Composite surface bonded transponder composite

Abstract

The present disclosure relates to methods, compositions, and kits for generating libraries of tagged nucleic acid fragments without the use of PCR amplification, including methods and compositions for fragmenting and tagging nucleic acids (e.g., DNA) using a transposon complex immobilized on a solid support.

Description

[0001] This application is a divisional application of the invention patent application with an application date of January 10, 2020, an international application number of PCT / EP2020 / 050612, a national application number of 202080005545.5, and an invention name of “Composite surface-bound transposome complex”.

[0002] Incorporation by reference into any priority application

[0003] This application claims the benefit of priority to U.S. Provisional Patent Application No. 62 / 791,509, filed on January 11, 2019, and U.S. Provisional Patent Application No. 62 / 840,610, filed on April 30, 2019, which are hereby incorporated by reference in their entirety. Technical Field

[0004] The present disclosure relates to methods, compositions and kits for generating libraries of tagged nucleic acid fragments without the use of PCR amplification, including methods and compositions for fragmenting and tagging nucleic acids (e.g., DNA) using transposome complexes immobilized on a solid support. Background Art

[0005] Current protocols for next generation sequencing (NGS) of nucleic acid samples typically employ a sample preparation process that converts DNA or RNA into a library of fragmented templates that can be sequenced. Sample preparation methods typically require multiple steps and material transfers as well as expensive instruments to achieve fragmentation, which can make these methods difficult, cumbersome, expensive, and inefficient. In addition, the amplification using primers introduces biases in the library content, thereby introducing biases into the resulting sequencing data. For example, a PCR amplification step can generate gaps, and since the polymerase cannot effectively replicate GC-rich regions, the gaps are exacerbated in GC-rich regions. These gaps form biases in the sequencing data obtained from the library. The library preparation process with a PCR amplification step may have significantly reduced insertion and deletion (indel) detection performance. Some regions with multiple amplified repeats may be difficult to sequence accurately, and DNA with GC-rich promoters may show low coverage within the genome. In addition, many library preparation methods are incompatible with the incorporation of sample indexes, or require multiple additional steps to introduce such indexes.

[0006] There is a need for brief, efficient and accurate library preparation procedures. Various methods, compositions and kits are described herein that address these issues and accommodate single and dual indexing approaches. Summary of the invention

[0007] The present disclosure relates to methods, compositions and kits for generating libraries of tagged nucleic acid fragments without using PCR amplification to incorporate fragment tags (such as primer sequences and / or index sequences), including methods and compositions for fragmenting and tagging nucleic acids (e.g., DNA) using transposome complexes immobilized on a solid support.

[0008] Some embodiments provided herein relate to a transposome complex comprising an attachment polynucleotide. In some aspects, the present disclosure relates to a transposome complex comprising: (a) a transposase; (b) a first transposon comprising a 3' transposon end sequence and a 5' adapter sequence; (c) a second transposon comprising a 5' transposon end sequence and a 3' adapter sequence, wherein the 5' transposon end sequence is complementary to at least a portion of the 3' transposon end sequence; and (d) an attachment polynucleotide comprising: (i) an attachment adapter sequence hybridized to one of the two adapter sequences and (ii) a binding element. Typically, the transposon end sequences are annealed together to form a double-stranded transposon end sequence recognized by the transposase. In some aspects, the binding element is fixed to a solid support to provide an immobilized transposome complex.

[0009] In some aspects, the disclosure relates to an annealed transposon / attachment polynucleotide hybrid comprising a first transposon, a second transposon, and an attachment polynucleotide.

[0010] In some aspects, the present disclosure relates to a method of preparing an annealed transposon / attached polynucleotide hybrid comprising a transposome complex, the method comprising annealing a first transposon, a second transposon, and an attached polynucleotide. In some aspects, the present disclosure relates to a method of preparing a transposome complex, the method comprising treating the annealed transposon / attached polynucleotide hybrid with a transposase. In some aspects, the method provides a method of preparing an immobilized transposome complex by fixing the transposome complex to a solid support by a binding element.

[0011] In some aspects, the present disclosure relates to a transposome complex comprising: (a) a transposase; (b) a first transposon comprising a 3' transposon end sequence and a 5' adapter sequence; (c) a second transposon comprising a 3' adapter sequence and a 5' transposon end sequence complementary to at least a portion of the 3' transposon end sequence; and (d) a binding element attached to the 5' adapter sequence via a cleavable linker. In some aspects, the binding element is fixed to a solid support to provide an immobilized transposome complex. In some aspects, the present disclosure relates to an annealed oligonucleotide construct comprising a first transposon, a second transposon, and a binding element.

[0012] In some aspects, the present disclosure relates to a method of generating a library of tagged nucleic acid fragments, the method comprising contacting the target nucleic acid with a plurality of immobilized transposome complexes as described herein under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3' ends of the 3' transposon end sequences to the 5' ends of the target fragments to produce a plurality of 5'-tagged target fragments.

[0013] Some embodiments provided herein relate to kits for generating libraries of tagged nucleic acid fragments without the use of PCR amplification. In some embodiments, the kit comprises an immobilized transposome complex as described herein.

[0014] In some aspects, the present disclosure relates to a method for generating a library of tagged nucleic acid fragments, the method comprising contacting an immobilized transposome complex with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3' end of a first transposon to the 5' end of the target fragment to produce a plurality of 5'-tagged target fragments; treating a solid support to remove unbound nucleic acid; or optionally treating the solid support to remove a transposase from the complex by: (a) heating the solid support and / or (b) washing the solid support with an enzyme denaturant, wherein the enzyme denaturant optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea or a protease; treating the plurality of 5'-tagged target fragments with a polymerase and a ligase; '-tagged target fragments to extend and connect these 5'-tagged target fragments to produce completely double-stranded tagged fragments, optionally wherein the treatment with polymerase and ligase is carried out in the presence of a DNA secondary structure disruptor, wherein the disruptor is optionally DMSO; removing the completely double-stranded tagged fragments from the solid support, optionally wherein the removal includes applying heat and / or a denaturing agent sufficient to cleave the completely double-stranded tagged fragments from the solid support, optionally wherein the denaturing agent is NaOH; and selecting the completely double-stranded tagged fragments using capture beads, optionally wherein the capture beads are magnetic beads, further optionally wherein two separate selection steps are performed.

[0015] In some embodiments, the immobilized transposome complex comprises: a solid support; and a transposome complex fixed to the solid support, wherein the transposome complex comprises: a transposase; a first transposon, the first transposon comprising a 3' transposon end sequence and an anchor sequence (Anchor); a second transposon, the second transposon comprising a 5' transposon end sequence and a B15' sequence; and an attachment polynucleotide, the attachment polynucleotide comprising an anchor sequence complementary sequence (Anchor'), an A14' sequence, a spacer and a P5' sequence and a binding element comprising biotin, wherein the biotin is fixed to the solid support. In some embodiments, the method further comprises sequencing one or more completely double-stranded tagged fragments in the completely double-stranded tagged fragments.

[0016] In some embodiments, the method includes contacting a first immobilized transposome complex and a second immobilized transposome complex with the target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and join the 3' end of each first transposon to the 5' end of the target fragment to produce a plurality of first 5'-tagged target fragments generated by the first immobilized transposome complex and a plurality of second 5'-tagged target fragments generated by the second immobilized transposome complex. In some embodiments, the first immobilized transposome complex comprises a solid support and a first transposome complex immobilized to the solid support, wherein the first transposome complex comprises: a transposase; a first transposon comprising a 3' transposon end sequence and an anchor sequence; a second transposon comprising a 5' transposon end sequence; and a first attachment polynucleotide comprising (i) an anchor sequence complementary sequence, an A14' sequence, a spacer, and a P5' sequence, and (ii) a binding element comprising biotin, wherein the biotin is immobilized to the solid support. In some embodiments, the second immobilized transposome complex comprises a solid support and a second transposome complex immobilized to the solid support, wherein the second transposome complex comprises: a transposase; a first transposon comprising a 3' transposon end sequence and an anchor sequence; a second transposon comprising a 5' transposon end sequence; and a second attachment polynucleotide comprising (i) an anchor sequence complementary sequence, a B15' sequence, a spacer, and a P7' sequence, and (ii) a binding element comprising biotin, wherein the biotin is immobilized to the solid support. In some embodiments, the method includes treating a plurality of 5'-tagged target fragments with a ligase to connect each 5'-tagged target fragment to a first index oligonucleotide or a second index oligonucleotide by contacting the 5'-tagged target fragments with a pool of a first index oligonucleotide and a second index oligonucleotide, wherein each first index oligonucleotide comprises an A14 sequence, an i5 sequence, and a P5 sequence and can bind to a first 5'-tagged target fragment; and wherein each second index oligonucleotide comprises a B15 sequence, an i7 sequence, and a P7 sequence and can bind to a second 5'-tagged target fragment to produce a plurality of 5'-tagged target fragments connected to the index oligonucleotides; optionally treating the solid support to remove the transposase from the complex by: (a) heating the solid support and / or (b) washing the solid support with an enzyme denaturant, wherein the enzyme denaturant optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea, or a protease; and treating the plurality of 5'-tagged target fragments connected to the index oligonucleotides with a polymerase to extend and produce fully double-stranded tagged fragments. In some embodiments, contacting the first immobilized transposome complex and the second immobilized transposome complex and treating the plurality of 5'-tagged target fragments with a ligase are performed in a single reaction. In some embodiments, double-stranded tagged fragments are generated in solution. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a flow chart showing an embodiment of a method for generating a library of tagged nucleic acid fragments without using PCR amplification. In a first step, a transposome complex as described herein and fixed on a solid support is provided. The target nucleic acid is applied to the solid support, and a fragment tagging reaction is performed to generate tagged and fragmented nucleic acids. An indexing mixture with an index sequence is applied, and extension and connection are performed. Finally, the tagged nucleic acid fragments are indexed. In some embodiments, indexing occurs simultaneously with extension and connection, and in other embodiments, indexing occurs after extension and connection. In other embodiments, the arrangement of the steps is different, such as shown in Example 9.

[0018] FIG. 2A to FIG. 2B A schematic diagram and method for preparing a library of tagged nucleic acid fragments without using PCR amplification are shown. Figure 2A is an exemplary configuration of a transposome complex in which biotin (B) is attached to one transposon via a cleavable linker. In this exemplary embodiment of a transposome complex, the transposome complex comprises: a transposase; a first transposon comprising a 3' transposon end sequence and a 5' adapter sequence; a second transposon comprising a 3' adapter sequence and a 5' transposon end sequence complementary to at least a portion of the 3' transposon end sequence; and a binding element attached to the 5' adapter sequence ( Figure 2A ). Figure 2B Schematic diagram of the process of using amplification from Figure 2A Exemplary steps of a method for preparing a library of tagged nucleic acid fragments in the case of an exemplary transposome complex immobilized to a solid support (solid support not shown), including steps of fragment tagging and washing, extension and ligation, and removal of beads. Figure 2B The steps of fragment tagging, in which insert fragments from a target nucleic acid are attached with tags, extension and ligation, and cleavage from a solid support are shown.

[0019] FIG. 3A to FIG. 3C Exemplary steps of a method for generating a library of tagged nucleic acid fragments without using PCR amplification are shown. Figure 3A The transposome complex is shown immobilized to a solid support via an attached polynucleotide bearing biotin (B, solid support not shown). For simplicity, the dimer is depicted in Figure 3A In, but not shown FIG. 3B to FIG. 3C middle. Figure 3BShown are the tagged and fragmented nucleic acids still complexed with the transposase (upper panel) and the structure after removal of the transposase (lower panel). Figure 3B A transposome complex is shown with a nucleic acid fragment (insert) bound to a first transposon, wherein the 5' end of the insert is attached to the 3' transposon end sequence. The transposase is removed using methods described herein, for example using an agent that removes the transposase, such as sodium dodecyl sulfate (SDS). Figure 3C The structure after gap filling and extension (extension and ligation) (upper panel) and after dehybridization to remove the generated fragments from the solid support (lower panel) are shown. Figure 3C As shown, the index is added to the solid support and hybridized with the attached polynucleotide of the second transposon. Figure 3C As shown in the embodiment of , the i5 index having a primer sequence (P5 sequence), an index sequence (i5 sequence) and an anchor sequence hybridizes with the attached polynucleotide at the complementary sequence, so that P5 hybridizes with P5' and Anchor hybridizes with Anchor'. Similarly, in Figure 3C In the embodiment of the present invention, the i7 index having a primer sequence (P7), an index sequence (i7) and an adapter sequence (B15 sequence) hybridizes with the second transposon at the complementary sequence, so that P7 hybridizes with P7', i7 hybridizes with i7', and B15 hybridizes with B15'. After the solid support is contacted with the index, the fragment is extended and connected using an extension and connection mixture (ELM). The solid support is then treated with a reagent (such as NaOH) to denature the chain sequence, thereby generating a labeled nucleic acid fragment. An embodiment of a transposome complex is shown, which has a Tn5 transposase and a first transposon and a second transposon. The first transposon comprises a 3' transposon end sequence (ME sequence) hybridized with the 5' transposon end sequence (ME' sequence) of the second transposon. The second transposon also comprises a 3' adapter sequence (B15' sequence). The first transposon comprises a 5' adapter sequence (A14 sequence), which is shown as hybridized with an attached adapter sequence (A14' sequence) of an attached polynucleotide. The attachment polynucleotide also comprises an anchor sequence (Anchor'), a spacer, a primer sequence (P5' sequence) and a linker attached to the binding element (B).The transposome complex is a dimer, having two dimerized transposome monomers.

[0020] FIG. 4A to FIG. 4EA schematic diagram comparing various configurations of transposome complexes immobilized to a solid support via exemplary biotin (B, solid support not shown), the transposome complexes comprising index beads and universal beads, each of which is shown in single index mode and dual index mode, for embodiments of methods for generating a library of tagged nucleic acid fragments without using PCR amplification, using variations of transposome complexes in which components of the transposon and / or attached polynucleotide are altered, arranged or varied compared to one another. Figure 4A Various configurations of transposome complexes attached to a solid support are shown. Figure 4A An embodiment of a transposome complex is shown showing a transposase and a first transposon and a second transposon, and attached to a solid support by attaching a polynucleotide. Figure 4B Various configurations after fragment tagmentation are shown. Figure 4B A fragment tagmentation reaction is shown for single or dual indexed index beads or universal beads, wherein a solid support is contacted with a nucleic acid fragment (insert) bound to the 3' transposon end of a first transposon. Figure 4C Various configurations after extension and connection are shown. Figure 4C Extension and ligation of indexing beads or universal beads for single or dual indexing are shown, wherein a solid support is contacted with an indexing mixture, the indexing mixture is hybridized to a transposon or an attachment polynucleotide, and wherein nucleic acid fragments are extended. Figure 4D Various configurations after indexing are shown (the indexing beads for single indexing are not shown because the indexing for this configuration is Figure 4C has been completed). Figure 4D The indexing of index beads for dual indexing or universal beads for single or dual indexing is shown. Figure 4D As shown, the indexing beads for single indexing are Figure 4C The solid support is contacted with the indexing mixture and the nucleic acid fragments are tagged for indexing. Figure 4E Exemplary results for various configurations are shown, showing normalized read frequency as a function of insert size. Figure 4E Normalized read frequencies of tagged nucleic acid fragments from index beads or universal beads for single or dual indexing are shown. FIG. 4A to FIG. 4E Specifically shown are embodiments of transposome complexes arranged as index beads for single indexing (upper left), universal beads for single indexing (upper right), index beads for dual indexing (lower left), and universal beads for dual indexing. FIG. 4A to FIG. 4E For the embodiment of the indexing bead shown, for single and double indexing (left), the attachment polynucleotide hybridizes to the second transposon at the 3' adapter sequence (B15' sequence). FIG. 4A to FIG. 4EEmbodiments of universal beads shown, with the attached polynucleotide hybridized to the first transposon at the 5' adapter sequence (A14 sequence) for single and dual indexes (right). In some embodiments, a normalized library can be prepared from an original sample such that nucleic acids are extracted from the original sample and directly input into a system or method described herein, wherein the self-normalized sample provides tight CVs across a range of sample types.

[0021] Figure 5A and Figure 5B A schematic diagram of an exemplary transposome complex for non-indexing is shown, showing the transposon containing the P7 sequence ( Figure 5A ) or a transposon containing the P5 sequence ( Figure 5B ) hybridized attachment polynucleotide. Specifically, Figure 5A and Figure 5B A primer sequence (P5 sequence) is shown that joins with a 5' adapter sequence (A14 sequence) on a first transposon and a primer sequence (P7' sequence) that joins with a 3' adapter sequence (B15' sequence) on a second transposon, thereby providing a non-indexed transposome complex. The attachment polynucleotide can be hybridized on the second transposon using a 5' binding element (B). Figure 5A ), or hybridize on the first transposon using a 3' binding element (B) Figure 5B ).

[0022] FIG. 6A to FIG. 6D A schematic diagram of an exemplary transposome complex comprising an i5 index sequence is shown. Fig. 6A A complex is shown in which an attachment polynucleotide comprising a nitro sequence and an anchor sequence can hybridize to an index oligonucleotide, which can then be ligated to the 5' end of the first transposon. Fig. 6A In the present invention, the transposome complex comprises: a first transposon comprising a 3' transposon end sequence (ME) and a 5' adapter sequence (A14), a second transposon comprising a 5' transposon end sequence (ME') and a 3' adapter sequence (B15'), and an attachment polynucleotide comprising an attachment adapter sequence (A14') and a binding element (biotin) that hybridizes with A14 in the first transposon. In this case, the attachment polynucleotide also comprises a nitroindole sequence (a universal sequence that binds to any i5 index region) and a primer sequence (P5'). The B15' region of the second transposon can hybridize with a polynucleotide comprising a complementary sequence (B15), an index region, and a P7 primer sequence, which itself anneals to a P7'-i7' index molecule. The ligation of the 5' end of the i7' index region with the 3' end of the 3' adapter sequence is used to generate a completely double-stranded region.

[0023] Figure 6BAn attachment polynucleotide comprising an anchor sequence and a spacer is shown that can hybridize to an index oligonucleotide, which can then be ligated to the 5' end of the first transposon. Figure 6B In the invention, the first transposon comprises a 3' transposon end sequence (ME) and a 5' adapter sequence (A14), and the second transposon comprises a 5' transposon end sequence (ME') and a 3' adapter sequence (B15'), such as Fig. 6A As shown. However, in this case, the attachment polynucleotide comprises an adaptor-complementary sequence (A14'), an Anchor' sequence, a 2×sp18 spacer, a primer-complementary sequence (P5'), and a biotin-binding element. The i5 index comprises an anchor sequence (complementary to Anchor'), an i5 index region, and a primer sequence (P5). The i5 index hybridizes to the complementary anchor sequence and primer sequence on the attachment polynucleotide across the spacer.

[0024] Figure 6C An attachment polynucleotide comprising a spacer and an A14' sequence is shown which can hybridize to an index oligonucleotide which can then be ligated to sequence X at the 5' end of the first transposon. Figure 6C In the method, the first transposon comprises a 3' transposon end sequence (ME) and a 5' adapter sequence X, and the second transposon comprises a 5' transposon end sequence (ME') and a 3' adapter sequence (B15'). The attachment polynucleotide comprises a complementary sequence of the 5' adapter sequence (X'), a second adapter sequence (A14'), a spacer (2×sp18), a primer complementary sequence (P5'), and a biotin binding element. The 5' adapter sequence (X') hybridizes with the 5' adapter sequence (X) of the first transposon. The i5 index comprises a complementary sequence of the second adapter sequence (A14), a 2×sp18 spacer, and a primer sequence (P5). The i5 index hybridizes with the second adapter sequence and the primer complementary sequence on the attachment polynucleotide across the spacer, and the 3' end of the complementary sequence of the second adapter sequence is connected to sequence X. Furthermore, the i7 index comprising the 5' primer sequence (P7), the i7 index region, and the complementary sequence (B15) of the 3' adapter sequence is annealed, and the 3' end of the 3' adapter sequence is extended to generate a double-stranded region.

[0025] Fig.6D An attachment polynucleotide comprising a spacer and an A14' sequence is shown which can hybridize to an index oligonucleotide which can then be ligated to sequence X at the 5' end of the first transposon. In this case, the index oligonucleotide comprises a double-stranded primer region. Fig.6D In the invention, the first transposon, the second transposon and the attached polynucleotide are as follows Figure 6CAs shown. The i7 index comprises a double-stranded primer (P7 / P7'), an i7 index region, and a complementary sequence to the 3' adapter sequence (B15). The double-stranded region in the i7 index can be formed (annealed) during the extension ligation reaction, for example, without the need to anneal the i7 index prior to the reaction itself. The P7' oligonucleotide can be included in the reaction mixture. The i7 index anneals via the B15 region, and the double-stranded region is formed from the extension and ligation of the second transposon. An example of this method is shown in Example 5.

[0026] FIG. 7A to FIG. 7B Exemplary results of performing a method of generating a library of tagged nucleic acid fragments with and without PCR amplification are shown, including results showing improvements in indel precision and recall ( Fig. 7A ) and improved coverage in GC-rich promoters ( Figure 7B These data were generated using four methods, two of which used PCR (TruSeq TM Nano and Nextera TM DNA Flex), two methods that do not use PCR (this method and TruSeq TM No PCR). Each method was repeated in two replicates, generating a total of eight libraries. Data were downsampled to 25X after sequencing. Fig. 7A The high percentage of indel precision and recall of the PCR-free method described herein are shown. From left to right, samples include (in duplicate): TruSeq TM Nano (black); Nextera TM DNA Flex (white); the inventive PCR-free method described herein (lined); and TruSeq TM No PCR (checkered). Figure 7B The improved coverage in GC-rich promoters of the PCR-free method of the present invention described herein compared to other methods is shown, all coverage results include: Nextera TM DNA Flex (upper left); TruSeq TM Nano (upper right); the inventive PCR-free method described herein (lower left); and TruSeq™ PCR-free (lower right).

[0027] Figure 8 Shown are results from a sequencing library from a sample containing a known 100% GC repeat expansion (FMR1) using Nextera TM DNA Flex or TruSeq TM DNA PCR-free library preparation kit was prepared for comparison with the method described herein (quadruplicate samples 1-4), as described in Example 3.

[0028] 9A to 9C shows the use of eight index pairs together with Figure 6C %CV results of the library prepared by the system ( Fig. 9A ) and together with Fig.6D %CV results of the library prepared by the system ( Fig. 9B and Fig. 9C ), as described in Example 5.

[0029] Fig.10 Shown is a graphical representation of gap coverage sequencing in a region of the gene RNPEPL1 using the PCR library preparation method (Nextera Flex or tube-based Nextera), but less gap coverage using the PCR-free method described herein (bottom two graphs). DETAILED DESCRIPTION

[0030] Fragmented nucleic acid libraries are typically formed from genomic nucleic acids for next generation sequencing (NGS) applications. The present disclosure provides methods, compositions, and kits for generating fragmented nucleic acid libraries that are appended with sequences (including indexes) required to perform sequencing operations without the need to add sequences by amplification using PCR (also referred to herein as PCR-free library generation or PCR-free library preparation). This PCR-free transposome library preparation method can reduce and / or eliminate the bias caused by PCR in current fragment tagging methods for library preparation.

[0031] Fragment tagging refers to the use of transposase to fragment and tag nucleic acids. Fragment tagging includes modifying DNA by a transpososome complex comprising a transposase compounded with a linker (referred to herein as a transposon) comprising a transposon end sequence. Fragment tagging causes the fragmentation of DNA and the connection of the linker to the 5' end of the two chains of the duplex fragment to occur simultaneously. Generally speaking, after the purification step of removing the transposase, additional sequences are added to the ends of the adapted fragments by PCR.

[0032] The methods, compositions, systems and kits described herein relate to composite hybrid oligonucleotides, transposome complexes (including complexes fixed on surfaces) comprising those hybrids, and the purposes of the transposome complexes for PCR-free library generation. As described herein, the transposome complexes include transposases and associated transposons that fragment and tag target DNA molecules. In some aspects, the composite hybrid oligonucleotides are cleavable and include binding elements, and in other aspects, the composite hybrid oligonucleotides include attachment polynucleotides with binding elements. In some aspects, the attachment polynucleotides are nucleic acid sequences that are hybridized with the transposon in the transposome complex and fixed on a solid support (such as a slide, a flow cell or beads). Due to the hybridization of the attachment polynucleotides with the transposon, the transposome complexes can be indirectly fixed on the solid support by the attachment polynucleotides. The attachment polynucleotides and the solid support are combined by the attachment polynucleotides The binding element on the binding polynucleotide occurs. The target nucleic acid is captured by the transposome complex, and then the nucleic acid is fragmented and tagged ("fragment tagging"). The oligonucleotide system is designed to allow incorporation of any tags required for indexing and sequencing via fragment tagging, extension and / or ligation steps without the need for PCR amplification. Thus, in some aspects, tagged fragments can be extended and ligated, and indexed without amplification to generate a library of nucleic acid fragments without the use of PCR amplification.

[0033] Solution-based tags have disadvantages and require several labor-intensive steps. In addition, bias may be introduced during the PCR amplification step for introducing the tag sequence. For example, reduced indels may be PCR results due to polymerase falloff. In addition, PCR polymerases have difficulties in certain areas (such as high GC areas or AT or other sequence repeat areas), which can lead to gaps or incorrect structural variation detection in the genome, or missed repeat amplification.

[0034] The methods, compositions, systems and kits provided herein overcome these shortcomings and allow for unbiased sample preparation and sequencing with minimal requirements for sample manipulation or transfer. The methods, compositions, systems and kits described herein relate to generating libraries without the use of PCR amplification. The PCR-free methods reduce and / or eliminate the bias caused by PCR, including: reducing the number and frequency of gaps, especially in GC-rich regions that are difficult to PCR; improving indel detection performance, including improving indel recall and indel precision; improving detection of repeated amplification; and improving coverage in GC-rich promoters. The present application discloses various transposome complex designs for PCR-free fragment tagging to improve nucleic acid library generation.

[0035] In addition, the methods, compositions, systems and kits described herein can be performed in a time period less than nucleic acid sample preparation and analysis using other methods (such as PCR-based methods). Therefore, in some embodiments, the method for generating a library of labeled nucleic acid fragments as described herein can be performed in a time period of less than about 5 hours, for example, less than 5 hours, less than 4 hours, less than 3 hours or less than 2 hours. In some embodiments, the method for generating a library of labeled nucleic acid fragments as described herein can be performed for a time period in the range of about 90 minutes to about 300 minutes, such as 90 minutes, 105 minutes, 120 minutes, 135 minutes, 150 minutes, 165 minutes, 180 minutes, 195 minutes, 210 minutes, 225 minutes, 240 minutes, 255 minutes, 270 minutes, 285 minutes or 300 minutes, or for a time amount within the range defined by any two values ​​in the aforementioned values.

[0036] Furthermore, in some embodiments, use of the methods, compositions, systems and kits described herein results in time-independent nucleic acid fragmentation, immobilization of transposomes results in consistent insert size, and saturation allows for integration extraction and quantitative library preparation.

[0037] Additional advantages of the methods, compositions, systems and kits described herein relate to immobilization of transposome complexes on solid surfaces and include, for example, reduced manual and overall library preparation time, cost and reagent requirements, reduced sample input requirements, and the ability to use unpurified or degraded samples as a starting point for library preparation. Furthermore, the transposome complexes described herein produce libraries with more consistent insert sizes relative to solution phase methods, even when using different sample input concentrations.

[0038] In some embodiments, any suitable nucleic acid sequencing platform can be used to sequence the nucleic acid library obtained by the method disclosed herein to determine the nucleic acid sequence of the target sequence. In some aspects, the sequence of interest is related to or associated with one or more congenital or hereditary diseases, pathogenicity, antibiotic resistance or genetic modification. Sequencing can be used to determine the nucleic acid sequence of short tandem repeats, single nucleotide polymorphisms, genes, exons, coding regions, exon groups or parts thereof. Therefore, the methods and compositions described herein relate to creating a sequenceable library, which can be used for but not limited to cancer and disease diagnosis, prognosis and treatment, DNA fingerprinting applications (e.g., DNA databases, criminal case work), metagenomic research and discovery, agricultural genomics applications, and pathogen identification and monitoring.

[0039] In some embodiments, the attachment adapter sequence hybridizes to at least a portion of the 5' adapter sequence and the binding element is located at the 3' end of the attachment polynucleotide. In some embodiments, the attachment adapter sequence hybridizes to at least a portion of the 3' adapter sequence and the binding element is located at the 5' end of the attachment oligonucleotide.

[0040] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those of ordinary skill in the art. Unless otherwise stated, all patents, applications, published applications and other publications cited herein are incorporated by reference in their entirety. In the case where a term has multiple definitions herein, unless otherwise stated, the definitions in this section shall prevail. As used in the specification and the appended claims, the singular forms "one", "a kind" and "the" include plural referents unless the context clearly states otherwise. Unless otherwise stated, conventional methods of mass spectrometry, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA technology and pharmacology are used. Unless otherwise stated, "or" or "and" are used to represent "and / or". In addition, the use of the term "include" and other forms (such as "include", "contain" and "have") is not restrictive. As used in this specification, whether in a transitional phrase or in the body of the claim, the terms "include" and "include" will be interpreted as having an open meaning. That is, the term should be interpreted synonymously with the phrase "at least have" or "at least include". When used in the context of a process, the term "comprising" means that the process includes at least the recited steps, but may also include additional steps. When used in the context of a compound, composition, or device, the term "comprising" means that the compound, composition, or device includes at least the recited features or components, but may also include additional features or components.

[0041] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

[0042] Transposome complex

[0043] Some embodiments provided herein relate to compositions for generating libraries of tagged nucleic acid fragments without using PCR amplification. In some embodiments, the composition comprises a solid support and a transposome complex fixed to the solid support. In some embodiments, the transposome complex comprises a transposase, a first transposon, an attachment polynucleotide, and a second transposon. In some embodiments, the first transposon comprises a 3' transposon end sequence and a 5' adapter sequence. In some embodiments, the attachment polynucleotide comprises an attachment adapter sequence and a binding element hybridized with the 5' adapter sequence. In some embodiments, the second transposon comprises a 5' transposon end sequence and a 3' adapter sequence. In some embodiments, the transposome complex is fixed to the solid support by an attachment polynucleotide. In some embodiments, the attachment polynucleotide also comprises a primer sequence.

[0044] In some embodiments, the binding element comprises or is an optionally substituted biotin. In some embodiments, the binding element is connected to the attachment polynucleotide via a linker. In some embodiments, the binding element comprises or is a biotin linker. In some embodiments, the binding element comprises or is a 3', 5' or internal biotin.

[0045] In some embodiments, the 3' transposon end sequence comprises a chimeric end (ME) sequence, and the 5' transposon end sequence comprises an ME' sequence. In some embodiments, the 5' adapter sequence comprises an A14 sequence, and the attachment adapter sequence comprises an A14' sequence. In some embodiments, the 3' adapter sequence comprises a B15' sequence. In some embodiments, the 3' adapter sequence is complementary to at least a portion of the index adapter sequence. In some embodiments, the index adapter sequence comprises a B15 sequence. In some embodiments, a portion of the attachment polynucleotide comprises a primer sequence, such as a P5' primer sequence. In some embodiments, the primer sequence of the attachment polynucleotide is complementary to at least a portion of the index oligonucleotide sequence (such as a P5 primer sequence).

[0046] In some embodiments, the transposome complex is immobilized on a solid support via a binding element (and optional linker) as described herein. In some embodiments, the solid support is a bead, a paramagnetic bead, a flow cell, a surface of a microfluidic device, a tube, a well of a plate, a slide, a patterned surface, or a microparticle. In some embodiments, the solid support comprises or is a bead. In one embodiment, the bead is a paramagnetic bead. In some embodiments, the solid support comprises a plurality of solid supports. In some embodiments, the transposome complex is immobilized on a plurality of solid supports. In some embodiments, the plurality of solid supports comprises a plurality of beads. In some embodiments, the plurality of transposome complexes are at least 10 3 , 10 4 , 10 5 , 106 Composites / mm 2 In some embodiments, the solid support is a bead or a paramagnetic bead, and each bead is bound to more than 10,000, 20,000, 30,000, 40,000, 50,000, or 60,000 transposome complexes.

[0047] Transposon-based technology can be used to fragment DNA, for example, as in NEXTERA TM As exemplified in the workflow of the FLEX DNA Sample Preparation Kit (Illumina, Inc.), a target nucleic acid such as genomic DNA is treated with a transposome complex that simultaneously fragments and tags the target ("fragment tagging"), thereby forming a population of fragmented nucleic acid molecules tagged with unique adapter sequences at the ends of the fragments.

[0048] The transposition reaction is a reaction in which one or more transposons are inserted into a target nucleic acid at a random site or an almost random site. The components in the transposition reaction include a transposase (or other enzymes capable of fragmenting and tagging nucleic acids as described herein, such as an integrase) and a transposon element, which includes a double-stranded transposon end sequence combined with a transposase (or other enzymes as described herein), and an adapter sequence attached to one of the two transposon end sequences. One chain of the double-stranded transposon end sequence is transferred to a chain of the target nucleic acid, while the complementary transposon end sequence chain is not transferred (non-transferred transposon sequence). Depending on the needs or expectations, the adapter sequence may include one or more functional sequences or components (e.g., primer sequences, anchor sequences, universal sequences, spacers, or index tag sequences).

[0049] A "transpososome complex" is composed of at least one transposase (or other enzymes as described herein) and a transposon recognition sequence. In some such systems, the transposase binds to the transposon recognition sequence to form a functional complex that can catalyze a transposition reaction. In some aspects, the transposon recognition sequence is a double-stranded transposon end sequence. The transposase binds to the transposase recognition site in the target nucleic acid and inserts the transposon recognition sequence into the target nucleic acid. In some such insertion events, one strand of the transposon recognition sequence (or end sequence) is transferred to the target nucleic acid, resulting in a cleavage event. Exemplary transposition procedures and systems that can be easily adapted for use with a transposase.

[0050] Exemplary transposases that can be used with certain embodiments provided herein include (or are encoded by): Tn5 transposase, Sleeping Beauty (SB) transposase, Vibrio harveyi, MuA transposase and Mu transposase recognition sites comprising R1 and R2 end sequences, Staphylococcus aureus Tn552, Ty1, Tn7 transposase, Tn / O and IS10, mariner transposase, Tc1, P element, Tn3, bacterial insertion sequence, retrovirus and yeast retrotransposons. More examples include engineered versions of IS5, Tn10, Tn903, IS911 and transposase family enzymes. The methods described herein may also include combinations of transposases, not just a single transposase.

[0051] In some embodiments, the transposase is Tn5, Tn7, MuA or Vibrio harveyi transposase or an active mutant thereof. In other embodiments, the transposase is Tn5 transposase or a mutant thereof. In other embodiments, the transposase is Tn5 transposase or a mutant thereof. In other embodiments, the transposase is Tn5 transposase or a mutant thereof. In other embodiments, the transposase is Tn5 transposase or an active mutant thereof. In some embodiments, the Tn5 transposase is a highly active Tn5 transposase or an active mutant thereof. In some aspects, the Tn5 transposase is a Tn5 transposase as described in PCT Publication No. WO2015 / 160895, which is incorporated herein by reference. In some aspects, the Tn5 transposase is a highly active Tn5 with mutations at positions 54, 56, 372, 212, 214, 251 and 338 relative to the wild-type Tn5 transposase. In some aspects, the Tn5 transposase is a highly active Tn5 with the following mutations relative to the wild-type Tn5 transposase: E54K, M56A, L372P, K212R, P214R, G251R and A338V. In some embodiments, the Tn5 transposase is a fusion protein. In some embodiments, the Tn5 transposase fusion protein comprises a fused elongation factor Ts (Tsf) tag. In some embodiments, the Tn5 transposase is a highly active Tn5 transposase comprising mutations at amino acids 54, 56 and 372 relative to the wild-type sequence. In some embodiments, the highly active Tn5 transposase is a fusion protein, optionally wherein the fusion protein is an elongation factor Ts (Tsf). In some embodiments, the recognition site is a Tn5-type transposase recognition site (Goryshin and Reznikoff, J. Biol. Chem., Vol. 273: p. 7367, 1998). In one embodiment, a transposase recognition site (e.g., EZ-Tn5 TMTransposase, Epicentre Biotechnologies, Madison, Wis.). In some embodiments, the Tn5 transposase is a wild-type Tn5 transposase.

[0052] In some embodiments, the transposome complex comprises a dimer of two molecules of a transposase. In some embodiments, the transposome complex is a homodimer in which two molecules of the transposase each bind to a first transposon and a second transposon of the same type (e.g., the sequences of the two transposons bound to each monomer are the same, thereby forming a "homodimer"). In some embodiments, the compositions and methods described herein employ two populations of transposome complexes. In some embodiments, the transposases in each population are the same. In some embodiments, the transposome complexes in each population are homodimers in which the first population has a first adapter sequence in each monomer and the second population has a different adapter sequence in each monomer.

[0053] In some embodiments, the transposase complex comprises a transposase (e.g., Tn5 transposase) dimer having a first monomer and a second monomer. In some aspects, each monomer comprises a first transposon, a second transposon, and an attachment polynucleotide, wherein the first transposon comprises a transposon end sequence (also referred to as a 3' transposon end sequence) at its 3' end and comprises an adapter sequence (also referred to as a 5' adapter sequence) at its 5' end; the second transposon comprises a transposon end sequence (also referred to as a 5' transposon end sequence) at its 5' end and comprises an adapter sequence (also referred to as a 3' adapter sequence) at its 3' end; and the attachment polynucleotide comprises an attachment adapter sequence, a primer sequence, and a linker hybridized with the 5' adapter sequence of the first transposon. In some embodiments, the 5' transposon end sequence of the second transposon is at least partially complementary to the 3' transposon end sequence of the first transposon. In some embodiments, the attachment adapter sequence of the attachment polynucleotide is at least partially complementary to the 5' adapter sequence of the first transposon. In some embodiments, the linker of the attachment polynucleotide comprises a binding element.

[0054] terminal sequence

[0055] In any embodiment of the methods described herein, the first transposon comprises a 3' transposon end sequence and the second transposon comprises a 5' transposon end sequence. In some embodiments, the 5' transposon end sequence is at least partially complementary to the 3' transposon end sequence. In some embodiments, the complementary transposon end sequences hybridize to form a double-stranded transposon end sequence that binds to a transposase (or other enzymes as described herein). In some embodiments, the transposon end sequence is a chimeric end (ME) sequence. Therefore, in some embodiments, the 3' transposon end sequence is a ME sequence and the 5' transposon end sequence is a ME' sequence.

[0056] Adaptor sequence

[0057] In any embodiment of the methods described herein, the first transposon comprises a 5' adapter sequence, and the second transposon comprises a 3' adapter sequence. The adapter sequence may comprise one or more functional sequences or components selected from primer sequences, anchor sequences, universal sequences, spacers, index sequences, capture sequences, barcode sequences, cleavage sequences, sequencing-related sequences, and combinations thereof. In some embodiments, the adapter sequence comprises a primer sequence. In other embodiments, the adapter sequence comprises a primer sequence and an index or barcode sequence. The primer sequence may also be a universal sequence. The present disclosure is not limited to the type of adapter sequence that can be used, and the technician will recognize additional sequences that can be used for library preparation and next-generation sequencing. Universal sequences are nucleotide sequence regions common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have a sequence difference region. Universal sequences that may be present in different members of a plurality of nucleic acid fragments may allow a single universal primer complementary to the universal sequence to be used to replicate or amplify a plurality of different sequences.

[0058] In some embodiments, the attachment polynucleotide comprises an attachment adapter sequence that hybridizes with a 5' adapter sequence. In some embodiments, the attachment adapter sequence is at least partially complementary to the 5' adapter sequence. In some embodiments, the adapter sequence is an A14 sequence or a B15 sequence. Therefore, in some embodiments, the 5' adapter sequence is an A14 sequence and the attachment adapter sequence is an A14' sequence. In some embodiments, the 3' adapter sequence is a B15' sequence. In some embodiments, the adapter sequence is any sequence for hybridization (referred to herein as sequence X). In some embodiments, sequence X comprises 16-20 nucleotides. In some embodiments, sequence X has a melting temperature (Tm) similar to that of the adapter sequence. In some embodiments, when the Tm of sequence X has a melting temperature similar to that of the adapter sequence, the sequencing result is improved. In some embodiments, sequence X has a melting temperature similar to that of the A14 sequence or the B15 sequence. In some embodiments, the Tm of sequence X is 53 °-56 °. In some embodiments, the adaptor sequence is transferred to the 5' end of the nucleic acid fragment by a fragment tagmentation reaction.

[0059] In any embodiment, the adapter sequence or transposon end sequence, including A14-ME, ME, B15-ME, ME', A14, B15 and ME, is provided as follows:

[0060] A14-ME:5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'(SEQ ID NO:1)

[0061] B15-ME:5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3'(SEQ ID NO:2)

[0062] ME':5'-phos-CTGTCTCTTATACACATCT-3'(SEQ ID NO:3)

[0063] A14:5'-TCGTCGGCAGCGTC-3'(SEQ ID NO:4)

[0064] B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)

[0065] ME:AGATGTGTATAAGAGACAG(SEQ ID NO:6)

[0066] Attaching polynucleotides

[0067] Embodiments of the transposome complex described herein include an attachment polynucleotide. As used herein, an attachment polynucleotide is a polynucleotide that hybridizes to a transposon at one end and binds to a surface at a second end. Thus, the transposome complex described herein is fixed to a solid support by the attachment polynucleotide. In some embodiments, the attachment polynucleotide comprises an attachment adapter sequence that hybridizes to an adapter sequence of a first transposon or an adapter sequence of a second transposon, a primer sequence, and a linker. In some embodiments, the linker comprises a binding element.

[0068] As described herein, the attachment adapter sequence may be at least partially complementary to the adapter sequence of the first transposon or the second transposon. In some embodiments, the attachment adapter sequence hybridizes with the 5' adapter sequence. In embodiments where the 5' adapter sequence is an A14 sequence, when the attachment adapter sequence hybridizes with the 5' adapter sequence, the attachment adapter sequence is an A14' sequence. In some embodiments, the adapter sequence is a sequence X. In some embodiments, the attachment adapter sequence hybridizes with the 3' adapter sequence. In embodiments where the 3' adapter sequence is a B15' sequence, when the attachment adapter sequence hybridizes with the 3' adapter sequence, the attachment adapter sequence is a B15' sequence. In any of these embodiments, the attachment adapter sequence may be fully complementary to the adapter sequence of the first transposon or the second transposon or partially complementary to the adapter sequence of the first transposon or the second transposon.

[0069] In some embodiments, the attachment polynucleotide comprises a primer sequence. In some embodiments, the primer sequence is a P5 primer sequence or a P7 primer sequence or its complementary sequence (e.g., P5' or P7'). P5 and P7 primers are used on the surface of commercial flow cells sold by Illumina, Inc. for sequencing on various Illumina platforms. Primer sequences are described in U.S. Patent Publication No. 2011 / 0059865, which is incorporated herein by reference in its entirety. Examples of P5 and P7 primers (which may be alkynes terminated at the 5' end) include the following primers:

[0070] P5:AATGATACGGCGACCACCGAGAUCTACAC(SEQ ID NO:7)

[0071] P7:CAAGCAGAAGACGGCATACGAG*AT(SEQ ID NO:8)

[0072] And their derivatives. In some examples, the P7 sequence includes a modified guanine at the G* position, such as 8-oxo-guanine. In other examples, * indicates that the bond between G* and adjacent 3'A is a thiophosphate bond. In some examples, P5 and / or P7 primers include non-natural joints. Optionally, one or both of P5 and P7 primers may include a polyT tail. The poly T tail is usually located at the 5' end of the sequence shown above, such as between the 5' base and the terminal alkyne unit, but may be located at the 3' end in some cases. The poly T sequence may include any number (e.g., 2 to 20) of T nucleotides. Although P5 and P7 primers are provided as examples, it should be understood that any suitable primer can be used in the examples proposed herein. An index sequence with a primer sequence (including P5 and P7 primer sequences) is used to add P5 and P7 to activate the library for sequencing. Although P5 and P7 primers are provided as examples, it should be understood that any suitable amplification primer can be used in the examples proposed herein.

[0073] As used herein, an example of a joint is a part that covalently connects a binding element to the end of a nucleotide portion of an attached polynucleotide and can be used to fix the attached polynucleotide to a solid support. The joint may be a cleavable joint, such as a joint that can be cleaved to remove the attached polynucleotide from the solid support and thus remove the transposome complex or fragment tagging product. The cleavable joint used herein is a joint that can be cleaved by chemical or physical means, such as photolysis, chemical cleavage, thermal cleavage or enzyme cleavage. In some embodiments, cleavage can be performed by biochemical, chemical, enzyme, nucleophilic, reduction-sensitive agents or other means. The cleavable joint may include a portion selected from the following: a restriction endonuclease site; at least one ribonucleotide that can be cleaved by RNAse; a nucleotide analog that can be cleaved in the presence of certain chemical agents; a photolyzable joint unit; a diol bond that can be cleaved by treatment with (for example) periodate; a disulfide group that can be cleaved by a chemical reducing agent; a cleavable portion that can be photochemically cleaved; and a peptide that can be cleaved by a peptidase or other suitable means. Cleavage can be mediated enzymatically by incorporation of a cleavable nucleotide or nucleobase into a cleavable linker, such as uracil or 8-oxo-guanine.

[0074] In some embodiments, the linkers described herein can be covalently and directly attached to the attachment polynucleotide, for example, forming an -O- bond, or can be covalently attached through another group such as a phosphate or ester. Alternatively, the linkers described herein can be covalently attached to a phosphate group of the attachment polynucleotide, for example, covalently attached to the 3' hydroxyl group via the phosphate group, thereby forming an -O-P(O)3- bond.

[0075] As used herein, a binding element is a moiety that can be used to covalently or non-covalently bind to a binding partner. In some aspects, the binding element is on the transposome complex and the binding partner is on a solid support. In some embodiments, the binding element can bind or non-covalently bind to a binding partner on a solid support, thereby non-covalently attaching the transposome complex to the solid support. In some embodiments, the binding element is capable of (covalently or non-covalently) binding to a binding partner on a solid support. In some aspects, the binding element (covalently or non-covalently) binds to a binding partner on a solid support, thereby producing an immobilized transposome complex.

[0076] In such embodiments, the binding element comprises or is, for example, biotin, and the binding partner comprises or is avidin or streptavidin protein. In other embodiments, the binding element / binding partner combination comprises or is FITC / anti-FITC, digoxin / digoxin antibody or hapten / antibody. Other suitable binding pairs include but are not limited to disulfide biotin-avidin, iminobiotin-avidin, biotin-avidin, disulfide biotin-succinylated avidin, iminobiotin-succinylated avidin, biotin-streptavidin and biotin-succinylated avidin. In some embodiments, the binding element is biotin, and the binding partner is streptavidin.

[0077] In some embodiments, the binding element can be bound to the binding partner by chemical reaction, or covalently bound by reaction with the binding partner on the solid support, thereby covalently attaching the transposome complex to the solid support. In some aspects, the binding element / binding partner combination comprises or is an amine / carboxylic acid (e.g., via standard peptide coupling reactions such as EDC or NHS-mediated coupling under conditions known to those of ordinary skill in the art). The reaction of the two components joins the binding element and the binding partner through an amide bond. Alternatively, the binding element and the binding partner can be two click chemistry partners (e.g., azide / alkyne, which react to form a triazole bond).

[0078] In some embodiments, the attachment polynucleotide also comprises additional sequences or components, such as universal sequences, spacers, anchor sequences or index tag sequences or combinations thereof. Universal sequences are regions of nucleotide sequences common to two or more nucleic acid fragments. Optionally, the two or more nucleic acid fragments also have regions of sequence differences. Universal sequences that may be present in different members of multiple nucleic acid fragments may allow the use of a single universal primer complementary to the universal sequence to replicate or amplify multiple different sequences.

[0079] In some embodiments, the first transposon further comprises a 5' primer sequence to the 5' adapter sequence, and the attachment polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 5' adapter sequence and (ii) a complementary primer sequence (see, e.g., Figure 4A , single-index, universal beads). Such constructs can be used as universal beads for single-index applications because no index tag sequence is employed.

[0080] In some embodiments, the first transposon further comprises a 5' primer sequence to the 5' adapter sequence, and the attachment polynucleotide comprises an index tag sequence and a primer sequence (see, e.g. Figure 4A , single index, index beads).

[0081] In some embodiments, the first transposon comprises a 5' adapter sequence, and the attachment polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 5' adapter sequence, (ii) a spacer, and (iii) a primer sequence (see, e.g., Figure 4A , universal beads, double indexed).

[0082] In some embodiments, the second transposon comprises a 3' adapter sequence, and the attachment polynucleotide comprises (i) a portion that is complementary to and hybridizes to the 3' adapter sequence, (ii) an index tag sequence, and (iii) a primer sequence (see, e.g., Figure 4A , double index, index beads).

[0083] In some embodiments, the attachment polynucleotide comprises a spacer (see e.g. Figure 4A) or spacer and anchor region (see, e.g., Fig. 3). As used herein, a spacer is a sequence, which refers to a nucleic acid sequence that does not carry any structure or coding information of a known gene function. The spacer on the attached polynucleotide can be compared with an index oligonucleotide with a different sequence (e.g., with a series of i5 sequences). In some embodiments, the spacer is a universal sequence. In some embodiments, the spacer is a non-DNA spacer. In some embodiments, the spacer comprises a universal base, such as inosine or nitroindole. In some embodiments, the spacer comprises an sp18 joint. As used herein, the sp18 joint is a standard modified joint with a C18 spacer (hexaethylene glycol spacer of 18 atoms), and the length is equal to 4 base pairs. Therefore, the length of a 2×sp18 joint is equal to 8 base pairs. In some embodiments, the spacer comprises a 2×sp18 synthetic joint. In some embodiments, the spacer comprises one or more C18 spacers, such as 1, 2, 3, 4, 5, 6 or more C18 spacers. In some embodiments, the spacer includes two C18 spacers (its length is equal to 8 nucleotides). In some embodiments, the spacer is a C9 spacer, and the length is equal to 2 base pairs. In some embodiments, the spacer includes one or more C9 spacers (triethylene glycol spacers), such as 1, 2, 3, 4, 5, 6 or more C9 spacers. In some embodiments, the spacer is a conventional spacer used with an existing index, such as a 10 base pair spacer. In some embodiments, the spacer is a combination of spacers, for example, a combination of one or more C18 spacers and one or more C9 spacers, or any combination of any spacers described herein. In some embodiments, the length of the spacer is equal to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20 or 30 base pairs. In some embodiments, the length of the spacer is approximately equal to 8 or 10 base pairs or nucleotides. In some embodiments, the spacer is particularly selected to be the same length as the index region. In some embodiments, the index region is 8 nucleotides long, and the spacer includes two C18 spacers. In some embodiments, the index region is 10 nucleotides in length and the spacer region comprises two C18 spacers and one C9 spacer.

[0084] In some aspects, the attachment polynucleotide comprises an anchor sequence. In some embodiments, the anchor sequence is GGATATGCTCGG (SEQ ID NO: 22). In some embodiments, the anchor sequence is an A14 sequence (SEQ ID NO: 4). As used herein, an anchor region refers to a DNA sequence that is complementary to an anchor complementary region in an index oligonucleotide and enables hybridization of the two components (see, e.g., Figure 3B). In some aspects, the anchor region is complementary to a portion of the anchor complementary region of the index oligonucleotide, wherein the index oligonucleotide comprises an anchor complementary region and an index tag sequence (-Anchor'-Index Tag Sequence-). In some embodiments, the anchor sequence is complementary to the anchor complementary region shared by multiple index oligonucleotides. In some embodiments, each index tag sequence in multiple index oligonucleotides is the same (no index) or different (index). In some embodiments, the index tag sequence is an i5 sequence. The attachment polynucleotide may also include additional sequence elements or components for improving the efficiency and function of the attachment polynucleotide binding to the index, including, for example, primer sequences, anchor sequences, universal sequences, spacers, index sequences, capture sequences, barcode sequences, cutting sequences, sequencing-related sequences, and combinations thereof. In some embodiments, the attachment polynucleotide comprises an A14' sequence.

[0085] Variations of the transposome complex, including the transposase, transposon, and attached polynucleotide, can be achieved. For example, variations in the configuration, design, hybridization, structural elements, and overall arrangement of the transposome complex can be achieved. The disclosure and figures provided herein provide several variations, but it should be understood that additional variations within the scope of the present disclosure can be readily achieved.

[0086] Solid carrier

[0087] The terms "solid surface", "solid support" and other grammatical equivalents refer to any material that is suitable or can be modified to be suitable for attachment of transposome complexes. As will be appreciated by those skilled in the art, the number of possible substrates is vast. Possible substrates include, but are not limited to, glass and modified or functionalized glass, plastics (including acrylic, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethane, Teflon, etc.), polysaccharides, polyhedral organosiliconsquioxane (POSS) materials, nylon or nitrocellulose, ceramics, resins, silica or silica-based materials (including silicon and modified silicon), carbon, metals, inorganic glasses, plastics, fiber optic bundles, beads, paramagnetic beads, and various other polymers.

[0088] Suitable bead compositions include, but are not limited to, plastics, ceramics, glass, polystyrene, methylstyrene, acrylic polymers, paramagnetic materials, thoria sols, carbon graphite, titanium dioxide, latex or cross-linked dextran (such as agarose gel), cellulose, nylon, cross-linked micelles and Teflon, as well as any other materials for solid supports outlined herein. In certain embodiments, the microspheres are magnetic microspheres or beads, such as paramagnetic particles, spheres or beads. The beads need not be spherical; irregular particles may be used. Alternatively or in addition, the beads may be porous. The bead size ranges from nanometers (e.g., 100 nm) to millimeters (e.g., 1 mm), with beads of about 0.2 microns to about 200 microns being preferred, beads of about 0.5 microns to about 5 microns being particularly preferred, but smaller or larger beads may be used in some embodiments. The beads may be coated with a binding partner, for example, the beads may be coated with streptavidin. In some embodiments, the beads are streptavidin-coated paramagnetic beads, such as Dynabeads MyOne Streptavidin C1 beads (ThermoScientific, catalog number 65601), Streptavidin MagneSphere paramagnetic particles (Promega catalog number Z5481), Streptavidin magnetic beads (NEB catalog number S1420S) and MaxBead Streptavidin (Abnova catalog number U0087). The solid support can also be a slide, such as a flow cell or other slide that has been modified so that the transposome complex can be immobilized thereon.

[0089] In some embodiments, the binding partner is present on the solid support or beads at a density of 1000 pmol / mg to about 6000 pmol / mg, or about 2000 pmol / mg to about 5000 pmol / mg, or about 3000 pmol / mg to about 5000 pmol / mg, or about 3500 pmol / mg to about 4500 pmol / mg.

[0090] In one embodiment, the solid surface is the inner surface of a sample tube. In another embodiment, the solid surface is a capture membrane. In one example, the capture membrane is a biotin capture membrane (e.g., from Promega Corporation). In another example, the capture membrane is a filter paper. In some embodiments of the present disclosure, the solid carrier is composed of an inert substrate or matrix (e.g., a glass slide, polymer beads, etc.), which has been functionalized, for example, by applying an intermediate material layer or coating containing a reactive group, which allows covalent attachment to molecules such as polynucleotides. Examples of such carriers include, but are not limited to, polyacrylamide hydrogels loaded on inert substrates such as glass, especially polyacrylamide hydrogels as described in WO2005 / 065814 and US2008 / 0280773, the contents of which are incorporated herein by reference in their entirety. Methods for tagging DNA fragments on a solid surface (fragmentation and tagging) to construct a fragment-tagged DNA library are described in WO2016 / 189331 and US2014 / 0093916A1, which are incorporated herein by reference in their entirety. In some embodiments, the transposome complex described herein is fixed to a solid support via a binding element. In some such embodiments, the solid support comprises streptavidin as a binding partner, and the binding element is biotin.

[0091] In some embodiments, the transposome complex is fixed on a solid support such as beads at a specific density or density range. In some embodiments, the density of the complex on the solid support refers to the concentration of the transposome complex in the solution during the fixation reaction. The complex density assumes that the fixation reaction is quantitative. Once the complex is formed at a specific density, the density remains constant for the batch of surface-bound transposome complexes. The resulting beads can be diluted, and the concentration of the resulting complex in the diluted solution is the preparation density of the beads divided by the dilution factor. The diluted bead stock solution retains the density of the complex at the time of preparation, but the complex is present in the diluted solution at a lower concentration. The dilution step does not change the density of the complex on the beads, thereby affecting the library yield, but does not affect the size of the insert (fragment). In some embodiments, the density is between about 5nM and about 1000nM, or between about 5nM and 150nM, or between about 10nM and 800nM. In other embodiments, the density is about 10nM, or about 25nM, or about 50nM, or about 100nM, or about 200nM, or about 300nM, or about 400nM, or about 500nM, or about 600nM, or about 700nM, or about 800nM, or about 900nM, or about 1000nM. In some embodiments, the density is about 100nM. In some embodiments, the density is about 300nM. In some embodiments, the density is about 600nM. In some embodiments, the density is about 800nM. In some embodiments, the density is about 100nM. In some embodiments, the density is about 1000nM.

[0092] Some embodiments provided herein relate to a kit comprising a transposome complex as described herein and an indexing mixture comprising an index sequence. Some embodiments provided herein relate to a kit comprising a composition having a solid support and a transposome complex as described herein immobilized thereon, and an indexing mixture comprising an index sequence. In some embodiments, the indexing mixture comprises an i5 index sequence and an i7 index sequence, wherein the i5 index sequence is complementary to and hybridizes with the attachment polynucleotide, and wherein the i7 index sequence is complementary to and hybridizes with the 3' adapter sequence.

[0093] Method for immobilizing transposome complexes / generating labeled nucleic acid fragments

[0094] The present disclosure also provides a method for preparing an immobilized transposome complex as described herein. Some embodiments provided herein relate to a method for generating a library of tagged nucleic acid fragments. In some embodiments, the method includes providing a solid support on which a transposome complex is fixed, applying the target nucleic acid to the solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and join the 3' end of the first transposon to the 5' end of the target fragment to produce a plurality of target fragments with 5' tags, and applying an index mixture comprising an index sequence to activate the library for sequencing. In some embodiments, the transposome complex comprises: a transposase bound to a first transposon and a second transposon, a first transposon comprising a 3' transposon end sequence and a 5' adapter sequence, an attachment polynucleotide comprising an attachment adapter sequence and a binding element, and a second transposon comprising a 5' transposon end sequence and a 3' adapter sequence.

[0095] In some embodiments, a method includes generating a library of tagged nucleic acid fragments, the method comprising contacting an immobilized transposome complex with the target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3' end of a first transposon to the 5' end of the target fragment to generate a plurality of 5'-tagged target fragments.

[0096] In some aspects, the method further comprises: treating the solid support to remove unbound nucleic acid; or optionally treating the solid support to remove the transposase from the complex by: (a) heating the solid support and / or (b) washing the solid support with an enzyme denaturing agent, wherein the enzyme denaturing agent optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea or a protease.

[0097] In some embodiments, contacting comprises adding a biological sample to the transposome complex. In some embodiments, the biological sample comprises cell lysate or whole cells, or is selected from blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirate, stool, macerated tissue, and fixed tissue FFPE.

[0098] In some aspects, contacting further comprises hybridizing a plurality of index oligonucleotides to the attachment polynucleotide, wherein the plurality of index oligonucleotides comprise the same or different index sequences.

[0099] In some aspects, the method also includes treating multiple 5'-tagged target fragments with polymerase and ligase to extend and connect the chains to produce completely double-stranded tagged fragments. In some aspects, the treatment with polymerase and ligase is carried out in the presence of a DNA secondary structure destroyer, wherein the destroyer is optionally DMSO. In some aspects, the treatment with polymerase and ligase is carried out in the presence of an oligonucleotide as a complementary sequence to a primer sequence, wherein the oligonucleotide is a P7' oligonucleotide, and wherein the primer sequence is a P7 sequence. In some embodiments, the polymerase comprises a T4 DNA polymerase mutant lacking exonuclease activity.

[0100] In some aspects, the method further comprises removing the fully double-stranded tagged fragments from the solid support. In some aspects, removing comprises applying heat and / or a denaturing agent sufficient to cleave the fully double-stranded tagged fragments from the solid support.

[0101] In some aspects, the method further comprises sequencing one or more of the target fragments with 5' tags or the fragments with complete double-stranded tags. In some aspects, the fragments are not quantified by PCR after contacting and before sequencing. In some aspects, the nucleic acid is DNA or RNA. In some aspects, the 3' adapter sequence is complementary to at least a portion of the index adapter sequence. In some aspects, the primer sequence of the attached polynucleotide is complementary to at least a portion of the index primer sequence. In some aspects, the primer sequence of the attached polynucleotide is complementary to the index primer sequence of the index polynucleotide.

[0102] In some embodiments, the method further comprises washing the solid support to remove unbound nucleic acid. In some embodiments, the method further comprises treating the solid support to remove the transposase. In some embodiments, treating the solid support comprises washing the solid support with an enzyme denaturant. In some embodiments, the enzyme denaturant comprises acetic acid, dimethyl sulfoxide (DMSO), dithiothreitol, ethanol, formaldehyde, formamide, glutaraldehyde, guanidine hydrochloride, lithium perchlorate, mercaptoethanol, propylene glycol, protease, sodium bicarbonate, sodium dodecyl sulfate (SDS), sodium salicylate, sulfosalicylic acid, trichloroacetic acid, tris (2-carboxyethyl) phosphine (TCEP) or urea. In some embodiments, treating the solid support comprises heating the solid support to remove the transposase. In some embodiments, applying the target nucleic acid comprises mixing the biological sample with the transposase complex. The nucleic acid does not need to be completely purified or does not need to be purified at all, and can be a part of the biological sample or a mixture with protein, other nucleic acid substances, other cell components and / or any other contaminants. In some embodiments, the biological sample comprises a cell lysate. In some embodiments, the biological sample comprises a whole cell. In some embodiments, the biological sample is selected from body fluids, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirates, stool, macerated tissue, and fixed tissue formalin-fixed paraffin-embedded tissue (FFPE).

[0103] In some embodiments, applying the index mixture includes hybridizing the index sequence with the attached polynucleotide and the second transposon. In some embodiments, the index mixture includes an extension-ligation mixture (ELM). In some embodiments, the ELM includes a polymerase and a ligase. In some embodiments, the ELM is a separate ELM for the separate connection of the index. In some embodiments, the polymerase includes T4 DNA polymerase or its mutant (such as a T4 DNA polymerase lacking exonuclease activity, or a mutant T4 DNA polymerase, or a mutant T4 DNA polymerase lacking exonuclease activity). In some embodiments, the ligase includes Escherichia coli (E.coli) DNA ligase. In some embodiments, the extension-ligation reaction is carried out in the presence of a DNA secondary structure destroying agent such as DMSO. In some embodiments, the method also includes denaturing a plurality of target fragments with 5' tags from a solid support. In some embodiments, denaturation can be achieved by applying heat and / or a denaturant sufficient to cut the target fragment with 5' tags from a solid support. In some embodiments, the method also includes sequencing one or more target fragments with 5' tags or their connection products in the target fragment with 5' tags or their connection products. In some embodiments, the nucleic acid is DNA or RNA.

[0104] In some aspects, such methods include contacting a first transposon and a second transposon as described herein with an attachment polynucleotide bound to a surface under conditions suitable for hybridizing the attachment polynucleotide to the first transposon or the second transposon. In some aspects, methods for preparing a solid support-bound transposome complex include incubating a transposome complex as described herein with a solid support comprising a binding partner under conditions sufficient to bind the binding element to the binding partner (covalently or non-covalently). An immobilized hybrid polynucleotide comprising the attachment polynucleotide and the first transposon and the second transposon is then contacted with a transposase under conditions suitable for forming a transposome complex.

[0105] In some embodiments, the first transposon and the second transposon as described herein are annealed to each other, and the first transposon is annealed to the attachment polynucleotide. The annealed polynucleotide is then loaded onto a transposase such as Tn5 transposase, thereby forming a transposome complex, which is then contacted and bound to a solid support such as beads. In some embodiments, the annealed transposon is bound to a solid support such as beads, and then the transposase is complexed with the transposon, thereby forming a transposome bound to the solid support.

[0106] In some aspects, a method for preparing fragments from a target nucleic acid is provided, the method comprising: providing a solid support comprising a transposome complex as described herein immobilized thereon; applying the target nucleic acid to the solid support under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and join the 3' end of the first transposon to the 5' end of the target fragment to produce a plurality of target fragments with 5' tags. In some aspects, the method further comprises applying an indexing mixture comprising an index sequence. In some embodiments, the fragmentation conditions are conditions suitable for fragment tagging by fragmenting and tagging the target nucleic acid using the transposome complex.

[0107] In some embodiments of the methods described herein, after fragmentation and tagging, the method further comprises washing the solid support to remove unbound nucleic acids. In some embodiments of the methods described herein, after fragmentation and tagging, the method further comprises removing the transposase. Removal of the transposase can be accomplished under chemical conditions, such as washing the solid support with a reagent to remove the transposase. In some embodiments, the reagent is sodium dodecyl sulfate (SDS).

[0108] In some embodiments, the method also includes contacting a solid support with an index mixture. Contacting the index mixture is used to tag the fragment with a specific index and activate the library for sequencing. In some embodiments, the index mixture comprises an oligonucleotide that hybridizes with a transposon or an attached polynucleotide to tag or index the nucleic acid fragment. Therefore, for example, the oligonucleotide comprises an index, and other regions of the oligonucleotide are complementary to and hybridize with a transposon or an attached polynucleotide. By way of example, in one embodiment, an i5 index with a primer sequence (P5 sequence), an index sequence (i5 sequence) and an anchor sequence is hybridized with an attached polynucleotide at a complementary sequence, so that P5 is hybridized with P5', and Anchor is hybridized with Anchor'. In some embodiments, the i5 sequence is combined with the nitroindole (nitro) sequence of the attached polynucleotide. In some embodiments, the nitroindole sequence is complementary to and hybridizes with any i5 index sequence. In one embodiment, the i7 index having a primer sequence (P7), an index sequence (i7), and an adapter sequence (B15 sequence) hybridizes with a second transposon at a complementary sequence, such that P7 hybridizes with P7', i7 hybridizes with i7', and B15 hybridizes with B15'. In some embodiments, the index mixture comprises a double-stranded index. After contacting the solid support with the index mixture, the fragments are connected and extended using an extension and ligation mixture (ELM). ELM may comprise, for example, T4 DNA polymerase and E. coli DNA ligase. Exemplary polymerases include, but are not limited to, Bst large fragments of Bst DNA polymerase I, E. coli DNA polymerase I (Klenow fragment), Klenow fragment (3'-5' exo-), T4 DNA polymerase, T7 DNA polymerase, Deep VentR. (Exo-) DNA polymerase, DeepVentR DNA polymerase, Therminator II DNA polymerase, AmpliTherm DNA polymerase, SP6 DNA polymerase or Taq polymerase, or mutants, analogs or derivatives of any of the foregoing polymerases. Exemplary ligases include, but are not limited to, T4 DNA ligase, T4 RNA ligase, Taq DNA ligase, Escherichia coli DNA ligase, Pfu DNA ligase and Tth DNA ligase. In some embodiments, ELM is a separate ELM reaction, for example, to allow differential indexing of index connection and index extension, for example, to allow separation of i5 connection and i7 extension. The solid support is then treated with a reagent (such as NaOH) to denature the chain sequence, thereby generating a labeled nucleic acid fragment.

[0109] In some embodiments, the fragments are deposited on a flow cell. In some embodiments, the fragments are hybridized with complementary primers grafted to a flow cell or surface. In some embodiments, the sequence of the sequencing fragments is detected by array sequencing or next generation sequencing methods such as sequencing by synthesis.

[0110] Table 1 shows exemplary sequences used in transposome complexes to generate libraries of tagged nucleic acid fragments.

[0111] Table 1: Exemplary sequences

[0112]

[0113]

[0114] In some aspects, the method of generating a library of tagged nucleic acid fragments comprises contacting an immobilized transposome complex with a target nucleic acid under conditions sufficient to fragment the target nucleic acid into a plurality of target fragments and to join the 3' end of a first transposon to the 5' end of a target fragment to produce a plurality of 5'-tagged target fragments; treating a solid support to remove unbound nucleic acid; or optionally treating the solid support to remove a transposase from the complex by: (a) heating the solid support and / or (b) washing the solid support with an enzyme denaturant, wherein the enzyme denaturant optionally comprises sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea or a protease; treating the plurality of tagged nucleic acid fragments with a polymerase and a ligase; 5'-tagged target fragments to extend and ligate these 5'-tagged target fragments to produce fully double-stranded tagged fragments, optionally wherein treatment with a polymerase and a ligase is performed in the presence of a DNA secondary structure disrupting agent, wherein the disrupting agent is optionally DMSO; removing the fully double-stranded tagged fragments from the solid support, optionally wherein removing comprises applying heat and / or a denaturing agent sufficient to cleave the fully double-stranded tagged fragments from the solid support, optionally wherein the denaturing agent is NaOH; and selecting the fully double-stranded tagged fragments using capture beads, optionally wherein the capture beads are magnetic beads, further optionally wherein two separate selection steps are performed.

[0115] In some embodiments, the immobilized transposome complex comprises: a solid support; and a transposome complex fixed to the solid support, wherein the transposome complex comprises: a transposase; a first transposon, the first transposon comprising a 3' transposon end sequence and an anchor sequence (Anchor); a second transposon, the second transposon comprising a 5' transposon end sequence and a B15' sequence; and an attachment polynucleotide, the attachment polynucleotide comprising an anchor sequence complementary sequence (Anchor'), an A14' sequence, a spacer and a P5' sequence and a binding element comprising biotin, wherein the biotin is fixed to the solid support. In some embodiments, the method further comprises sequencing one or more completely double-stranded tagged fragments in the completely double-stranded tagged fragments.

[0116] Method for generating labeled nucleic acid fragments by combined fragment tagging and indexing

[0117] In some embodiments, a dual-index double-end library can be prepared from a DNA sample using a combined fragment tagging and indexing step. By avoiding separate fragment tagging and indexing steps, this protocol has the advantages of being easy to use and of shorter duration. In addition, the protocol can avoid the denaturation step and produce a double-stranded library without the need for a separate step of producing a double-stranded sample from a denatured single-stranded sample. The protocol can also avoid certain washing steps, further reducing the time required for the workflow.

[0118] The method uses a first immobilized transposon complex and a second immobilized transposon complex. In the first immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attached polynucleotide is an anchor sequence complementary sequence. In the second immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attached polynucleotide is an anchor sequence complementary sequence. The anchor sequences of the first immobilized transposon complex and the second immobilized transposon complex can be non-complementary to avoid cross-hybridization. The first transposon complex may include an exemplary first attached polynucleotide, which includes (i) an anchor sequence complementary sequence, an A14' sequence, a spacer and a P5' sequence, and (ii) a binding element comprising biotin, and the second transposon complex may include an exemplary second attached polynucleotide, which includes (i) an anchor sequence complementary sequence, a B15' sequence, a spacer and a P7' sequence, and (ii) a binding element comprising biotin.

[0119] In the combined fragment tagging and indexing, a suspension of solid support-linked transpososomes (BLTs, i.e., immobilized transposon complexes) comprising a first transposome complex and a second transposome complex can be added to each well. The indexing step can then be performed in a single reaction solution, wherein the index 1 (i7) adapter, the index 2 (i5) adapter, and the sequence required for cluster generation sequencing are ligated in the same reaction solution as the fragment tagging. The first index oligonucleotide can comprise an A14 sequence, an i5 sequence, and a P5 sequence, and the second index oligonucleotide can comprise a B15 sequence, an i7 sequence, and a P7 sequence. The conditions for the fragment tagging / ligation step include a fragment tagging buffer and an E. coli DNA ligase added to a mixture of the target DNA, the first transposome complex and the second transposome complex, and the first index oligonucleotide and the second index oligonucleotide. The combined fragment tagging and indexing step can be performed for different times, for example, from at least 1 minute to at least 15 minutes, or from at least 5 minutes to at least 15 minutes.

[0120] The fragment tagging and indexing reaction can then be stopped using various methods, including heating the solid support and / or washing the solid support with an enzyme denaturant, such as optionally using sodium dodecyl sulfate (SDS), guanidine hydrochloride, urea or a protease. Whether by heating and / or by a washing step, the time for stopping the reaction can vary between at least 1 minute and at least 5 minutes.

[0121] The 5'-tagged target fragments attached to the index oligonucleotide can be treated with a polymerase to extend and generate fully double-stranded tagged fragments. The extension reaction can be performed for different times, such as from at least 1 minute to at least 10 minutes, or from at least 2 minutes to at least 10 minutes.

[0122] Furthermore, library preparation including combined fragment tagmentation and indexing can also avoid the qPCR step, since the final product is a double-stranded DNA library in solution.

[0123] In some embodiments, contacting the first immobilized transposome complex and the second immobilized transposome complex and treating the plurality of 5'-tagged target fragments with a ligase are performed in a single reaction.

[0124] In some embodiments, double-stranded tagged fragments are generated in solution.

[0125] Some embodiments further comprise selecting the completely double-stranded tagged fragments using capture beads, optionally wherein the capture beads are magnetic beads, further optionally wherein two separate selection steps are performed.

[0126] In some embodiments, the method further comprises sequencing one or more of the completely double-stranded tagged fragments.

[0127] Target nucleic acid

[0128] The target nucleic acid can be any type including DNA, RNA, cDNA, etc. For example, the target nucleic acid can be in a variety of purified states, including purified nucleic acid. In some embodiments, the biological sample comprises a mixture of nucleic acids (such as DNA), proteins, other nucleic acid materials, other cellular components, and / or any other contaminants present in a ratio roughly the same as that present in vivo. For example, in some embodiments, the component is present in a ratio identical to that present in intact cells. Because the method provided herein allows nucleic acid or DNA to be bound to a solid carrier by a fragment tagging process, other contaminants can be removed by washing the solid carrier after fragment tagging occurs. The biological sample can include, for example, a crude cell lysate or a whole cell. For example, the crude cell lysate applied to the solid carrier in the method shown herein does not need to undergo one or more separation steps traditionally used to separate nucleic acids from other cellular components.

[0129] Thus, in some embodiments, the biological sample may include not only purified nucleic acids from any source, but also unpurified nucleic acids or lysates thereof present in, for example, blood, plasma, serum, lymph, mucus, sputum, urine, semen, cerebrospinal fluid, bronchial aspirates, feces, and macerated tissues, or any other biological sample containing nucleic acid or DNA material. The target nucleic acid may be from a tissue sample, a tumor sample, a cancer cell, or a biopsy sample. The target nucleic acid may be cell-free DNA (cfDNA).

[0130] The target nucleic acid can be from any species, or from a mixture of species. For example, the target nucleic acid can be from a mammal (such as a human, dog, cat, cow, pig, sheep or other domestic animal) or other species (such as fish, bacteria, virus, fungus or archaea). The nucleic acid can be from an environmental sample, such as soil or water.

[0131] In some embodiments, the target nucleic acid is DNA. In one such embodiment, the DNA is double-stranded. In other embodiments, the double-stranded DNA comprises genomic DNA. In some other embodiments, the target nucleic acid is RNA or a derivative thereof, or cDNA. In some embodiments, the target nucleic acid is a product of an upstream reaction, such as an amplification or replication event, e.g., an amplicon. In some embodiments, the target nucleic acid is bisulfite-treated DNA.

[0132] In some embodiments, the biological sample (original sample or extract) is processed to purify the target nucleic acid before the fragment labeling method described herein. In some embodiments, the biological sample is an original sample or an original sample lysate (e.g., blood, saliva, one or more cells). In some embodiments, the processing method includes providing an original sample, an original sample lysate, or a pre-treated sample (e.g., a blood or saliva sample), mixing the sample with a lysis buffer and proteinase K, incubating the mixture to lyse the cells in the sample and release DNA from the cells, thereby providing a target nucleic acid for the fragment labeling method described herein. As long as the biological sample contains sufficient nucleic acid for analysis, there is no particular requirement for a certain amount of the biological sample. Thus, the amount of the biological sample may include about 1 μL to about 500 μL, such as 1 μL, 2 μL, 3 μL, 4 μL, 5 μL, 6 μL, 7 μL, 8 μL, 9 μL, 10 μL, 15 μL, 20 μL, 25 μL, 30 μL, 35 μL, 40 μL, 45 μL, 50 μL, 60 μL, 70 μL, 80 μL, 90 μL, 100 μL, 150 μL, 200 μL, 250 μL, 300 μL, 350 μL, 400 μL, 450 μL or 500 μL, or an amount within a range defined by any two of the foregoing values.

[0133] The components in the original sample or the original sample lysate (such as blood) or the additives (stabilizers in the collection tube) in the pre-treated sample (such as saliva) collected in the Oragene collection tube can inhibit the fragment tagging reaction. Therefore, the present invention provides a method for treating the original sample, the original sample lysate or the pre-treated sample to overcome this problem. In some embodiments, the method includes providing the original sample, the original sample lysate or the pre-treated sample (for example, a blood or saliva sample), mixing the sample with a lysis buffer, proteinase K and DNA capture or purification beads (for example, SPRI beads, beads containing carboxyl groups, wherein the beads are optionally magnetic beads), incubating the mixture to lyse the cells in the sample and release DNA from the cells, thereby capturing DNA on DNA purification beads or SPRI beads, and separating the beads containing the captured DNA from the mixture. Separation serves to remove the potential fragment tagging inhibitors present in the supernatant. The method also includes optionally washing the beads containing the captured DNA, and eluting the DNA from the beads to provide the target nucleic acid.

[0134] In some embodiments, the target nucleic acid is present in an amount sufficient to generate a library for sequencing. In some embodiments, the amount of the target nucleic acid is 10 ng-500 ng, such as 10 ng, 20 ng, 30 ng, 40 ng, 50 ng, 60 ng, 70 ng, 80 ng, 90 ng, 100 ng, 200 ng, 300 ng, 400 ng or 500 ng of gDNA, or an amount within a range defined by any two of the aforementioned values. In some embodiments, the target nucleic acid is a gDNA present in an amount of 50 ng.

[0135] Sequencing methods

[0136] Some methods provided herein include methods for analyzing nucleic acids. Such methods include preparing a library of template nucleic acids for target nucleic acids, obtaining sequence data from the library of template nucleic acids, and optionally assembling a sequence representation of target nucleic acids. The DNA fragments produced by transposome-mediated fragment labeling can be sequenced according to any suitable sequencing method, such as direct sequencing or next generation sequencing (including sequencing while synthesis, sequencing while connection, hybrid sequencing, sequencing based on release of proton detection) can use electrical detectors and related technologies derived from Ion Torrent (Guilford, CT, Life Technologies subsidiary), nanopore sequencing, etc. In some embodiments, DNA fragments are sequenced on a solid support such as a flow cell. Exemplary SBS procedures, fluid systems, and detection platforms that can be readily adapted for use with nucleic acid libraries generated by the methods of the present disclosure are described in, for example, Bentley et al., Nature, Vol. 456: pp. 53-59 (2008), WO 04 / 018497, US 7,057,026, WO91 / 06678; WO 07 / 123744, US 7,329,492, US 7,211,414, US 7,315,019, US 7,405,281, and US2008 / 0108082, each of which is incorporated herein by reference.

[0137] The methods described herein are not limited to any particular type of sequencing instrument used.

[0138] Example

[0139] The following examples are intended to illustrate but not limit the disclosure provided herein.

[0140] Example 1: No attached oligonucleotide with a user-cleavable linker

[0141] Experiments were performed to compare PCR-free sequencing data with PCR sequencing data. Libraries were prepared using TruSeq PCR-free, TruSeqNano (+PCR), Nextera Flex (+PCR), and the present method and then sequenced to 25X coverage. Each method had two replicates for a total of eight libraries. Fig. 7A It is shown that the PCR-free method (striped bars and checkered bars, representing the present method and TruSeq without PCR, respectively) has improved indel precision and recall compared to the method using PCR (black bars and white bars, representing TruSeq Nano and Nextera Flex, respectively). Figure 7B It is shown that the coverage of GC-rich promoter regions is also improved in the PCR-free method (the lower two figures, the method of the present invention in the lower left figure, and TruSeq without PCR in the lower right figure).

[0142] Example 2: Generating a library of tagged nucleic acid fragments without PCR amplification

[0143] Step A1. Formation of immobilized transposome complexes-index beads. A mixture of: (1) a first transposon having a 3' chimeric end (ME) sequence (SEQ ID NO: 6), a first tag sequence (A14), and a 5' primer sequence (P5') (25 μM final concentration); (2) a transposon having a 5' complementary chimeric end sequence (ME'; SEQ ID NO: 3) and a second tag sequence (B15') (37.5 μM final concentration); and (3) an attachment polynucleotide comprising a 3' sequence complementary to the second tag sequence (B15), an index sequence (in this case, i701 in Table 1), and a 5' primer sequence (P7) having biotin at the 5' end (25 μM final concentration) was annealed by treatment with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 25 mM NaCl, heating at 95°C for 10 minutes, and then cooling to 10°C over approximately 15 minutes. The annealed transposon / attached polynucleotide (2 μM final concentration based on the attached polynucleotide) was then mixed with transposase (6.1 μM final concentration) and incubated overnight at 37°C to form a solution-phase transposome complex ( Figure 4A, index bead map). The solution phase transposome complex is then immobilized on a solid support by mixing with streptavidin-coated beads. In some examples, immobilization can be performed in the presence of HT1 buffer (Illumina), which is a high salt buffer that facilitates the formation of biotin-streptavidin bonds. After rotating in HT1 for 1 hour, the beads are pelleted and washed once in a mixture of HT1 buffer and 50% glycerol standard storage buffer (Illumina) (9:1). The beads are then resuspended in 360 μL of buffer containing 50 mM Tris pH 7.5, 30 mM NaCl, and 0.1% Tween 20. 40 μL EPX2 (Illumina) is added and the beads are rotated for another 10 minutes at room temperature. The beads are pelleted again and then resuspended in 396 μL of the same buffer, treated with 4 μL of single-stranded binding protein (5 mg / mL), and rotated again for 10 minutes. The beads were re-pelleted, washed once in a 9:1 mixture of HT1: standard storage buffer, and resuspended in 15% glycerol standard storage buffer (Illumina). The resulting indexed beads were used in both single-index and dual-index fragment tagmentation protocols.

[0144] Step A2. Formation of immobilized transposome complexes—universal beads. Annealed transposons were prepared as described in step A1, except that the attachment polynucleotides comprised a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with biotin at the 3' end (for single indexing), and optionally an intervening universal nitroindole sequence (for dual indexing). Transposome complexes were prepared from annealed transposons and immobilized on a solid support as described in step A1. As indicated, the resulting universal beads were used in both single and dual index fragment tagging protocols.

[0145] Step B. Fragment tagging. DNA (e.g., about 50 pg to 5 μg) is mixed with the immobilized transposome complex and 50 μL of fragment tagging buffer (10 mM Tris acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide, as described in U.S. Pat. Nos. 9,080,211, 9,085,801, and 9,115,396, each of which is incorporated by reference), and the resulting mixture is incubated at 55° C. for 5 minutes. A library of tagged DNA fragments immobilized on beads is generated. The fragment tagging reaction mixture is treated with 10 μL of a stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, and the resulting mixture is incubated at 37° C. for 5 minutes to denature the transposase in the transposome complex. The beads with immobilized DNA fragments were then precipitated on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove any residual SDS. The beads were separated from the supernatant by magnetic capture and further washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20. The resulting fragments of all four methods were tagged in Figure 4B Shown in.

[0146] Step C. Extension, ligation and indexing. Extension and ligation are performed by contacting the beads with an extension and ligation mixture (ELM) containing T4 DNA polymerase (exonuclease-) and E. coli DNA ligase and incubating at 30°C for 15 minutes and then at 16°C for 15 minutes, thereby gap filling the DNA fragment between the 3' end of the fragment and the 5' end of the ME' sequence, and extending the single-stranded region to generate a completely double-stranded product by incorporating the remaining sequence from the attached polynucleotide ( Figure 4C ). In some cases, indexes are also added during this step. Figure 4D As shown in the upper right panel of , an index is added to the universal bead / single index construct by adding an oligonucleotide with a double-stranded primer sequence (P7 / P7'), a double-stranded index sequence (in this case, i701 / i701'), and a single-stranded overhang with a 3' sequence complementary to the second tag sequence (B15). Figure 4D , lower left), the indexing reagent includes a double-stranded primer sequence (P5 / P5'), a double-stranded index sequence (in this case, i501 / i501'), and a single-stranded overhang having a 5' sequence complementary to the first sequence tag (A14'). For the universal bead / dual indexing method ( Figure 4D, lower right), the indexing reagents are the same as in the universal bead / single index case, but an additional second indexing reagent comprising a complementary primer sequence (P5) and an index sequence (i5) is hybridized and ligated to the 5' end of the A14 sequence.

[0147] The reaction mixture was treated with 10 μL of a stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, and the resulting mixture was incubated at 37°C for 5 minutes to denature the transposase in the transposome complex. The beads with immobilized DNA fragments were then precipitated on a magnet and washed three times in a wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove any residual SDS. The beads were separated from the supernatant by magnetic capture and further washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20.

[0148] Step D. Release of tagged fragments. After the third wash, resuspend the beads in 100 μL 0.2N NaOH to denature the library fragments and release them from the beads. Purify the library by adding 100 μL of supernatant directly to 180 μL SPRI beads and eluting in 15 μL Illumina resuspension buffer following the standard SPRI purification protocol. The library was quantified by qPCR and then prepared for PCR by diluting to 5 μL of a solution of approximately 3200 pM and denaturing with 5 μL of 0.2N NaOH for 5 minutes at room temperature. Add cooled Illumina HT1 buffer (990 μL) and load the entire 1 mL mixture onto In the card box.

[0149] The results for index beads or universal beads with single or double indexes are shown in Figure 4E and are summarized in Table 2 below.

[0150] Table 2: Library preparation results for various transposome complex configurations

[0151]

[0152] Using the methods described herein, the bias in the sequencing data that is usually introduced with PCR is overcome. For example, using the PCR-free methods described herein, the resulting library of nucleic acid fragments is sequenced, and the sequences do not have significant gaps in GC-rich regions, as usually observed when using PCR.

[0153] Example 3: Sequencing comparison of test libraries

[0154] In this example, Nextera TM DNA Flex (which includes PCR) and TruSeq TM Two comparison libraries from a sample containing a known 100% GC repeat amplification (FMR1) were prepared using the PCR-free library preparation kit, and four test libraries were prepared using the universal bead / dual index method as described herein, such as Figure 4D As shown. Figure 8 As shown in the example from using Nextera TM In the sequencing data of the library prepared by DNA Flex, no repetitive sequences were detected (the first column, no bar is displayed, so the result is 0). TM Detection of repetitive sequences without PCR (column 2) and with the four test libraries (samples 1-4, columns 3-6) using the methods described herein. Thus, the methods of the present invention demonstrate improved detection of repetitive amplifications for samples with 100% GC regions.

[0155] Example 4: Forked oligonucleotides with cleavable linkers

[0156] Step 1. Formation of transposome complex. A biotinylated oligonucleotide (50 μM) containing 5' biotin, three T residues, then three U residues, P5, A14 and ME, whose sequence is: / 5Biosg / TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA (SEQ ID NO: 20) and an oligonucleotide (75 μM) containing ME'_B15'_P7', whose sequence is: CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 21) were treated with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA and 25 mM NaCl, heated to 95°C for 10 minutes, and then cooled to 10°C at -0.1°C / sec. The annealed transposon was then mixed with transposase such that the final concentration of the biotinylated oligonucleotide was 2 μM and the transposase concentration was 4 μM. The mixture was incubated overnight at 37°C to form a solution-phase transposome complex. The solution-phase transposome complex was then immobilized on a solid support by mixing with streptavidin-coated beads and HT1 buffer (Illumina) and rotating at room temperature for 1 hour. The beads were then washed three times in HT1 buffer and then resuspended in 15% glycerol standard storage buffer (Illumina) ( Figure 2A ).

[0157] Step 2. Fragment tagging. DNA (e.g., about 50 pg to 5 μg) is mixed with the immobilized transposome complex and 50 μL of fragment tagging buffer (10 mM Tris acetate (pH 7.6), 5 mM magnesium acetate, and 10% dimethylformamide, as described in U.S. Pat. Nos. 9,080,211, 9,085,801, and 9,115,396, each of which is incorporated by reference), and the resulting mixture is incubated at 55° C. for 5 minutes. A library of tagged DNA fragments immobilized on beads is generated. The fragment tagging reaction mixture is treated with 10 μL of a stop buffer containing 5% SDS, 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20, and the resulting mixture is incubated at 37° C. for 5 minutes to denature the transposase in the transposome complex. The beads with immobilized DNA fragments were then precipitated on a magnet and washed three times in wash buffer (100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween) to remove any residual SDS. The beads were separated from the supernatant by magnetic capture and further washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl, and 0.1% Tween 20.

[0158] Step 3. Extension and ligation. Extension and ligation are performed by the following steps: the beads are contacted with an extension and ligation mixture (ELM) containing T4 DNA polymerase (exonuclease-) and Escherichia coli DNA ligase and incubated at 30°C for 15 minutes, and then incubated at 16°C for 15 minutes, so that the gap is filled in the DNA fragment between the 3' end of the fragment and the 5' end of the ME' sequence. The reaction mixture is treated with 10 μL of a washing buffer containing 5% SDS, 100mM Tris-HCl (pH 7.5), 100mM NaCl and 0.1% Tween20, and the resulting mixture is incubated at 37°C for 5 minutes to denature the transposase in the transposome complex. The beads with immobilized DNA fragments are then precipitated on a magnet and washed three times in a washing buffer (100mM Tris-HCl (pH 7.5), 100mM NaCl and 0.1% Tween) to remove any residual SDS. The beads were separated from the supernatant by magnetic capture and further washed with 100 mM Tris-HCl (pH 7.5), 100 mM NaCl and 0.1% Tween20.

[0159] Step 4. Release of labeled fragments. After the third wash, the beads were resuspended in a buffer containing 50 mM potassium acetate, 20 mM tris-acetate, 10 mM magnesium acetate, and 100 μg / mL BSA. 5 μL of an enzyme mix containing uracil DNA glycosylase and endonuclease VIII was added and the library was incubated at 37°C for 30 minutes. The enzymes work together to cut the U in the attached oligonucleotide and release the library fragments into the solution. The library was purified by adding 100 μL of supernatant directly to the SPRI beads and eluting in 15 μL of Lumina resuspension buffer according to the standard size selection SPRI purification protocol (right 0.5x and left 0.7-0.8x). The resulting library was quantified by qPCR ( Figure 2B ).

[0160] Example 5: Improved extension-connection scheme

[0161] An alternative extension-ligation reaction with index variation can be used (Example 2C). In some cases, the extension efficiency of the i7 index is low due to secondary structures in certain index sequences. Figure 6C For the construct, eight different index pairs were investigated. Fig. 9A As shown, the %CV of the index pool was 76%. It was found that adding the P7' oligonucleotide during the extension-index reaction can improve the performance of some index pairs, which may be due to hybridization with the P7 sequence to disrupt or prevent secondary structure formation. In this case, the extension-index reaction also included ligation. During the extension-ligation-index reaction, P7' (with a 5' phosphate for ligation) was added at 2.5 μM. For Fig.6D The constructs shown, Fig. 9B The %CVs for eight index pairs less than 30% are shown.

[0162] Adding DMSO to the P7' oligonucleotide extension-ligation-indexing reaction further improved the %CV. Fig.6D The construct was added to the extension-ligation-indexing reaction at 5%. The extension-ligation reaction contains all the necessary enzymes and components for extension and ligation. The reaction was incubated at 37°C for 30 minutes and then continued with the normal working procedure. Fig. 9C As shown, the %CV for eight different index pairs was less than 20%. This result allows the system to adjust for variations in index performance without quantifying the DNA output of the library from each sample.

[0163] Example 6: Immobilized transposomes in tubes without PCR

[0164] This example demonstrates methods and systems for immobilizing transposome complexes in tubes, such as PCR tubes, for PCR-free whole genome sequencing. These methods are performed similarly to those described in Example 2, and the entire preparation can be performed in the same tube.

[0165] Formation of immobilized transposome complex in tube. A mixture of: (1) a first transposon having a 3' chimeric end (ME) sequence (SEQ ID NO: 6), a first tag sequence (A14), and a 5' primer sequence (P5) (25 μM final concentration); (2) a transposon having a 5' complementary chimeric end sequence (ME'; SEQ ID NO: 3) and a second tag sequence (B15') (37.5 μM final concentration); and (3) an attachment polynucleotide comprising a 3' sequence complementary to the second tag sequence (B15), an index sequence, and a 5' primer sequence (P7) having biotin at the 5' end (25 μM final concentration) was annealed by treatment with 10 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 25 mM NaCl, heating at 95°C for 10 minutes, and then cooling to 10°C over approximately 15 minutes. The attachment polynucleotide comprises a 5' sequence complementary to the first tag sequence (A14') and a 3' primer sequence (P5') with biotin at the 3' end (for single indexing). In some embodiments, the attachment polynucleotide comprises an intervening universal nitroindole sequence (for dual indexing). The annealed transposon / attachment polynucleotide (2 μM final concentration based on the attachment polynucleotide) is then mixed with transposase (6.1 μM final concentration) and incubated overnight at 37°C to form a solution-phase transposome complex. The solution-phase transposome complex is then immobilized on the surface of a PCR tube by mixing the complex (with biotin) with a streptavidin-coated surface in the PCR tube. In some examples, immobilization can be performed in the presence of HT1 buffer (Illumina, San Diego, CA), which is a high salt buffer that facilitates the formation of biotin-streptavidin bonds. After incubation for 1 hour, the PCR tube is washed in a mixture of TWB buffer (Illumina, San Diego, CA). The resulting tubes with transposomes immobilized thereon were used in both single-indexed and dual-indexed fragment tagmentation protocols.

[0166] The library preparation workflow including the steps of fragment tagmentation, extension, ligation and indexing was performed as outlined in Example 2. After completing the steps as outlined in Example 2, the library fragments immobilized to the tube surface were generated. The tube was rinsed with 50 μL of 0.2N NaOH to denature the library fragments and release them from the surface of the tube. The library was quantified by qPCR and then prepared for PCR by diluting to 5 μL of a solution of approximately 3200 pM and denaturing with 5 μL of 0.2N NaOH for 5 minutes at room temperature. Add cooled Illumina HT1 buffer (990 μL) and load the entire 1 mL mixture onto In the card box.

[0167] The sequencing results were Fig.10 , which shows coverage in a region of the genome known to be difficult to sequence (gene RNPEPL1). Two library preparation methods using PCR (Nextera Flex and tube-based Nextera) show gaps in the region where no sequence covers the gene, indicated by a rectangular bounding box. Both PCR-free methods were found to have good coverage in this region, as shown in Fig.10 As shown in the sections denoted as "No-PCR Flex" and "No-PCR Tube-Based Nextera".

[0168] Example 7: PCR-free preparation without cleavable adapter

[0169] The following example demonstrates a method and system for immobilizing a transposome complex in a tube, such as a PCR tube, for PCR-free whole genome sequencing. The method is performed similarly to the method described in Example 2, but without the attachment nucleotides comprising a cleavable linker or without the step of cleaving the linker. The method employs three separate oligonucleotides. Additional components of the method include a Tn5 transposon, SDS, an extension-ligation mixture (ELM), and a streptavidin-coated surface, such as a bead or plate.

[0170] A mixture of: (1) a first transposon having an ME sequence, a first tag sequence (A14), an i5 sequence, and a 5' primer sequence (P5); (2) a second transposon having a 5' complementary chimeric end sequence (ME'), a second tag (B15'), an i7' sequence, and a 3' primer sequence (P7'); and (3) an attachment polynucleotide comprising a P7 sequence and a binding element (such as biotin) can be prepared and attached to a surface (such as a streptavidin-coated plate or beads). Transposomes can be constructed and attached to a surface in a single step in the presence of a template nucleic acid in a fragment tagging buffer.

[0171] Fragment tagging was performed at 55°C for 5 minutes. PEG may be included in the fragment tagging reaction. The mixture was treated with SDS to remove the Tn5 transposase. ELM was performed and the supernatant was removed. This method does not require SPRI capture beads and therefore does not require adjustment of insert size via bead loading density. Fragments can be eluted in NaOH in preparation for sequencing.

[0172] Example 8: PCR-free preparation of 96-well library

[0173] The following examples show methods and systems for preparing up to 96 dual-index double-end libraries from DNA samples. The method is similar to the method described in Example 2, but two steps of incubation with capture beads are used to allow preparation without a final qPCR step. Since qPCR can be time-consuming (up to two hours), this protocol has the advantages of ease of use and shorter duration. The method is compatible with 25ng to 1000ng of DNA input. For human DNA samples and other large complex genomes, the DNA input can be greater than 200ng. For 200ng to 1000ng of DNA input, it is not necessary to quantify and normalize the initial DNA sample. For 25ng to 200ng of DNA input, the library is quantified and normalized before sequencing.

[0174] This method uses Fig.6D The first transposon, wherein the sequence X in the first transposon is ATCTGACTATCCCCTGCG (SEQ ID NO: 23), and the sequence X' in the attached polynucleotide is CGCAGGGGATAGTCAGAT (SEQ ID NO: 24). The anchor sequence is A14, and the spacer region consists of 2 C18 carbon spacers and 1 C9 carbon spacer (non-DNA sequence).

[0175] Fragment labeling. Add DNA in 10mM Tris-HCl (about 2μL to 30μL) to each well of a 96-well PCR plate so that the total input amount (ng) is within the desired range. If the DNA volume is <30μL, add nuclease-free water to the DNA sample to bring the total volume to 30μL. Add a suspension (10μL) of bead-linked transposomes (BLT) to each well, followed by 10μL of fragment labeling buffer. Load BLT on the beads at a concentration of about 50nM to 1000nM. Resuspend them in 15% glycerol standard storage buffer, which consists of 15% glycerol, 100mM NaCl, 50mM TrisHCl (pH 7.5), 0.1mM EDTA, 1mM DTT, 0.1% triton X-100. The sample was pipetted to mix until the beads were completely resuspended, and the plate was sealed and placed on a thermal cycler at 41°C for 5 minutes and then kept at 10°C. Fragment labeling times of 15 seconds, 30 seconds, 45 seconds, 60 seconds, 75 seconds, 90 seconds, 105 seconds, 120 seconds, and 300 seconds provided similar yields, with the length of the insert fragment increasing as the incubation time shortened (e.g., 15 seconds produced a longer insert fragment size than 60 seconds, 120 seconds, or 300 seconds). In some examples, the fragment labeling time was shortened to 1 minute.

[0176] Add 10 μL of SDS-containing stop fragment labeling buffer to each well, and pipette the resulting mixture until the beads are completely resuspended, then incubate the mixture for 1 to 5 minutes. Place the plate on a magnetic stand for 2 to 5 minutes, remove the supernatant and discard. Remove the plate from the magnet, and add 150 μL of fragment labeling wash buffer directly to the beads in each well. Mix the sample by pipetting, and place the plate on a magnetic stand until the solution is clear (approximately 2 to 5 minutes). This step removes SDS from the sample.

[0177] Extension / ligation. Index 1 (i7) adapters, index 2 (i5) adapters, and sequences required for cluster generation sequencing are added by extension / ligation. While the plate is still on the magnetic stand, remove the supernatant and discard. Remove the plate from the magnetic stand, add 45 μL of extension and ligation mixture to each well, and then pipette to resuspend the beads. Next, add the appropriate index adapter (5 μL) to each sample, and the plate is sealed and placed on a thermal cycler at 37°C for 5 minutes, 50°C for 5 minutes, and then kept at 10°C. The 37°C and 50°C incubation time periods can each be performed for 1 minute, 3 minutes, or 5 minutes, and all variants produce similar library yields. Shorter incubation time periods produce libraries with increased fragment sizes, while longer incubation time periods produce higher concentrations of ligation products. The plate is then placed on the magnetic stand for 2 to 5 minutes, and the supernatant is then removed.

[0178] Add 75 μL of fragment tagging wash buffer to the wells and pipette the mixture to resuspend the fragment tagging beads. Discard the supernatant, centrifuge the plate and place it on a magnet for 2 minutes to 5 minutes. Add 45 μL of 0.2 N NaOH to each well to denature the fragments. Pipette the mixture in each well to resuspend the fragment tagging beads and incubate the plate at room temperature for 1 minute to 5 minutes.

[0179] Library purification. Add 36 μL of capture beads (such as Ampure XP beads) to each well and mix the well contents to resuspend the beads, then incubate for 1 minute, 3 minutes, or 5 minutes. Place the plate on a magnetic stand for approximately 1 minute to 5 minutes until the supernatant is clear.

[0180] 42 μL of capture beads were added to each well of the second 96-well plate. Then, 76 μL of supernatant from each well of the first 96-well plate was added to the second 96-well plate with capture beads. The samples were mixed by pipetting and incubated for 1 minute, 3 minutes, or 5 minutes, and then placed on a magnetic stand until the supernatant was clear (approximately 1 minute to 5 minutes). In some examples, the second capture bead step was omitted.

[0181] Single or dual capture bead purification protocols, and 1 minute, 3 minute, or 5 minute incubations for each bead purification step are suitable.

[0182] After capture bead purification, the supernatant was discarded and the capture beads were washed twice with 180 μL of fresh 80% ethanol without mixing and incubated at room temperature before discarding the supernatant. Residual ethanol was removed by pipetting, the plate was air dried and removed from the magnetic stand.

[0183] 15 μ L to 22 μ L resuspension buffer is added to each well, and the well contents are mixed by pipetting to resuspend the beads. The plate is incubated at room temperature for 2 minutes, and then placed on a magnetic rack until the supernatant is clarified (approximately 2 minutes). A total of 14 μ L to 20 μ L supernatant from each well is transferred to the third 96-well PCR plate. This plate is the final DNA library and is prepared for sequencing as described above.

[0184] This protocol uses two purification steps with capture beads and eliminates the qPCR step, allowing library preparation to be completed in a shorter time. For example, samples were prepared in 30 minutes using these methods when a short magnet incubation step of 20 minutes total was used.

[0185] This protocol can be performed in other containers such as microcentrifuge tubes.

[0186] In some embodiments, to achieve optimal cluster density, equal library volumes are combined and the combined pool is quantified before sequencing. When using 200 ng to 1000 ng of DNA input, in some cases, the libraries are combined by combining equal volumes from each library in a 1.7 mL microcentrifuge tube, vortexing, and then centrifuging. The library pool is quantified using the ssDNA Qubit kit to determine the concentration of the pool. When using 25 ng to 200 ng of DNA input, in some examples, each library is quantified individually using the ssDNA Quibit kit.

[0187] In some examples, sequencing is performed on a NovaSeq 6000 cartridge.

[0188] Example 9: Library preparation by combined fragment tagging and indexing

[0189] The following example demonstrates a method and system for preparing a dual-indexed double-end library from a DNA sample using a combined fragment tagging and indexing step. The method is performed similarly to the method described in Example 2, but the fragment tagging and indexing are combined in one step. By avoiding separate fragment tagging and indexing steps, this protocol has the advantages of being easy to use and of shorter duration. In addition, the protocol can avoid the denaturation step and produce a double-stranded library without the need for a separate step to produce a double-stranded sample from a denatured single-stranded sample. The protocol can also avoid certain washing steps, further reducing the time required for the workflow.

[0190] To show that these libraries can be prepared using reactions performed for a given long, medium, or short period of time, three sets of samples were processed at a normal working flow rate, a fast working flow rate, and an ultra-fast working flow rate, respectively.

[0191] The method uses a first immobilized transposon complex and a second immobilized transposon complex. In the first immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attached polynucleotide is an anchor sequence complementary sequence. In the second immobilized transposon complex, the sequence X in the first transposon is an anchor sequence, and the sequence X' in the attached polynucleotide is an anchor sequence complementary sequence. The anchor sequences contained in the first immobilized transposon complex and the second immobilized transposon complex can be non-complementary to avoid cross-hybridization. The first transposon complex may include an exemplary first attached polynucleotide, which includes (i) an anchor sequence complementary sequence, an A14' sequence, a spacer and a P5' sequence, and (ii) a binding element comprising biotin, and the second transposon complex may include an exemplary second attached polynucleotide, which includes (i) an anchor sequence complementary sequence, a B15' sequence, a spacer and a P7' sequence, and (ii) a binding element comprising biotin.

[0192] Fragment tagging and indexing. DNA in 10 mM Tris-HCl (approximately 2 μL to 30 μL) was added to each well of a 96-well PCR plate so that the total input amount (ng) was within the desired range. A suspension of bead-linked transposomes (BLTs, i.e., immobilized transposon complexes) containing the first transposome complex and the second transposome complex was added to each well. The indexing step was performed in a single reaction solution, in which the index 1 (i7) adapter, index 2 (i5) adapter, and the sequence required for cluster generation sequencing were connected in the same reaction solution as the fragment tagging. In this example, the first index oligonucleotide contained an A14 sequence, an i5 sequence, and a P5 sequence, and the second index oligonucleotide contained a B15 sequence, an i7 sequence, and a P7 sequence. The conditions for the fragment tagging / ligation step included fragment tagging buffer and E. coli DNA ligase added to the target DNA, the first transposome complex and the second transposome complex, and the mixture of the first index oligonucleotide and the second index oligonucleotide, in a total volume of 20 μL. Fragment tagmentation and indexing reactions were performed at 41°C for three different time intervals (for three different samples): 15 min (normal workflow), 5 min (fast workflow), and 1 min (ultrafast workflow).

[0193] After the combined fragment tagmentation and indexing reaction, 5 μL of 0.6% SDS was added to each well and incubated at 37°C to terminate the fragment tagmentation reaction by washing with SDS to denature the transposase. The termination step was performed for three different time intervals (for three different samples): 5 minutes (normal workflow), 5 minutes (fast workflow), and 1 minute (ultra-fast workflow). Although the termination step was performed for the same time period for the normal workflow and the fast workflow, the total time for the fast workflow was still shorter due to the time differences in other steps.

[0194] Extension. 75 μL of extension mix (DNA polymerase, dNTPs and buffer) was added to each well, and the extension reaction was performed in a 100 μL reaction volume at <68°C. The extension step was performed for three different time intervals (for three different samples): 10 minutes (normal workflow), 2 minutes (fast workflow) and 1 minute (ultrafast workflow). This extension step can generate double-stranded DNA libraries in solution. Capture beads can be used for library purification.

[0195] Overall, the library yields of the normal working workflow and the rapid workflow are comparable to methods with separate fragment tagging and indexing steps, while the library yield of the ultra-rapid workflow may be sufficient for many uses, especially considering the additional convenience of the even faster workflow. The method with combined fragment tagging and indexing can allow the indexing oligonucleotide to bind to the transposase that did not successfully fragment the DNA sample (i.e., fragment tagging byproducts). In addition, combined fragment tagging and indexing can generate library products with P5 / P5 sequences or P7 / P7 sequences at both ends, and these library products with homozygous ends may not be sequenced correctly. However, for many applications, the amount of starting DNA sample is sufficient to achieve sequencing results even if some byproducts are generated.

[0196] A number of embodiments have been described. However, it should be understood that various modifications may be made. Therefore, other embodiments are also within the scope of the following claims.

[0197] Sequence Listing

[0198] SEQ ID NO:1-A14-ME

[0199] TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0200] SEQ ID NO:2-B15-ME

[0201] GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

[0202] SEQ ID NO:3-ME'

[0203] phos-CTGTCTCTTATACACATCT

[0204] SEQ ID NO:4-A14

[0205] TCGTCGGCAGCGTC

[0206] SEQ ID NO:5-B15

[0207] GTCTCGTGGGCTCGG

[0208] SEQ ID NO:6-ME

[0209] AGATGTGTATAAGAGACAG

[0210] SEQ ID NO:7–P5

[0211] AATGATACGGCGACCACCGAGAUCTACAC

[0212] SEQ ID NO:8–P7

[0213] CAAGCAGAAGACGGCATACGAG*A

[0214] SEQ ID NO:9-P5_A14_ME

[0215] AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0216] SEQ ID NO:10-P_ME'_B15'

[0217] 5Phos / CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

[0218] SEQ ID NO:11–Bio_P7_i701_B1_5_ddC

[0219] 5Biosg / CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG / 3ddC /

[0220] SEQ ID NO:12-A14'_P5'_bio

[0221] GACGCTGCCGACGAGTGTAGATCTCGGTGGTCGCCGTATCATT / 3Bio /

[0222] SEQ ID NO:13-P_A14_ME

[0223] 5Phos / TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

[0224] SEQ ID NO:14–A14'_nitro_P5'_bio

[0225] GACGCTGCCGACGACCC / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / / i5NitInd / GTGTAGATCTCGGTGGTCGCCGTATCATT / 3Bio /

[0226] SEQ ID NO:15–A14'_12anc'_2sp_P5'_bio

[0227] GACGCTGCCGACGACCGAGCATATCC / iSp18 / / iSp18 / GTGTAGATCTCGGTGGTCGCCGTATCATT / 3BioTEG /

[0228] SEQ ID NO:16-P5_i501

[0229] AATGATACGGCGACCACCGAGATCTACACTAGATCGC

[0230] SEQ ID NO:17-P_i701'_P7_ddC

[0231] 5Phos / TAAGGCGAATCTCGTATGCCGTCTTCTGCTTG / 3ddC /

[0232] SEQ ID NO:18–P7_i701_B15_ddC

[0233] CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGG / 3ddC /

[0234] SEQ ID NO:19-P5_i501_12anc

[0235] AATGATACGGCGACCACCGAGATCTACACTAGATCGCGGATATGCTCGG

[0236] SEQ ID NO:20—Biotinylated oligonucleotide

[0237] / 5Biosg / TTUUUAATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACA

[0238] SEQ ID NO:21-ME'_B15'_P7'

[0239] CTGTCTCTTATACACATCTCCGAGCCCACGAGACATCTCGTATGCCGTCTTCTGCTTG

[0240] SEQ ID NO:22—Exemplary anchor sequence

[0241] GGATATGCTCGG

[0242] SEQ ID NO: 23: Exemplary sequence X

[0243] ATCTGACTATCCCCTGCG

[0244] SEQ ID NO:24: Exemplary sequence X'

[0245] CGCAGGGGATAGTCAGAT。

Claims

1. A fragment-tagged insert sequence, comprising: a first nucleic acid fragment, wherein the 5' end of the first nucleic acid fragment comprises a first transposon end sequence and a first adaptor sequence, and wherein the 3' end of the first nucleic acid fragment comprises a second transposon end sequence and a second adaptor sequence; a second nucleic acid fragment that at least partially hybridizes to the first nucleic acid fragment, wherein the 3' end of the second nucleic acid fragment comprises a third transposon end sequence and a third adaptor sequence, and wherein the 5' end of the second nucleic acid fragment comprises a fourth transposon end sequence and a fourth adaptor sequence; and wherein the first transposon end sequence is complementary to the third transposon end sequence, and wherein the second transposon end sequence is complementary to the fourth transposon end sequence; and a first attachment polynucleotide comprising a first binding element and a second attachment polynucleotide comprising a second binding element, wherein the first attachment polynucleotide and the second attachment polynucleotide hybridize to: the first adaptor sequence and the fourth adaptor sequence; or The second adapter sequence and the third adapter sequence. 2 . The fragment-tagged insert sequence according to claim 1 , wherein the 5′ end of the first nucleic acid fragment further comprises a first primer sequence, and the 5′ end of the second nucleic acid fragment further comprises a second primer sequence. 3 . The fragment-tagged insert sequence of claim 1 , wherein the 5′ end of the first nucleic acid fragment and the 5′ end of the second nucleic acid fragment comprise terminal phosphate ends.

4. The fragment-tagged insert sequence of claim 1, wherein the first attachment polynucleotide and the second attachment polynucleotide comprise one or more universal bases.

5. The fragment-tagged insert sequence of claim 4, wherein the one or more universal bases comprise inosine, nitroindole, or both.

6. The fragment-tagged insert sequence of claim 1, wherein the first attachment polynucleotide comprises a first index sequence and the second attachment polynucleotide comprises a second index sequence.

7. The fragment-tagged insert sequence of claim 1, wherein the fragment-tagged insert sequence is attached to a solid support.

8. The fragment-tagged insert sequence of claim 1, wherein the first attachment polynucleotide, the second attachment polynucleotide, or both comprise an A14' sequence.

9. The fragment-tagged insert sequence of claim 1, wherein the first attachment polynucleotide comprises a first spacer region and a first anchor region, and the second attachment polynucleotide comprises a second spacer region and a second anchor region.

10. The fragment-tagged insert sequence of claim 1, wherein the first binding element is attached to the first adapter sequence and the fourth adapter sequence, or the second adapter sequence and the third adapter sequence, via a cleavable linker.

11. A transposome complex, comprising: Transposase; The first transposon; a second transposon that is partially complementary to the first transposon; as well as An attachment polynucleotide comprising: attaching an adapter sequence, the attached adapter sequence hybridizing to the first transposon or the second transposon; bonding elements; and Interval area. 12 . The transposome complex of claim 11 , wherein the attachment polynucleotide comprises an A14′ sequence.

13. The transposome complex of claim 11, wherein the spacer comprises one or more universal bases.

14. The transposome complex of claim 13, wherein the one or more universal bases comprise inosine, nitroindole, or both.

15. The transposome complex of claim 11, wherein the spacer comprises one or more C18 spacers, one or more C9 spacers, or a combination thereof. 16 . The transposome complex of claim 11 , wherein the spacer comprises a 2×spl8 synthetic linker, two C18 spacers, a C9 spacer, or two C18 spacers and one C9 spacer.

17. The transposome complex of claim 11, wherein the spacer is a non-DNA spacer.

18. The transposome complex of claim 11, wherein the length of the spacer is equal to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20 or 30 base pairs.

19. The transposome complex of claim 11, wherein the attachment polynucleotide comprises an anchor region. 20 . The transposome complex according to claim 19 , wherein the anchor region is complementary to an anchor-complementary region of an index oligonucleotide, wherein the index oligonucleotide comprises the anchor-complementary region and an index tag sequence (—Anchor'—IndexTag Sequence—).

21. The transposome complex of claim 20, wherein the anchor-complementary region is common to a plurality of index oligonucleotides.

22. The transposome complex of claim 21, wherein the binding element is immobilized to a solid support.

23. A transposome complex, comprising: Transposase; The first transposon; a second transposon that is partially complementary to the first transposon; as well as An attachment polynucleotide comprising: attaching an adapter sequence, the attached adapter sequence hybridizing to the first transposon or the second transposon; Combining elements; Non-DNA spacers; and Anchorage area. 24 . The transposome complex according to claim 23 , wherein the anchor region is complementary to an anchor-complementary region of an index oligonucleotide, wherein the index oligonucleotide comprises the anchor-complementary region and an index tag sequence (—Anchor'—IndexTag Sequence—).

25. The transposome complex of claim 23, wherein the non-DNA spacer comprises a 2xsp18 synthetic linker, two C18 spacers, a C9 spacer, or two C18 spacers and one C9 spacer.

26. The transposome complex of claim 23, wherein the non-DNA spacer has a length equal to 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 20, or 30 base pairs.

Images