The neutralizing antibody pseudovirus in Example 2 was purified using HisPur Ni NTA Kit (NTA kit, purchased from Changzhou Tiandi Renhe Biotechnology Co., Ltd., item number SA004K03). The HisPur Ni NTA Column was taken out and fixed on a centrifuge tube emergency rack, and the lower end plug and the upper end plug were removed in turn, and the protective liquid of the pre-packed column was drained and collected in a 15 mL centrifuge tube (purchased from NEST Wuxi Nice Life Science Co., Ltd., item number 601002) for use.

[0139] 2) Add 5 mL of Lysis / Wash Buffer to the column tube, equilibrate the column, and repeat twice after it is drained, using a total of 15 mL of Lysis / Wash Buffer.

[0140] 3) The four groups of HPV6 neutralizing antibody pseudovirus solutions in Example 2 were added to the column tubes respectively, and the effluent was collected. After it was drained, the collected solution was added back to the column tube. The operation was repeated twice. The effluent finally collected was marked as "FT" (flow-through in English, abbreviated as "FT").

[0141] 4) Add 5 mL of Lysis / Wash Buffer into the column tube, absorb impurities, collect the wash solution, and mark it as "W1" (Wash is abbreviated as "W" in English, and W1 represents the first round of wash solution); repeat the operation twice, collect the wash solutions respectively, and mark them as "W2" and "W3" (W2 represents the second round of wash solution, and W3 represents the third round of wash solution).

[0142] 5) Add 5 mL of Elution Buffer to the column tube to elute the target virus, collect the eluate and mark it as "E1"

[0143] (Elution in English is Elution, abbreviated as "E", E1 represents the first round of eluent); repeat the operation twice more, collect the eluent, and mark it as "E2" and "E3" (E2 represents the second round of eluent, and E3 represents the third round of eluent).

[0144] Example 4: Quality detection of purified HPV6 neutralizing antibody pseudovirus

[0145] 1) SDS-PAGE electrophoresis:

[0146] a) Sample treatment: Take 30 μL of the HPV6 neutralizing antibody pseudovirus solution before purification in Example 2 (the sample before purification is recorded as "Sample", abbreviated as "Sam"), the effluent FT of Example 3, the wash solutions W1, W2, W3 and the eluents E1, E2, E3, and then add 10 μL of 4X protein loading buffer (containing thiol reducing agent, purchased from Solarbio Life Sciences, product number P1016) in sequence, boil at 100°C for 10 min, briefly centrifuge and place on ice for use or store in a -80°C medical low-temperature refrigerator (purchased from Thermo Fisher Scientific, product model ULTS1368).

[0147] b) Sample loading: Take out FuturePAGE 4-20% 15Wells protein precast gel (purchased from ACE, product number ET15420Gel) from a 4°C refrigerator and load it into an electrophoresis tank device (purchased from Tanon, product number VE-180), fill it with MOPS-SDS RunningBuffer (from ACE, used with protein precast gel), add 10μL of the protein sample to be tested to each well in sequence, and then add 6μL Rainbow 245 Broad Spectrum Protein Marker (11-245KD, purchased from Solarbio Life Sciences, product number PR1920), and perform electrophoresis at 120V for 60-90min.

[0148] 2) Silver staining: Use a rapid silver staining kit (purchased from Beyotime Biotechnology Co., Ltd., catalog number P0017S), and the specific process is as follows.

[0149] a) Fixation: After the SDS-PAGE electrophoresis in step 1), the gel was placed in about 50 mL of fixative solution (mixed with 25 mL of anhydrous ethanol, 5 mL of acetic acid and 20 mL of ultrapure water), and shaken on a shaker at room temperature for 20 min at a speed of 60 rpm.

[0150] b) 30% ethanol washing: discard the fixative, add 50 mL 30% ethanol (mix 15 ml anhydrous ethanol and 35 ml ultrapure water), and shake on a shaker at room temperature for 10 min at a shaking speed of 60 rpm.

[0151] c) Water washing: discard 30% ethanol, add 50 mL of ultrapure water, and shake on a shaker at room temperature for 10 min at a shaking speed of 60 rpm.

[0152] d) Sensitization: discard the water, add 50 mL of 1X silver staining sensitization solution (add 0.5 mL of 100X silver staining sensitization solution to 49.5 mL of ultrapure water and mix well), and shake on a shaker at room temperature for 2 min at a shaking speed of 60 rpm.

[0153] e) Water washing: discard the sensitizing solution, add 50 mL of ultrapure water, and shake on a shaker at room temperature for 1 min at a shaking speed of 60 rpm; discard the water, add 50 mL of ultrapure water, and shake on a shaker at room temperature for 1 min at a shaking speed of 60 rpm.

[0154] f) Silver staining: discard the water, add 50 mL of 1X silver solution (add 0.5 mL of 100X silver solution to 49.5 mL of ultrapure water and mix well), and shake on a shaker at room temperature for 10 min at a shaking speed of 60 rpm.

[0155] g) Water washing: discard the silver solution, add 50 mL of ultrapure water, and shake on a shaker at room temperature for 1.5 min at a shaking speed of 60 rpm.

[0156] h) Color development: discard the water, add 50 mL of silver staining solution (add 10 mL of 5X silver staining basic solution and 25 μL of 2000X silver staining acceleration solution to 40 mL of ultrapure water and mix well), shake on a shaker at room temperature for 3-10 min until the expected ideal protein band appears, with a shaking speed of 60 rpm.

[0157] i) Stop: discard the silver staining solution, add 50 mL of 1X silver staining stop solution (add 2.5 mL of 20X silver staining stop solution to 47.5 mL of ultrapure water and mix well), and shake on a shaker at room temperature for 10 min at a shaking speed of 60 rpm.

[0158] j) Water washing: discard the silver staining stop solution, add 50 mL of ultrapure water, and shake on a shaker at room temperature for 5 minutes at a shaking speed of 60 rpm.

[0159] 3) Silver staining detection:

[0160] Silver staining was performed using a fully automatic chemiluminescence image analysis system (purchased from Shanghai Tianneng, product model Tanon 5200 series) according to its user guide. Figure 1-4Silver staining results of four groups of HPV6 neutralizing antibody pseudovirus solutions, namely p6 L1-6x His L2, p6 6x His-L1 L2, p6 L1 6xHis-L2, and p6 6x His-L1 6x His-L2. The results showed that after purification by the NTA kit, the four groups of pseudovirus solutions (6x His fused at different positions) could remove a large number of impurities, and eluted protein components close to the theoretical size (6x His-L1 theoretical molecular weight 56.4kDa, 6x His-L2 theoretical molecular weight 49.4kDa), among which p6 6x His-L1 6x His-L2 virus solution had the best purification effect. From the silver staining result diagram, it can be seen that its eluate E1 and E2 contain a large amount of L1 and L2 proteins, and no other impurity proteins are obviously seen, indicating that the nickel column purification effect of the pseudovirus obtained by fusing 6x His at the N-terminus of L1 and L2 is the best.

[0161] Effect example 1: Infectivity detection

[0162] 1) Cell plating: Take 293T cells in good growth state, add PBS (purchased from BasalMedia Shanghai Yuanpei Biotechnology Co., Ltd., product number B320KJ) to wash, and then add 0.25% reduced serum medium (Gibco, product number 31985-070) to resuspend the cells, count them using an automatic cell fluorescence analyzer (purchased from CountStar, product model Countstar MiraFL-S), make a cell solution containing 1E+05 cells / mL, add 100 μL of cell solution to each well of a 96-well cell culture plate (purchased from Wuxi Nice Life Science Co., Ltd., product number 701002), and place it in a 5% CO2, 37°C cell culture incubator for use.

[0163] 2) Add 0.5 μL of Sam, FT, W1, W2, W3, E1, E2, and E3 solutions of four groups of HPV6 neutralizing antibody pseudovirus solutions, namely p6 L1-6x His L2, p6 6x His-L1 L2, p6 L1 6xHis-L2, and p6 6x His-L1 6x His-L2, into 96-well cells, respectively. Set up 3 replicate wells for each group and continue culturing in a 5% CO2, 37°C cell culture incubator.

[0164] 3) After 72 hours of infection, the 96-well plate was removed and the expression efficiency of green fluorescent protein was observed under a fluorescent inverted microscope (purchased from OLYMPUS, product model CKX53) and photographed for record. Figure 5As shown, after the p6 L1-6x His L2 virus liquid was purified by HisPur NiNTA Kit (NTA kit), most of the virus did not bind to Ni effectively, remained in the flow-through (FT), and was continuously washed off during the washing process; after the p6 6x His-L1 L2 HPV6 virus liquid was purified by nickel column, most of the virus did not bind to Ni firmly, part of it was retained in the flow-through (FT), and part of it could bind to Ni and be eluted, and a neutralizing antibody pseudovirus liquid with higher purity was harvested; after the p6 L1 6x His-L2 virus liquid was purified by nickel column, the infection results were consistent with those of p6 6xHis-L1 L2; after the p6 6x His-L1 6x His-L2 virus liquid was purified by nickel column, most of the virus bound to Ni effectively, a small amount remained in the flow-through (FT), and high concentration of imidazole could elute most of the virus particles; compared with other groups, p6 6x His-L16x His-L2 had the best purification effect. After the pseudovirus was purified by nickel column, the amount of green fluorescent protein expressed by the infected 293T cells in the harvested eluate gradually decreased with the increase of the elution times, indicating that the Ni purification kit can specifically bind to the HPV neutralizing antibody pseudovirus and be eluted, and the entire purification process does not affect the infectious activity of the HPV neutralizing antibody pseudovirus.

[0165] Effect example 2: Firefly luciferase expression detection

[0166] The 96-well cell culture plate with the highest expression of green fluorescent protein after 293T was infected with the eluate E1 in the four groups compared in Example 3 was taken out, the old culture medium was drained, 50 μL of DMEM culture medium containing 2% FBS was added, and then 50 μL of Bio-LiteLuciferase Assay System (purchased from Vazyme, product number DD1201) was added, and the cells were fully lysed by blowing several times. The 96-well plate was placed in a multifunctional microplate reader (purchased from TECAN, product model INFINITE M PLEX) and the expression of firefly luciferase was detected according to its user guide. The results are as follows Figure 6 As shown, after the samples of each stage of p6 6x His-L1 6x His-L2 purification infected 293T cells, the numerical trend of their luciferase expression was consistent with the expression level of green fluorescent protein. After infection with the same amount of E1 eluate, the expression level of firefly luciferase in cells was significantly higher than that in other stages (except the untreated Sam group). Compared with the untreated Sam group, its expression level accounted for 66.87% of the total.

[0167] Effect Example 3: Real-time PCR Detection

[0168] 1) Take 100 μL of each of the Sam, FT, W1, W2, W3, E1, E2, and E3 solutions of the p6 6x His-L1 6x His-L2 neutralizing antibody pseudovirus solution with the best purification effect, and use a viral nucleic acid extraction kit (BEAVERBIO Suzhou Beaver Biology, catalog number 70406-100) to extract the nucleic acid components contained therein, and set up 3 parallels for each solution.

[0169] 2) Using the extracted nucleic acid as a template, the universal high-specificity dye quantitative PCR detection kit AceQUniversal SYBR qPCR Master Mix (purchased from Vazyme Nanjing Novogene Biotechnology Co., Ltd., catalog number Q511-02) was selected for qPCR. The reaction system was as follows: AceQ Universal SYBR qPCR Master Mix: 10 μL;

[0170] Primer-F: 0.4μL; Primer-R: 0.4μL; ddH2O: 7.2μL; Template: 2μL.

[0171] 3) Primer information is shown in Table 4.

[0172] Table 4 Description of Real-time PCR primers

[0173]

[0174] 4) Reaction procedure:

[0175] 95℃5min; 95℃10sec, 60℃30sec, the cycle number was set to 40, and the fluorescence signal was collected; 95℃60sec, 60℃1min, 95℃10sec.

[0176] 5) On-machine detection, the instrument used was a fluorescent quantitative PCR detection system (purchased from BIOER Hangzhou Bioer Technology Co., Ltd., product model 9600). The test results are shown in Table 5. After the p6 6x His-L1 6x His-L2 HPV6 neutralizing antibody pseudovirus solution was purified by HisPur Ni NTA Kit, a large amount of reporter gene LUC2 and ZsGreen expression could be detected in the eluents E1 and E2. As the number of elutions increased, the expression of the reporter gene in the eluent gradually decreased; as the number of washes increased, the expression of the reporter gene in the wash solution gradually decreased; indicating that the eluent of the HisPur Ni NTA Kit contained not only L1 and L2 proteins expressed in 293TT cells, but also HPV pseudovirus particles encapsulating the reporter gene plasmid.

[0177] Table 5 Real-time PCR detection of reporter gene content in p6 6x His-L1 6x His-L2 virus solution

[0178]

[0179]

[0180] Effect example 4: Particle size detection

[0181] The p6 6x His-L1 6x His-L2 neutralizing antibody pseudovirus solution with the best purification effect was concentrated (using an ultrafiltration tube purchased from Sartorius SARTORIUS, product number VS2042), the eluents E1, E2, and E3 were mixed together, 1XDPBS solution was added, concentrated to 1.5mL by centrifugation, and sterilized by filtering with a 0.22μm filter. It was diluted 20 times with a diluent (provided by Resuntech Ruixin Intelligent Manufacturing, a supporting reagent for particle size detection instruments), and some samples were taken for particle size detection on a machine (Nano Coulter single particle analysis system, Resuntech Ruixin Intelligent Manufacturing, model NanoCoulter). The results are as follows Figure 7-Figure 8 As shown, the average particle size of the purified p6 6x His-L1 6x His-L2 HPV6 neutralizing antibody pseudovirus was 64 nm, and the median particle size was 60 nm, which was consistent with the particle size of the live HPV virus (about 60 nm).

[0182] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for preparing a HPV neutralizing antibody pseudovirus, characterized in that: The following steps are involved: S1. Construction of stable cell lines; S2, construction of structural plasmid and reporter gene plasmid; The structural plasmid is any one of the following three situations: (1) HPV capsid protein L1 gene containing an N-terminal or C-terminal fused His tag; (2) HPV viral capsid protein L2 gene containing an N-terminal or C-terminal fused His tag; (3) A combination of the above two; S3, co-transfecting the structural plasmid and the reporter gene plasmid in step S2 into the stably transfected cell line in step S1, and culturing the cells; S4, collecting the cells cultured in step S3, lysing them, and centrifuging them to obtain a supernatant; S5. Filter the supernatant in step S4 and purify it using nickel column affinity chromatography to obtain HPV neutralizing antibody pseudovirus.

2. The preparation method according to claim 1, characterized in that: The step S1 comprises the following steps: The DNA sequence of SV40 large T antigen fused with 3×FLAG tag at the C-terminus was inserted into the vector plasmid to construct the target plasmid.

3. The preparation method according to claim 2, characterized in that: The DNA sequence of the SV40 large T antigen fused with a 3×FLAG tag at the C-terminus is the sequence shown in SEQ ID NO.

1.

4. The preparation method according to claim 1, characterized in that: The step S1 comprises the following steps: The target plasmid described in claim 2 and the helper plasmid are co-transfected into 293T cells to obtain 293TT cells expressing SV40 large T antigen.

5. The preparation method according to claim 1, characterized in that: In step S2, the sequence of the HPV virus capsid protein L1 gene is the sequence shown in SEQ ID NO.4, and the sequence of the HPV virus capsid protein L2 gene is the sequence shown in SEQ ID NO.2; The structural plasmid in step S2 contains both the HPV virus capsid protein L1 gene fused to the N-terminus with a His tag and the HPV virus capsid protein L1 gene fused to the N-terminus with a His tag.

6. The preparation method according to claim 5, characterized in that: The N-terminal fusion expression of the HPV virus capsid protein L2 gene in step S2 is a 6×His tag, and the HPV virus capsid protein L2 gene after the N-terminal fusion of the His tag includes the sequence shown in SEQ ID NO.3; In step S2, the N-terminal of the HPV virus capsid protein L1 gene is fused with a 6×His tag, and the HPV virus capsid protein L1 gene after the N-terminal fusion of the His tag includes the sequence shown in SEQ ID NO.

5.

7. The preparation method according to claim 1, characterized in that: The reporter gene plasmid in step S2 contains a fluorescent protein or luciferase gene.

8. The preparation method according to claim 1, characterized in that: The nickel column affinity chromatography method in step S5 includes using Ni-NTA column material for chromatography.

9. The pseudovirus prepared by the preparation method according to any one of claims 1 to 8.

10. The preparation method according to any one of claims 1 to 8 or the use of the pseudovirus according to claim 9, characterized in that: The application includes infecting mammalian cells to prepare pseudoviruses.

Images