Molecular marker primers, kit and application thereof for identifying the sex of Qinling salmon

Abstract

This invention provides molecular marker primers, kits, and their applications for sex identification of Qinling lenok, belonging to the field of salmonid sex identification technology. Through comparative analysis of the genomes of male and female Qinling lenok individuals, this invention identified two specific mutation sites in males. Two primer pairs, 617-F1 / R1 and 556-F1 / R1, were then designed based on the flanking regions of these two mutation sequences. Each primer can be used independently to identify the sex of Qinling lenok, offering stable, accurate, and reliable results. The molecular marker primers of this invention can be used for sex identification of Qinling lenok, which is of great significance to the development of Qinling lenok genetic breeding work.

Description

Technical Field

[0001] This invention relates to the field of salmonid sex identification technology, and in particular to molecular marker primers, kits and their applications for identifying the sex of Qinling fine-scaled salmon. Background Art

[0002] The Qinling lenok (Brachymystax tsinlingensis), belonging to the family Salmonidae in the order Salmoniformes, is mainly distributed in the mountain streams of the Qinling Mountains. Due to multiple factors such as habitat destruction, overfishing, and climate change, its wild population has declined sharply and it is listed as a national second-class protected animal. In recent years, a series of conservation actions, such as artificial breeding and release into the wild, have been carried out to increase the wild population. However, the population maintenance capacity of endangered animals is affected by various potential random factors, among which the sex ratio is one of the important potential random factors. In the process of artificial breeding, the sex ratio directly affects the reproductive efficiency and the recovery capacity of the subsequent population. Especially in small populations, maintaining an appropriate sex ratio is of great significance for avoiding inbreeding and maintaining genetic diversity. However, because the Qinling lenok reaches sexual maturity in a relatively long time (3-5 years), juvenile fish that meet the release criteria do not show significant sexual dimorphism characteristics, making it difficult to use traditional morphological methods for sex identification, resulting in difficulties in monitoring the sex ratio. Therefore, developing stable, simple, and low-cost sex molecular markers is of great significance for monitoring the sex ratio of released populations and will make an important contribution to the sustainable development and stability of the Qinling fine-scaled salmon wild population.

[0003] Molecular marker technology is a rapid, efficient, and accurate modern molecular biology technique for identifying genomic sequence differences, including SNPs (single nucleotide polymorphisms), SSRs (microsatellites), AFLPs (amplified fragment length polymorphisms), and InDel (insertion / deletion). InDel, due to its high stability and ease of detection, has been successfully applied to sex identification in various aquatic species. However, due to genomic sequence differences between species, molecular markers are difficult to apply across species. Therefore, it is necessary to develop sex molecular markers specifically for the Qinling fine-scaled salmon and establish an efficient sex identification technique, which is of great significance for optimizing its artificial breeding process and promoting population recovery.

[0004] A patent application with publication number "CN 112646870 A" discloses a method for sex identification in the lenok species *Brachymystaxlenok*. However, analysis shows that *B. lenok* and *B. tsinlingensis* diverged genetically over two million years ago, exhibiting significant genomic differences. According to biological principles, genetic differences between species often prevent the use of molecular markers across species. Therefore, when applying molecular markers based on different species, especially in sensitive areas such as sex identification, there are instances where markers are ineffective between species or cannot be applied across species. However, no molecular markers or primers for sex identification in the lenok species *B. tsinlingensis* have been found in the existing technology. Summary of the Invention

[0005] In view of the shortcomings of the prior art, the present invention provides two specific molecular markers for Qinling fine-scaled salmon and their primers. Each primer can be used independently to identify the sex of Qinling fine-scaled salmon, and has the advantages of stable, accurate and reliable results.

[0006] The sex of the Qinling lenok is determined by homomorphic chromosomes; males have heteromorphic chromosomes (XY), while females have homomorphic chromosomes (XX), exhibiting high similarity in structure and gene content, making them difficult to distinguish. Comparative analysis of male and female genome resequencing revealed two specific mutation sites in male Qinling lenok. To date, there are no reports, either domestically or internationally, of multiple pairs of genetic sex molecular markers for Qinling lenok. Therefore, developing multiple genetic sex molecular markers to accurately identify the sex of Qinling lenok has significant production application value in sex determination and breeding.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] This invention provides molecular marker primers for identifying the sex of Qinling fine-scaled salmon, including primer pair 617-F1 / R1, the nucleotide sequence of the upstream primer 617-F1 is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer 617-R1 is shown in SEQ ID NO:2.

[0009] This invention provides molecular marker primers for identifying the sex of Qinling fine-scaled salmon, including primer pair 556-F1 / R1, the nucleotide sequence of the upstream primer 556-F1 is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer 556-R1 is shown in SEQ ID NO:4.

[0010] The present invention also provides the application of the molecular marker primers in at least one of the following:

[0011] (1) Application in sex identification or screening of Qinling fine-scaled salmon;

[0012] (2) Application in the breeding of Qinling fine-scaled salmon;

[0013] (3) Application in the preparation of products for sex identification of Qinling fine-scaled salmon.

[0014] The present invention also provides a kit for identifying the sex of Qinling fine-scaled salmon, including molecular marker primers 617-F1 / R1 or 556-F1 / R1.

[0015] This invention also provides a method for identifying the sex of Qinling fine-scaled salmon, comprising the following steps:

[0016] S1. Extract genomic DNA from the Qinling fine-scaled salmon to be tested;

[0017] S2. Using the genomic DNA of the Qinling fine-scaled salmon to be tested as a template, PCR amplification was performed using molecular marker primers 617-F1 / R1 or 556-F1 / R1;

[0018] S3. After the amplification reaction is completed, electrophoresis is performed. If only one band appears, the sample is identified as female; if two bands appear, the sample is identified as male.

[0019] Preferably, the PCR amplification reaction system is 10 μL, comprising 0.3 μL of Qinling fine-scaled salmon genomic DNA, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 5 μL of RapidTaqMasterMix, and 4.1 μL of ddH2O.

[0020] Preferably, the PCR amplification reaction program is as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 40 s; 54℃ annealing for 30 s; 72℃ extension for 45 s; 35 cycles followed by 72℃ extension for 5 min.

[0021] Preferably, if primer pair 617-F1 / R1 is used for amplification, male samples show two amplification bands with lengths of 245bp and 122bp, respectively; female samples show only one amplification band with a length of 122bp.

[0022] Preferably, if primer pair 556-F1 / R1 is used for amplification, male samples show two amplification bands with lengths of 123bp and 94bp, respectively; female samples show only one band with a length of 94bp.

[0023] By adopting the above technical solution, the present invention has the following beneficial effects:

[0024] (1) Based on the whole genome resequencing data of male and female Qinling fine-scaled salmon, this invention accurately and quickly screened two male-specific molecular markers of Qinling fine-scaled salmon using the analysis method of sequence alignment and mutation site identification, and designed and provided two pairs of male-specific primers, which can quickly and reliably identify the sex of Qinling fine-scaled salmon.

[0025] (2) The method for sex identification of Qinling fine-scaled salmon using male-specific primers established in this invention only requires one PCR reaction to identify the sex of Qinling fine-scaled salmon; both primer pairs can be used independently to identify sex, which is time-saving, efficient and reliable. Attached Figure Description

[0026] Figure 1 Agarose gel electrophoresis images showing the sex differentiation of 68 female and 66 male Qinling lenok using primer pairs 617-F1 / R1 and 556-F1 / R1.

[0027] Figure 2 This study analyzes the similarity between the primer sequences used in this invention and those in existing patents.

[0028] Figure 3 This is an agarose gel electrophoresis image of 7 pairs of primers that could not effectively distinguish between genders during the experimental process of this invention. Detailed Implementation

[0029] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0030] Example 1. Development of molecular marker primers for male and female sex of Qinling fine-scaled salmon

[0031] This invention provides two pairs of molecular marker primers capable of identifying the sex of Qinling lenok. Each primer can be used independently to identify the sex of Qinling lenok. The sex marker primers for Qinling lenok are obtained through the following steps:

[0032] I. Sequencing Library Construction and Resequencing

[0033] 1. DNA extraction from Qinling fine-scaled salmon

[0034] DNA extraction was performed using the ammonium acetate method. A very small amount of fin strips was cut, minced, and lysed. Proteinase K was added, and the mixture was incubated in a water bath until no residue remained. After cooling, ammonium acetate was added, and the mixture was centrifuged. The supernatant was then added to isopropanol to precipitate the DNA. After centrifugation, the DNA was washed several times with ethanol to remove impurities. Finally, the DNA was dissolved, its quality and concentration were determined, and it was diluted and stored at -20°C for later use.

[0035] 2. Using whole-genome resequencing data from 5 male and 5 female Qinling lenok, male-specific mutation sites were screened based on sequence alignment and mutation site identification, as shown in SEQ ID NO:5 (123bp) and SEQ ID NO:6 (29bp), respectively.

[0036] SEQ ID NO:5:

[0037] ACCGCTGTCACGTCCAGGCCTGAGAAGACAGGCTGGAGTGTTTA GTTTGTTTTAGGTGTAGGGGTTTTCTGTTCTAGGTTTTATATTTCTATGT TGGTCTGTCCCTATAGAAGATCGTGACA.

[0038] Primers were designed in the flanking region of this mutant sequence. The sequence information is as follows:

[0039] 617-F1: GTGGCACGCAGTGTAAAAAGGGTCT (SEQ ID NO: 1);

[0040] 617-R1: ATCAAACTAAAATGTCAACAGGCAG (SEQ ID NO: 2).

[0041] Another mutated sequence is:

[0042] TGCACATCTGGCATTTTGTTTTATACTAA (SEQ ID NO: 6).

[0043] Primers were designed in the flanking region of this mutant sequence. The sequence information is as follows:

[0044] 556-F1: CCTTTTCTTGTAGCAGTGGA (SEQ ID NO: 3);

[0045] 556-R1: ATGCTTTGTTTTGGTGATTT (SEQ ID NO: 4).

[0046] Example 2. Sex determination of Qinling fine-scaled salmon using molecular marker primers.

[0047] This embodiment uses the Qinling fine-scaled salmon sex molecular marker primers from Example 1 to identify the sex of Qinling fine-scaled salmon. The steps are as follows:

[0048] (1) The above-mentioned Qinling fine-scaled salmon sex molecular marker primers were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0049] (2) Samples were collected from the Baiyunxia Qinling Fine-scaled Salmon Breeding Farm. Sex was determined based on the sperm or eggs produced by sexually mature parent fish used for artificial breeding. A total of 68 female and 66 male Qinling Fine-scaled Salmon were obtained. A very small amount of fin rays were cut from each sample, and DNA samples were prepared using the ammonium acetate method.

[0050] (3) PCR amplification verification:

[0051] DNA samples from 68 female and 66 male Qinling lenok were verified by PCR using primer pair 617-F1 / R1 and primer pair 556-F1 / R1, respectively.

[0052] The total PCR amplification reaction volume is 10 μL, including the following reagents:

[0053] Qinling fine-scaled salmon genomic DNA: 0.3 μL (15 ng);

[0054] Upstream primer: 0.3 μL (150 ng);

[0055] Downstream primer: 0.3 μL (150 ng);

[0056] 2×Rapid Taq MasterMix: 5μL;

[0057] ddH2O: 4.1 μL.

[0058] Rapid Taq MasterMix, consisting of Taq DNA polymerase, dNTPs, and reaction buffer, was purchased from Shanghai Sangon Biotech Co., Ltd. After the reaction system was prepared, it was thoroughly mixed using a vortex mixer, and then the residue remaining on the tube wall was centrifuged to the solution at the bottom of the tube.

[0059] The PCR reaction program was as follows: 94℃ pre-denaturation for 4 min; 94℃ denaturation for 40 s; 54℃ annealing for 30 s; 72℃ extension for 45 s; 35 cycles followed by 72℃ extension for 5 min.

[0060] After the PCR reaction, agarose gel electrophoresis is performed. The gel electrophoresis detection involves three steps:

[0061] 1) Prepare a 3% agarose gel and add 2 μL of nucleic acid dye, then let it solidify at room temperature for 40 min;

[0062] 2) Apply 5 μL of PCR product using the wet spot method, followed by electrophoresis at 120V for 50-80 min;

[0063] 3) Once the DNA bands are clearly separated, image them using an electrophoresis gel imaging system, and analyze the sex composition of the sample based on the imaging results.

[0064] The results are as follows Figure 1 As shown, the results indicate that both primer pairs produced two bands in males and only one band in females. One band in males was the same length as in females, while the other band was male-specific.

[0065] When amplified using primer pair 617-F1 / R1, the amplification products of male samples were 245bp and 122bp, as shown in SEQ ID NO:7 and SEQ ID NO:8, respectively. Female samples showed only one amplification band of 122bp.

[0066] SEQ ID NO:7:GTGGCAGCAGTGTAAAAAGGGTCTTCCTAAAATC CCAAAATCTATAAAGATTATATTCTAATTTCACCGCTGTCACGTCCAGGCCTGAGAAGACAGGCTGGAGTGTTTAGTTTTGTTTTAGGTGTAGGGGTTTTCTGTTCTAGGTTTTATATTTCTATGTTGGTCTGTCCCTATAGAAGATCGTGACAACCGCTCATTTCTTGGCTGCACCCATGTGGACTGCCTGTTGACATTTTAGTTTGAT.

[0067] SEQ ID NO:8: GTGGCACGCAGTGTAAAAAGGGTCTTCCTAAAATCC CAAAATCTATAAAGATTATATTCTAATTTAACCGCTCATTTCTTGGCTGC ACCCATGTGGACTGCCTGTTGACATTTTAGTTTGAT.

[0068] When amplified using primer pair 556-F1 / R, the amplification products of male samples were 123 bp and 94 bp, as shown in SEQ ID NO:9 and SEQ ID NO:10, respectively. Female samples showed only one amplification band of 94 bp.

[0069] SEQ ID NO:9: CCTTTTCTTGTAGCAGTGGAGCCACTGCACATCTGG CATTTTGTTTTATACTAAAAGTCTTGCAGAGTGAACAACTGAAACAAAT TTATGATATGACAAAAATAAATCACCAAAACAAAGCAT.

[0070] SEQ ID NO:10: CCTTTTCTTGTAGCAGTGGAGCCACAAGTCTTGCA GAGTGAACAACTGAAACAAATTTATGATATGACAAAAATAAATCACCA AAACAAAGCAT.

[0071] Example 3. Primer sequence differential analysis

[0072] The primer sequences of this invention differ significantly from those in an existing patent (CN 112646870A). Comparative analysis using ClustalW in MEGAX revealed no significant sequence similarity between the primer sequences used in this invention and those in the existing patent. Figure 2 Specifically, the selected primers showed extremely low homology with known primers, indicating that the two sets of primers target significantly different gene regions and have different specificities, making them incompatible. This sequence difference further demonstrates their independence at the molecular level.

[0073] Example 4

[0074] In the development of the molecular marker primers of this invention, a total of 9 pairs of candidate primers were designed and systematically screened, and 2 pairs of primers with the best performance (617-F1 / R1; 556-F1 / R1) were selected for sex marker identification. Figure 1 These two preferred primer pairs demonstrated good specificity and stability in the experiment, achieving efficient sex differentiation. In contrast, the remaining seven primer pairs failed to achieve the expected results, exhibiting poor sensitivity or stability and failing to effectively differentiate sex. Figure 3 By comparing with preferred primers, it is clear that the primers used in this invention have significant advantages and can more efficiently meet the needs of sex identification.

[0075] As can be seen from the above embodiments, the present invention provides a molecular marker primer, kit and its application for identifying the sex of Qinling lenok, which can achieve accurate sex differentiation of Qinling lenok.

[0076] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Molecular marker primers for sex identification of Qinling fine-scaled salmon, characterized in that, It includes primer pair 617-F1 / R1, the nucleotide sequence of the upstream primer 617-F1 is shown in SEQ ID NO:1, and the nucleotide sequence of the downstream primer 617-R1 is shown in SEQ ID NO:

2.

2. Molecular marker primers for sex identification of Qinling fine-scaled salmon, characterized in that, It includes primer pair 556-F1 / R1, the nucleotide sequence of the upstream primer 556-F1 is shown in SEQ ID NO:3, and the nucleotide sequence of the downstream primer 556-R1 is shown in SEQ ID NO:

4.

3. The use of the molecular marker primer according to claim 1 or 2 in at least one of the following: (1) Application in sex identification or screening of Qinling fine-scaled salmon; (2) Application in sex breeding of Qinling fine-scaled salmon; (3) Application in the preparation of products for sex identification of Qinling fine-scaled salmon.

4. A kit for identifying the sex of Qinling fine-scaled salmon, characterized in that, Includes the molecular marker primers as described in claim 1 or 2.

5. A method for identifying the sex of Qinling fine-scaled salmon, characterized in that, Includes the following steps: S1. Extract genomic DNA from the Qinling fine-scaled salmon to be tested; S2. Using the genomic DNA of the Qinling fine-scaled salmon to be tested as a template, PCR amplification was performed using the molecular marker primers described in claim 1 or 2; S3. After the amplification reaction is completed, electrophoresis is performed. If only one band appears, the sample is identified as female; if two bands appear, the sample is identified as male.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system was 10 μL, including 0.3 μL of Qinling fine-scaled salmon genomic DNA, 0.3 μL of upstream primer, 0.3 μL of downstream primer, 5 μL of Rapid Taq MasterMix, and 4.1 μL of ddH2O.

7. The method according to claim 5, characterized in that, When primer pair 617-F1 / R1 is used for amplification, male samples show two amplification bands with lengths of 245bp and 122bp, respectively; female samples show only one amplification band with a length of 122bp.

8. The method according to claim 5, characterized in that, When primer pair 556-F1 / R1 is used for amplification, male samples show two amplification bands with lengths of 123bp and 94bp, respectively; female samples show only one band with a length of 94bp.

Images