Primer probe combination and kit for detecting strain abundance and application of primer probe combination and kit

Abstract

The invention discloses a primer probe combination and a kit for detecting strain abundance and application of the primer probe combination and the kit. According to the present invention, the primer probe combination and the kit have characteristics of high sensitivity and high specificity in the detection of Akkermansia muciniphila, Bacteroides multiforme, Doramecena long chain and Macromonas, can achieve the wide strain detection, and are suitable for the clinical diagnosis and the scientific research application, and the kit can be used for the detection of Akkermansia muciniphila, Bacteroides multiforme, Doramecena long chain and Macromonas, and can be used for the detection of the bacterial strains, such that the kit can be used for the detection of the bacterial strains, such that the kit can be used for the detection of the bacterial strains, and can be used for the detection of the bacterial strains, and can be used for the detection of the bacterial strains.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a primer-probe combination for detecting bacterial abundance, a kit and applications thereof. Background Art

[0002] Current studies have shown that intestinal microorganisms play an extremely important role in the occurrence and development of metabolic diseases in people. Intestinal flora disorders may increase the risk of metabolic diseases such as obesity, type 2 diabetes, and non-alcoholic fatty liver disease. At present, through population cohort combined with animal experimental studies, a series of functional mechanisms of intestinal bacteria regulating obesity and metabolic diseases have been found, such as Akkermansia muciniphila (Akk bacteria), Bacteroides thetaiotaomicron, Dorea longicatena, and Megamonas rupellensis. The former two are reduced in obese people, while the latter two are increased in obese people. At present, studies have shown that these four bacteria have a regulatory effect on obesity and the body's metabolic function, and are promising intervention target bacteria. Therefore, accurate and rapid detection of the levels of these species in the human body is particularly necessary for identifying people at metabolic risk and conducting clinical interventions.

[0003] Take Akk bacteria as an example. This bacterium is a bacterium that colonizes in the intestinal mucus layer. It uses mucus proteins secreted by the host as its only source of carbon and nitrogen to protect the intestine from pathogens. It plays a very important role in maintaining intestinal homeostasis and health, participating in lipid metabolism and immune response, and is considered to be a next-generation probiotic with great development potential.

[0004] Based on the important role of Akk bacteria in promoting human health and the occurrence of diseases, detecting the abundance of Akk bacteria in the human body is crucial for judging the disease state; on the other hand, whether patients with metabolic disorders in clinical practice need Akk bacteria intervention, and under what circumstances can patients obtain better metabolic benefits by supplementing Akk bacteria under the guidance of the concept of precision medicine, these issues can also be judged by monitoring the abundance of Akk bacteria in the body. Therefore, monitoring the abundance of Akkermansia muciniphila in the intestine is of great value for evaluating the health status of the host and judging the efficacy of treatment. However, the current quantitative detection method for this bacterium is not accurate and efficient enough, so it is urgent to establish a convenient, rapid and highly specific Akk bacteria detection technology.

[0005] At present, the fecal Akk bacteria detection technology used in the field is real-time fluorescence quantitative PCR using fluorescent dyes. The SYBRGreen dye method is widely used in experiments because of its advantages such as ease of use and low price. However, its biggest disadvantage is the lack of specificity, that is, the dye can bind to any dsDNA. Therefore, the appearance of nonspecific amplification products in the qPCR reaction will increase the fluorescence value and affect the accuracy of the quantitative results. In general, the experiment is prone to false positives, has high requirements for primer specificity, and has relatively low sensitivity. These shortcomings make it difficult to meet the requirements of high sensitivity and high specificity in clinical diagnosis, so this method is more suitable for basic research rather than clinical testing needs. Summary of the invention

[0006] The commonly used SYBR Green dye method is easily interfered by nonspecific amplification products due to its nonspecific binding characteristics, resulting in reduced accuracy of the test results and a high false positive rate. In addition, the existing detection methods have high requirements for primer specificity, and the sensitivity and repeatability are still relatively low, which is difficult to meet the clinical needs of rapid and accurate detection. In order to solve the problems of insufficient specificity and limited sensitivity in the methods for detecting Akkermansia muciniphila, Bacteroides_thetaiotaomicron bacteria, Dorea_longicatena bacteria and Megamonas_rupellensis bacteria in the prior art, the present invention provides a primer probe combination, a kit and its application for detecting the abundance of bacterial species.

[0007] Specifically, the present invention provides a combination of primers and probes, wherein the combination of primers and probes comprises one or more of the following:

[0008] (1) an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, and a probe as shown in SEQ ID NO: 3

[0009] (2) an upstream primer as shown in SEQ ID NO:4, an upstream primer as shown in SEQ ID NO:5, and a probe as shown in SEQ ID NO:6;

[0010] (3) an upstream primer as shown in SEQ ID NO:7, an upstream primer as shown in SEQ ID NO:8, and a probe as shown in SEQ ID NO:9;

[0011] (4) an upstream primer as shown in SEQ ID NO:10, an upstream primer as shown in SEQ ID NO:11 and a probe as shown in SEQ ID NO:12.

[0012] In some specific embodiments, the primer probes in group (1) are primer probes for detecting Akkermansia muciniphila.

[0013] In some specific embodiments, the primer probes in group (2) are primer probes for detecting Bacteroides thetaiotaomicron.

[0014] In some specific embodiments, the primer probes in group (3) are primer probes for detecting Dorea_longicatena.

[0015] In some specific embodiments, the primer probes in group (4) are primer probes for detecting Megamonas_rupellensis.

[0016] In some embodiments, the 3' end of the probe further comprises a 3'BHQ2 or 3'BHQ1 probe.

[0017] In some embodiments, the probe comprises a fluorescent label, which is located at the 5' end of the probe and is selected from any one of VIC, CY5, FAM, ROX and HEX.

[0018] Herein, the combination is a primer-probe set placed separately or a primer-probe composition placed mixedly.

[0019] The present invention also provides a kit, which comprises the combination of the primer and probe.

[0020] In some embodiments, the kit further comprises a PCR amplification reaction solution; the PCR amplification reaction solution comprises one or more of Taq enzyme, buffer, dNTP, UDG enzyme and sterile water.

[0021] In some specific embodiments, the kit further comprises a reference positive control solution and / or a negative control solution.

[0022] In some specific embodiments, the PCR amplification reaction solution includes Probe qPCR Mix reagent.

[0023] The present invention also provides a method for detecting bacterial species abundance, the method comprising using the combination of primers and probes or the kit, and comprising the following steps:

[0024] a) adding the primer-probe combination to the sample to be tested, and adding PCR amplification reaction solution, and placing the sample in a fluorescent quantitative PCR instrument for PCR amplification reaction;

[0025] b) Performing fluorescence detection on the amplified product and directly interpreting the abundance of the bacterial species of the sample to be tested based on the fluorescence curve;

[0026] The PCR amplification reaction solution includes one or more of Taq enzyme, buffer, dNTP, UDG enzyme and sterile water; the bacterial species include one or more of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis.

[0027] In some specific embodiments, the PCR amplification reaction solution includes Probe qPCR Mix reagent.

[0028] In some specific embodiments, the sample to be tested is gastrointestinal contents.

[0029] In some specific embodiments, the gastrointestinal contents are selected from feces or the contents of the duodenum, jejunum, ileum, and cecum.

[0030] In some specific embodiments, the conditions for performing the PCR amplification reaction in step a) are:

[0031] Incubate at 50°C for 2 min; pre-denaturate at 95°C for 2 min; denature at 95°C for 10 s, anneal at 60-65°C for 60 s, and cycle 45 times.

[0032] The present invention also provides a sequence amplification method, which comprises using the combination of primers and probes or the kit, and comprises the following steps:

[0033] The combination of primers and probes is added to the sample to be tested, and a PCR amplification reaction solution is added, and the sample is placed in a PCR instrument for PCR amplification reaction.

[0034] In some specific embodiments, the conditions of the PCR amplification reaction are:

[0035] Incubate at 50°C for 2 min; pre-denaturate at 95°C for 2 min; denature at 95°C for 10 s, anneal at 60-65°C for 60 s, and cycle 45 times.

[0036] The present invention also provides a primer or probe for bacterial species detection, wherein the primer or probe comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-12.

[0037] In some specific embodiments, the primers or probes comprise primers as shown in any one of SEQ ID NOs: 1-2, 4-5, 7-8 and 11-12 and probes as shown in SEQ ID NOs: 3, 6, 9 and 12.

[0038] In some specific embodiments, the 3' end of the probe further comprises a 3'BHQ2 or 3'BHQ1 probe.

[0039] In some specific embodiments, the probe comprises a fluorescent label, which is located at the 5' end of the probe and is selected from any one of VIC, CY5, FAM, ROX and HEX.

[0040] The present invention also provides a primer comprising a nucleotide sequence as shown in any one of SEQ ID NOs: 1-2, 4-5, 7-8 and 11-12.

[0041] The present invention also provides a probe, which comprises the nucleotide sequences shown in SEQ ID NOs: 3, 6, 9 and 12.

[0042] In some specific embodiments, the 3' end of the probe further comprises a 3'BHQ2 or 3'BHQ1 probe.

[0043] In some specific embodiments, the probe comprises a fluorescent label, which is located at the 5' end of the probe and is selected from any one of VIC, CY5, FAM, ROX and HEX.

[0044] The present invention also provides a nucleic acid complex, which includes the combination of the primer probe or the primer or probe, and a sequence from one or more bacterial genomes of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis.

[0045] The present invention also provides the use of the combination of primers and probes or the kit in detecting the abundance of bacterial species, wherein the bacterial species include one or more of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis.

[0046] In some specific embodiments, the bacterial species is a gastrointestinal bacterium.

[0047] On the basis of being in accordance with the common sense in the art, the above-mentioned preferred conditions can be arbitrarily combined to obtain the preferred embodiments of the present invention.

[0048] The reagents and raw materials used in the present invention are commercially available.

[0049] The positive and progressive effects of the present invention are:

[0050] A real-time fluorescence quantitative PCR detection method based on TaqMan probes for multiple bacterial species has been developed, which significantly improves the specificity, sensitivity and anti-interference ability of the detection: Detection specificity: Through bioinformatics comparison, a highly specific target gene region was designed, and the primers and probes can accurately distinguish Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis from other bacterial species. Detection sensitivity: The lower limit of detection can reach 20 copies / reaction. Detection repeatability: It shows good stability in different background solutions (such as TE buffer and DNA background) and annealing temperatures. Detection accuracy: The accurate measurement of baseline bacterial species abundance provides an important basis for screening suitable probiotic supplementation populations.

[0051] By introducing dedicated specific primers and probe design strategies and determining specific target gene regions through bioinformatics comparison, the problems of high false positive rate, low sensitivity and difficulty in meeting clinical needs of existing SYBR Green dye detection methods are solved. This method can achieve convenient, rapid and highly specific detection of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis, which is suitable for clinical diagnosis and scientific research applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 This is the amplification curve of Akkermansia_muciniphila detected by qPCR method (TE dissolution at 60℃).

[0053] Figure 2 This is the amplification curve of Akkermansia_muciniphila detected by qPCR method (60℃DNA background).

[0054] Figure 3 This is the corresponding standard curve for the qPCR detection of Akkermansia muciniphila (dissolved in 60℃TE).

[0055] Figure 4 This is the standard curve corresponding to the qPCR detection of Akkermansia_muciniphila (60℃ DNA background).

[0056] Figure 5 This is the corresponding standard curve for the qPCR detection of Akkermansia muciniphila (dissolved in 62℃TE).

[0057] Figure 6 This is the corresponding standard curve for the qPCR detection of Akkermansia muciniphila (62°C DNA background).

[0058] Figure 7 This is the corresponding standard curve for the qPCR detection of Akkermansia muciniphila (65℃TE dissolution).

[0059] Figure 8 This is the standard curve corresponding to the qPCR detection of Akkermansia muciniphila (65℃ DNA background).

[0060] Fig. 9 This is the amplification curve of the qPCR interference test of Akkermansia muciniphila (60℃TE dissolution).

[0061] Fig.10 This is the standard curve for the interference test of the qPCR method for Akkermansia muciniphila (dissolved in 60℃TE).

[0062] Fig.11 This is the standard curve corresponding to the quadruple qPCR detection of Akkermansia muciniphila (dissolved in 60℃TE).

[0063] Fig.12 This is the standard curve corresponding to the quadruple qPCR detection method for Akkermansia_muciniphila (60℃ DNA background).

[0064] Fig.13 This is the standard curve corresponding to the quadruple qPCR detection of Bacteroides_thetaiotaomicron (dissolved in 60℃TE).

[0065] Fig.14 This is the standard curve corresponding to the quadruple qPCR detection of Bacteroides_thetaiotaomicron (60℃ DNA background).

[0066] Fig.15 This is the standard curve corresponding to the quadruple qPCR detection of Dorea_longicatena bacteria (dissolved in 60℃TE).

[0067] Fig.16 This is the standard curve corresponding to the quadruple qPCR detection method of Dorea_longicatena bacteria (60℃DNA background).

[0068] Fig.17 This is the standard curve corresponding to the quadruplex qPCR detection of Megamonas_rupellensis (dissolved in 60℃TE).

[0069] Fig.18 This is the standard curve corresponding to the quadruplex qPCR detection of Megamonas_rupellensis (60℃ DNA background).

[0070] Fig.19 is the amplification efficiency of different strains of the target bacterial species. DETAILED DESCRIPTION

[0071] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples without specifying specific conditions are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0072] Example 1

[0073] 1. Design specific real-time PCR primers for Akkermansia_muciniphila. First, use a self-written program to perform bioinformatics analysis on the genomes of 1655 bacterial species in the NCBI database to find the specific gene sequence of this species (compared with the NCBI database, the NCBI Nucleotide Sequence Database and other bacterial species in the Representative genomes database do not have this sequence).

[0074] Use oligo7 software to design primers and probes. Under the premise of meeting the design principles of primers and probes, ensure that the amplified fragment is within 200bp. After a series of screening and verification, the optimal primers and probes are determined, as shown in the table below. Here, a pair of optimal primers and probes targeting Akkermansia muciniphila are screened out.

[0075] 2. Design specific real-time PCR primers for Bacteroides_thetaiotaomicron. First, use a self-compiled program to perform bioinformatics analysis on the genomes of 1,170 bacterial species in the NCBI database to find the specific gene sequence of this species (compared with the NCBI database, other bacterial species in the NCBI nt library and representative genomes database do not have this sequence).

[0076] The oligo7 software was used to design primers and probes. Under the premise of meeting the design principles of primers and probes, the amplified fragment was ensured to be within 200 bp. After a series of screening and verification, the optimal primers and probes were determined, as shown in the table below. Here, a pair of optimal primers and probes targeting Bacteroides_thetaiotaomicron were screened out.

[0077] 3. Design specific real-time PCR primers for Dorea_longicatena. First, use the microbase self-compiled program to perform bioinformatics analysis on the genomes of 170 bacterial species in the NCBI database to find the specific gene sequence of this bacterial species (compared with the NCBI database, other bacterial species in the NCBI nt library and representative genomes database do not have this sequence).

[0078] Oligo7 software was used to design primers and probes. On the premise of meeting the design principles of primers and probes, the amplified fragment was ensured to be within 200 bp. After a series of screening and verification, the optimal primers and probes were determined, as shown in the table below. Here, a pair of optimal primers and probes targeting Dorea_longicatena bacteria were screened out.

[0079] 4. To design specific real-time PCR primers for Megamonas_rupellensis, we first used a self-compiled program in Microbase to perform bioinformatics analysis on the genomes of six bacterial species in the NCBI database to find the specific gene sequence of this bacterial species (compared with the NCBI database, other bacterial species in the NCBI nt library and representative genomes database did not have this sequence).

[0080] The oligo7 software was used to design primers and probes. Under the premise of meeting the design principles of primers and probes, the amplified fragment was ensured to be within 200 bp. After a series of screening and verification, the optimal primers and probes were determined, as shown in the table below. Here, a pair of optimal primers and probes targeting Megamonas_rupellensis were screened out.

[0081] Table 1 Sequence list of specific qPCR detection primers and corresponding Taqman probes

[0082]

[0083]

[0084] Example 2

[0085] The Taqman qPCR detection method based on the primers and probes described in Example 1 has the following specific steps:

[0086] (1) Construct Akkermansia_muciniphila standard plasmid. Test the peak and amplification efficiency of the standard plasmid under different backgrounds (through TE buffer dilution and DNA background solution dilution) and different annealing temperatures. qPCR reaction was performed in a dedicated PCR eight-tube tube (Axygen, USA) with a 20 μL system. The standard plasmid was repeated once and used ProbeqPCR Mix (UDG) reagent was used for quantification. The primers and TaqMan probes used were synthesized by Micro-Biotech (Shanghai) Co., Ltd., and all sequence determination work was completed by Micro-Biotech (Shanghai) Co., Ltd.

[0087] (2) qPCR primers and their corresponding probes were used for detection. The standard plasmid (1) was used as a template, and the primers and probes described in Example 1 were used for qPCR amplification, and the fluorescence signal was collected.

[0088] The qPCR reaction system is 10 μL 2×qPCR Mix ( Probe qPCR Mix (UDG) reagent), 0.5 μL each of F1, R1 and UP1 with an initial concentration of 10 μmol / L, 2 μL template, and then dd water was used to make up the total volume to 20 μL.

[0089] (3) The reaction procedure of the qPCR amplification was: 50°C for 2 min, 95°C for 2 min, 95°C for 10 s, 60°C for 60 s, and 45 cycles. Fluorescence data collection was performed during annealing and extension. Real-time quantitative PCR was performed in a Biori FQD-96A fluorescence quantitative PCR instrument. The fluorescence channel of the qPCR instrument was set to CY5.

[0090] (4) Read the test results and amplification curve.

[0091] Example 3

[0092] The construction and verification of the detection method described in Example 1 and Example 2, the specific experimental process is as follows:

[0093] First, a standard plasmid was used as a positive control template, and DEPC water was set as a blank control. About 10 ng of DNA was added to each reaction system as a DNA background. The designed primer probe was used to perform a single-plex qPCR reaction to demonstrate the specificity of the designed primer-probe set. Figure 5-12 As shown, different annealing gradient tests were selected, including 60℃, 62℃ and 65℃; mixed quantitative tests were performed under TE background and DNA background to observe whether the sample peak and amplification efficiency were normal. Single-factor optimization experiments were performed, and the cycle threshold (Ct) and fluorescence signal value of the amplification curve were comprehensively considered to determine the final TaqMan qPCR reaction system for Akkermansia_muciniphila.

[0094] When testing different annealing gradients, the amplification effects of Akkermansia_muciniphila bacteria were similar under the three annealing temperatures. In general, 60°C can be used for subsequent experiments. When tested under TE background and DNA background, the sample peak and amplification efficiency were normal, and the peak was relatively consistent.

[0095] Sensitivity test:

[0096] Preparation of plasmid The Akkermansia_muciniphila bacteria-specific sequence was submitted to the company for full gene synthesis. After obtaining the plasmid standard, sterile nuclease-free water was added for dilution to obtain a plasmid concentration of 10.9ng / μl. The calculated plasmid copy number was 3.86×108 copies / μl. The plasmid standard was diluted in a 10-fold gradient, with a total of 6 dilution gradients. After mixing evenly, it was placed at -20°C for standby use. In the sensitivity test, 2 parallel wells were set for each DNA concentration gradient for qPCR amplification. The results showed that there was an obvious amplification curve for dilutions of 20 copies / μl and less, and the amplification curve had a good linear relationship. The sensitivity can reach 20 copies / μl. There is a linear correlation between the samples with dilutions of 20 to 2000000, and the correlation coefficient R 2The test results are shown in Table 2 and Figure 5-12 .

[0097] Table 2 Optimization of annealing temperature for Akkermansia_muciniphilajun

[0098]

[0099] Interference test:

[0100] like Fig.13 As shown, the quantitative results of the interference test showed that in addition to the addition of AM plasmid, when the primer probes of three different bacteria were added to quantify the AM plasmid, the peak and amplification efficiency were normal, and no other signal peaks except the target signal.

[0101] Example 4

[0102] A mixed test of four bacteria was performed based on the Taqman qPCR detection method of primers and probes described in Example 1, and the specific steps were as follows:

[0103] (1) Construct standard plasmids of Akkermansia_muciniphila, Bacteroides_thetaiotaomicron, Dorea_longicatena, and Megamonas_rupellensis. Test the peaks and amplification efficiency of the four standard plasmids under different backgrounds (through TE buffer dilution and DNA background solution dilution) and different annealing temperatures. qPCR reactions were performed in a dedicated PCR eight-tube tube (Axygen, USA) with a 20 μL system. The standard plasmids were replicated once and used Probe qPCR Mix (UDG) reagent was used for quantification. The primers and TaqMan probes used were synthesized by Micro-Biotech (Shanghai) Co., Ltd., and all sequence determination work was completed by Micro-Biotech (Shanghai) Co., Ltd.

[0104] (2) qPCR primers and their corresponding probes were used for detection. The standard plasmid in (1) was used as a template, and the primers and probes described in Example 1 were used for qPCR amplification, and the fluorescence signal was collected.

[0105] The qPCR reaction system is 10 μL 2×qPCR Mix ( Probe qPCR Mix (UDG) reagent), 0.5 μL each of F1 and R1 and UP1 or LP1 with an initial concentration of 10 μmol / L, 2 μL template, and then use dd water to make up the total volume to 20 μL.

[0106] (3) The reaction procedure of the qPCR amplification was: 50°C for 2 min, 95°C for 2 min, 95°C for 10 s, 60°C for 60 s, and 45 cycles. Fluorescence data collection was performed during annealing and extension. Real-time quantitative PCR was performed in a Biori FQD-96A fluorescence quantitative PCR instrument. The fluorescence channels of the qPCR instrument were set to CY5, HEX, ROX, and FAM.

[0107] (4) Read the test results and amplification curves, and test the standard curves of each bacterium separately.

[0108] Example 5

[0109] The Taqman qPCR detection method of the primers and probes in Example 4 was tested for the amplification efficiency of different strains of the target bacterial species. Two strains of Akkermansia muciniphila BAA-835 (ATCC BAA-835) and Akkermansia muciniphila SSYD-3 (CGMCC 14764) and two strains of Bacteroides thetaiotaomicron: Bacteroides_thetaiotaomicron VPI-5482 (ATCC 29148D-5) and Bacteroides thetaiotaomicron SHRJ-M271 (sequences are shown below), respectively recorded as AM-1, AM-2, BT-1, and BT-2. Read the test results, see Fig.19 .

[0110] Example 6

[0111] The Taqman qPCR detection method based on the primers and probes described in Example 1 was used to detect the abundance of Akkermansia muciniphila in human fecal samples. The specific steps are as follows:

[0112] (1) Extract human fecal DNA (QIAamp PowerFecal pro DNA kit, Qiagen).

[0113] (2) qPCR primers and their corresponding probes were used for detection. The standard plasmid (1) was used as a template, and the primers and probes described in Example 1 were used for qPCR amplification, and the fluorescence signal was collected.

[0114] The qPCR reaction system is 10 μL 2×qPCR Mix ( Probe qPCR Mix (UDG) reagent), 0.5 μL each of F1, R1 and UP1 with an initial concentration of 10 μmol / L, 2 μL template, and then dd water was used to make up the total volume to 20 μL.

[0115] (3) The reaction procedure of the qPCR amplification was: 50°C for 2 min, 95°C for 2 min, 95°C for 10 s, 60°C for 60 s, and 45 cycles. Fluorescence data collection was performed during annealing and extension. Real-time quantitative PCR was performed in a Biori FQD-96A fluorescence quantitative PCR instrument. The fluorescence channel of the qPCR instrument was set to CY5.

[0116] (4) Read the test results. The feces of 8 subjects were tested, and the results were 7364786.70, 574896.04, 99.72, 29.80, 1140267.18, 160.18, 32.85, and 54043.59, respectively. The unit is Akkermansia_muciniphilang / g fecal DNA.

[0117] Standard plasmid sequence:

[0118] Akkermansia_muciniphila standard plasmid sequence:

[0119] ATGAAGACCCACGTGAAAAAAGGTGATGAAGTGGAAATCATCGCCGGACGTAACC

[0120] ACAAGGGCAAGCGCGGCACCGTTCTCGCCGTGAATGCTTCCAAAGGTACTGTCATC

[0121] GTAGAAGGCGCCCGCACCCTGAAAAAGGCTGTGCGCCCGACCGAACAGAACCCGG

[0122] AAGGCGGCATTCAGGAAATCAACGGCCCGATTCACATCTCCAACGTGAAAAAAGTAGGCTAG(SEQ IDNO:13)

[0123] Bacteroides_thetaiotaomicron standard plasmid sequence:

[0124] ATGACCCCACAAGAGTTTTTTTAAAAAGGACCTGTTCGCCGAAAATGCAGGCGTAGTATTGCTTGAAGTACGTGAAGGATACAGCAAAGCCAAACTGGAAATAAAACCCGAACATCTCAATGCCGGAGCACGGACACAAGGAGGAGCGATTTTCACGCTGGCAGACCTGGCACTCGCCGCAGCCGCCAATTCTCACGGGACACTCGCTTTCTCTCTTTCATCCTCAATCACTTTTCTGCGCGCCAGCGGTCCGGGCGACACCCTTTATGCCGAGGCACGCGAACGGTATATCGGTCGAAGCACCGGCTGCTATCAAGTAGATGTTACTAACCAGAACGGAGACTTGATCGCTACATTCGAATCAAGTGTTTTCCGGAAAGATCAGAAAGTTCCTTTTACTCTGTAG(SEQ ID NO:14)

[0125] Standard plasmid sequence of Dorea_longicatena:

[0126] ATGCAGGCATTGTCAAAGGCGGCGGCTGGAAAAAGCTACACCATCAAGTGGATGTTCGGCATCCCGGAAGTTCTGGATAAGATCCGAAAATGCAAGATTGATGAAGGCAGTGAGATCACAGTCATTCAGAATTCCGGAAGAGACCTGATCATCAGGAGTGGTGAGAAGCGGATCGCAATGAGCAGCGATGCGGCAACAAGAATTCAGGTATAA(SEQ IDNO:15)

[0127] Standard plasmid sequence of Megamonas_rupellensis:

[0128]

[0129] Bacteroides thetaiotaomicron SHRJ-M271 16s sequence:

[0130]

[0131] Although the specific embodiments of the present invention are described above, it should be understood by those skilled in the art that these are only examples, and various changes or modifications may be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the protection scope of the present invention is limited by the appended claims.

Claims

1. A combination of primers and probes, characterized in that: The combination of primers and probes includes one or more of the following: (1) an upstream primer as shown in SEQ ID NO: 1, a downstream primer as shown in SEQ ID NO: 2, and a probe as shown in SEQ ID NO: 3; (2) an upstream primer as shown in SEQ ID NO:4, an upstream primer as shown in SEQ ID NO:5, and a probe as shown in SEQ ID NO:6; (3) an upstream primer as shown in SEQ ID NO:7, an upstream primer as shown in SEQ ID NO:8, and a probe as shown in SEQ ID NO:9; (4) an upstream primer as shown in SEQ ID NO: 10, an upstream primer as shown in SEQ ID NO: 11, and a probe as shown in SEQ ID NO:

12.

2. The combination of primers and probes according to claim 1, characterized in that: The 3' end of the probe further comprises a 3'BHQ2 or 3'BHQ1 probe; And / or, the probe comprises a fluorescent marker, the fluorescent marker is located at the 5' end of the probe and is selected from any one of VIC, CY5, FAM, ROX and HEX.

3. A kit, characterized in that: The kit comprises the combination of primers and probes as described in claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit also includes a PCR amplification reaction solution; the PCR amplification reaction solution includes one or more of Taq enzyme, buffer, dNTP, UDG enzyme and sterile water; Preferably, the kit further comprises a reference positive control solution and / or a negative control solution; and / or the PCR amplification reaction solution comprises Probe qPCR Mix reagent.

5. A method for detecting bacterial species abundance, characterized in that: The method comprises using the combination of primers and probes as claimed in claim 1 or 2 or the kit as claimed in claim 3 or 4, comprising the following steps: a) adding the primer-probe combination to the sample to be tested, and adding PCR amplification reaction solution, and placing the sample in a fluorescent quantitative PCR instrument for PCR amplification reaction; b) Performing fluorescence detection on the amplified product and directly interpreting the abundance of the bacterial species of the sample to be tested based on the fluorescence curve; The PCR amplification reaction solution includes one or more of Taq enzyme, buffer, dNTP, UDG enzyme and sterile water; the bacterial species include one or more of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis; Preferably, the PCR amplification reaction solution comprises Probe qPCR Mix reagent.

6. The method according to claim 5, characterized in that The sample to be tested is gastrointestinal contents; Preferably, the gastrointestinal contents are selected from feces or the contents of the duodenum, jejunum, ileum, and cecum.

7. The method according to claim 5 or 6, characterized in that The conditions for performing the PCR amplification reaction in step a) are: Incubate at 50°C for 2 min; pre-denaturate at 95°C for 2 min; denature at 95°C for 10 s, anneal at 60-65°C for 60 s, and cycle 45 times.

8. A primer or probe for bacterial species detection, characterized in that: The primer or probe comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 1-12.

9. Use of the combination of primers and probes according to any one of claims 1 to 3 or the kit according to claim 4 or 5 in detecting bacterial species abundance, wherein: The bacterial species include one or more of Akkermansia muciniphila, Bacteroides thetaiotaomicron, Dorea longicatena and Megamonas rupellensis.

10. The use according to claim 9, characterized in that The bacterial species is gastrointestinal bacteria.

Images