Primer probe combination and method for detecting brucella based on nested MIRA and application of primer probe combination and method

Abstract

The invention discloses a primer probe combination and method for detecting Brucella based on nested MIRA and application of the primer probe combination and method, and belongs to the technical field of Brucella detection. Compared with SAT and RBPT serological detection methods, the Brucella detection method provided by the invention has the advantages of high specificity and no cross reaction; compared with blood culture and qPCR technologies, the kit has the advantages of short detection time and convenience in operation, and nested MIRA amplification and detection can be completed within 30 minutes; the detection performance is greatly improved, and compared with common MIRA, the detection lower limit is improved by 10 times and can reach 1.73 copies / mu L; the kit is based on the nested MIRA technology, meets the requirements of POCT (Point-of-Card Testing, namely, rapidness, sensitivity, specificity, low equipment requirement and economy and practicability), can overcome the limitation of equipment dependence, is an ideal tool for field screening of Brucella of livestock (cattle and sheep) and crowds in an epidemic area, and provides a powerful diagnostic tool for early screening and early diagnosis of Brucella and prevention and treatment of inter-livestock propagation and inter-livestock propagation.

Description

Technical Field

[0001] The present invention relates to the technical field of Brucella detection, and in particular to a primer-probe combination, method and application thereof for detecting Brucella based on nested MIRA. Background Art

[0002] Brucellosis (abbreviated as brucellosis) is a zoonosis caused by the Gram-negative bacteria Brucella, which mainly damages the reproductive system and joints, causing significant economic losses in the livestock industry and serious health problems for humans. In China, the disease is mainly transmitted through cattle, sheep, and pigs. Among them, Brucella melitensis is the most contagious to humans and has the highest morbidity rate.

[0003] Brucella evades the human immune system through complex mechanisms: after entering the human body through skin wounds or mucous membranes, Brucella is first phagocytosed by immune cells. However, as an intracellular parasite, Brucella can survive and reproduce in phagocytes, effectively avoiding the attack of humoral immunity and other antimicrobial factors. This intracellular proliferation eventually leads to phagocyte lysis, releasing Brucella into the lymphatic and blood circulation, causing bacteremia. Subsequently, the bacteria establish multiple infection foci in organs such as the liver, spleen, and bone marrow. As the infection worsens, Brucella can reproduce extracellularly in the bloodstream, leading to sepsis and intermittent fever. The lysis of Brucella also releases endotoxins, further exacerbating tissue damage and disease progression. If the immune system is impaired or the infection is severe, Brucella can evade immune clearance, leading to chronic infection and repeated attacks, accompanied by a variety of clinical manifestations, posing a major threat to animal husbandry and human health.

[0004] At present, the diagnostic methods for brucellosis mainly include serological testing, microbial culture and molecular testing. Serological tests, such as the tiger red plate agglutination test (SAT), enzyme-linked immunosorbent assay (ELISA) and rose bengal test (RBPT), are prone to cross-reactions and false positives. Although microbial culture is considered the gold standard, it is time-consuming, labor-intensive, has the risk of infection for laboratory personnel, has low sensitivity, and the interpretation of results is subjective.

[0005] Molecular detection methods, including quantitative PCR (qPCR), digital PCR (dPCR) and isothermal amplification techniques, such as RPA and LAMP, can detect Brucella DNA quickly, sensitively and specifically. At present, some Brucella detection methods based on PCR and isothermal amplification techniques have been reported. For example, patent CN 117867145 A discloses a qPCR-based detection method, and patent CN 108220461 A describes an RPA method for Brucella ovis. However, these methods still have some limitations, such as qPCR requires expensive instruments and professional personnel to operate, and conventional isothermal amplification methods have relatively low sensitivity.

[0006] Multienzyme Isothermal Rapid Amplification (MIRA) is a new isothermal amplification technology that uses a RecA recombinase (SC recA) from Streptomyces coelicolor. Unlike RPA (T4 UvsX) and RAA (Escherichia coli UvsX), MIRA has higher stability and inhibitor resistance. MIRA can be performed at a constant temperature of 37-42°C, and the results can be interpreted by agarose gel electrophoresis, real-time fluorescence or lateral flow chromatography strips.

[0007] Although MIRA technology has the advantages of simplicity, rapidity and high specificity, making it very suitable for on-site detection, there are no reports on its application in Brucella detection. In addition, according to literature reports, the sensitivity of MIRA is usually lower than that of qPCR, which limits its application in low-concentration samples. Summary of the invention

[0008] The purpose of the present invention is to provide a primer-probe combination, method and application for detecting Brucella based on nested MIRA, so as to solve the problems that the current detection of Brucella is prone to cross-reaction and false positive, is time-consuming, labor-intensive, has infection risks, is highly subjective, has low sensitivity, and has high requirements on the professionalism of instruments and personnel.

[0009] To achieve the above objectives, the present invention provides a primer-probe combination for detecting Brucella based on nested MIRA, wherein the primer-probe combination comprises: an inner upstream primer Bru-1IF, an inner downstream primer Bru-3IR, an outer upstream primer Bru-2OF, an outer downstream primer Bru-2OR and a probe.

[0010] Preferably, the sequence of the inner upstream primer Bru-1IF is shown as SEQ ID NO.1, the sequence of the inner downstream primer Bru-3IR is shown as SEQ ID NO.6, the sequence of the outer upstream primer Bru-2OF is shown as SEQ ID NO.8, and the sequence of the outer downstream primer Bru-2OR is shown as SEQ ID NO.11.

[0011] Preferably, the probe sequence is labeled with a FAM fluorescent reporter group at the 29th base T from the 5′ end, the 31st base T is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ-1 fluorescent quencher group, and the 3′ end is modified with a C3spacer blocking, and the sequence is shown in SEQ ID NO.13.

[0012] A method for detecting Brucella based on nested MIRA, using the above-mentioned primer-probe combination for detecting Brucella based on nested MIRA, with the extracted DNA of the sample to be tested as a template, a one-step reaction system is configured, after mixing, the mixture is reacted at a constant temperature of 38-42°C for 10 minutes, and a two-step reaction system is configured with the reaction product as a template, after mixing, the mixture is reacted at a constant temperature of 38-42°C for 20 minutes, and a fluorescent signal can be collected, which is positive.

[0013] Preferably, the one-step reaction system includes the following components: 29.4 μL of buffer A, 2 μL of peripheral upstream primer, 2 μL of peripheral downstream primer, 9.1 μL of ddH2O, 5 μL of template, 2.5 μL of buffer B, and MIRA reaction enzyme; the concentration of the primers is 10 μM, and buffer A, buffer B and MIRA reaction enzyme are all taken from DNA constant temperature rapid amplification kit-fluorescence type.

[0014] Preferably, the two-step reaction system includes the following components: 29.4 μL of buffer A, 2 μL of inner upstream primer, 2 μL of inner downstream primer, 0.6 μL of probe, 8.5 μL of ddH2O, 5 μL of template, and 2.5 μL of buffer B; the concentrations of the probe and primers are both 10 μM, and buffer A and buffer B are both taken from a DNA isothermal rapid amplification kit - fluorescent type; the template is a one-step reaction product.

[0015] A Brucella detection kit comprises the above-mentioned primer-probe combination for detecting Brucella based on nested MIRA.

[0016] An application of the primer-probe combination for detecting Brucella based on nested MIRA as described above in Brucella detection, wherein the application is not for the purpose of disease diagnosis and treatment.

[0017] An application of the above-mentioned method for rapid detection of Brucella by isothermal amplification in Brucella detection, wherein the application is not for the purpose of diagnosis and treatment of the disease.

[0018] The present invention creatively developed a new nested MIRA (nestMIRA) detection method for rapid and highly sensitive detection of Brucella. The nestMIRA technology not only retains the original advantages of MIRA, which is easy to operate and does not require complex equipment, but also significantly improves the detection sensitivity through the nested amplification strategy, making it comparable to or even surpassing qPCR. More importantly, the entire reaction process of nestMIRA can be completed on a portable constant temperature device, and the test results can be read by naked eye observation or simple equipment, making it an ideal tool for on-site screening of Brucella in livestock (cattle and sheep) and people in epidemic areas. This innovation will greatly promote the rapid diagnosis and timely management of brucellosis, and provide strong support for improving animal and human health.

[0019] Therefore, the present invention provides a primer-probe combination, method and application for detecting Brucella based on nested MIRA, and its specific technical effects are as follows: (1) Compared with SAT and RBPT serological detection methods, the Brucella detection method provided by the present invention has the advantages of strong specificity and no cross-reaction; compared with blood culture and qPCR technology, it has the advantages of short detection time and convenient operation, and can complete nested MIRA amplification and detection within 30 minutes; (2) The Brucella detection method provided by the present invention has greatly improved detection performance. Compared with ordinary MIRA, the detection limit is increased by 10 times to 1.73 copies / μL; (3) High social value. The present invention is based on the Nest MIRA technology and meets the requirements of POCT (Point-of Care Testing, i.e., rapid, sensitive, specific, low equipment requirements and economical). It can overcome the limitation of equipment dependence and is an ideal tool for on-site screening of Brucella in livestock (cattle and sheep) and humans in epidemic areas. It provides a powerful diagnostic tool for early screening, early diagnosis and prevention of Brucella transmission between animals and between humans. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for use in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative labor.

[0021] Figure 1 The figure is a schematic diagram of the process of detecting Brucella by using nested MIRA in Example 3 of the present invention; Figure 2 The results of the inner primer screening in Example 3 of the present invention are as follows; Figure 3The peripheral primer screening results in Example 3 of the present invention are shown; Figure 4 The optimized result of the reaction temperature in Example 3 of the present invention; Figure 5 The specific experimental results in Example 4 of the present invention; Figure 6 The sensitivity test results of the optimal Brucella sutchi MIRA detection method in Example 5 of the present invention are as follows; Figure 7 The results of the common MIRA sensitivity experiment in Example 5 of the present invention; Figure 8 This is the result of testing real samples using the optimal Brucella spp. MIRA detection method in Example 6 of the present invention. DETAILED DESCRIPTION

[0022] The technical solution of the present invention is further described below through the accompanying drawings and embodiments.

[0023] In order to make the purpose, technical scheme and advantages of the present application clearer, more thorough and more complete, the technical scheme of the present invention is clearly and completely described below through the accompanying drawings and examples. The following detailed descriptions are all descriptions of the embodiments, and are intended to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the present application belongs.

[0024] The instruments, equipment, reagents and materials used in the examples were all obtained through commercial channels; the experimental steps and methods not described in detail in the examples are conventional methods in the art; the positive detection in the examples can be performed using a portable fluorescence reader, but for the accuracy of the experimental results, all data in the examples are collected by the fluorescence quantitative PCR instrument in the examples.

[0025] Embodiment 1 Design primer probes. The specific steps are as follows: The full-length reference sequence of the Brucella-specific conserved gene Bcsp31 (GenBank: LC743842.1) was downloaded from the NCBI data website. According to the design principle of MIRA multi-enzyme isothermal amplification primers and probes, primers and probes for Brucella nestinus MIRA detection were designed. The probe sequence is that the 29th base T from the 5′ end is labeled with a FAM fluorescent reporter group, the 31st base T is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ-1 fluorescent quencher group, and the 3′ end is modified with C3spacer blocking. The primer and probe sequence information is shown in Table 1.

[0026] Table 1 ;

[0027] Embodiment 2 Prepare the positive control, the specific steps are as follows: S21. Insert the amplicon sequence of the Brucella bcsp31 gene synthesized by the company (as shown in SEQ ID NO.14, with a length of 439 bp) between the KpnI and BmHI restriction sites of the vector pUC57, and select the recombinant plasmid with correct sequencing as the Brucella positive control plasmid.

[0028] SEQ ID NO.14: TCTTGAAGCTACGGCCTCACGGAAGACGATATCAAGGCTGAACACCTGAAGCCGGGACCGGCAGGCGAGAGGCTGAAAGATGGTGCGCTGGACGCCTATTTCTTTGTGGGCGGCTATCCGAC GGGCGCAATCTCGGAACTGGCCATCTCGAACGGTATTTCGCTCGTTCCGATCTCCGGGCCGGAAGCGGACAAGATTCTGGAGAAATATTCCTTCTTCTCGAAGGATGTGGTTCCTGCCGGAGC CTATAAGGACGTGGCGGAAACACCGACCCTTGCCGTTGCCGCACAGTGGGTGACGAGCGCCAAGCAGCCGGACGACCTCCATCTATAACATCACCAAGGTCTCTGGAACGAGGATACACGCAAGGCACTCGATGCGGGCCATGCGAAGGGCAAGCTCATCAAGCTCGATAGTGCGACGAGCAGCCTCGGTATTCCGCTGCATCCCGGCGCAGAACGCTTTTACAAGGAAGCGGGCGTGCTGAAATAA S22, using an ultraviolet spectrophotometer to measure the concentration of the Brucella positive control plasmid obtained in step S21, using the following formula to calculate the copy number, and then the positive plasmid was diluted in a 10-fold dilution method to obtain a total of 7 concentrations of Brucella positive control plasmids, which were: 1.73×10 5 , 1.73×10 4 , 1.73×10 3 , 1.73×10 2 , 1.73×10 1 , 1.73, 0.173 copies / μL. The copy number calculation formula is: .

[0029] Embodiment 3 The optimal Brucella nidulans MIRA detection method was established and the DNA isothermal rapid amplification kit-fluorescence type was used for the test. The specific steps are as follows: S31. Ordinary MIRA reaction. The MIRA reaction system was configured according to Table 2.

[0030] Table 2 ;

[0031] Add 5 μL of the template to be tested to the reaction system, and finally add 2.5 μL of buffer B to the tube cap, then shake the sample up and down to mix it, and the reaction will start immediately. Place the above reaction system in a fluorescent quantitative PCR instrument, and the program is to react at 38°C for 20 minutes, and collect the fluorescent signal every 30 seconds.

[0032] S32, Nest's MIRA reaction, including one-step reaction and two-step reaction, the flow chart is as follows Figure 1 The components of the one-step reaction system are shown in Table 3.

[0033] Table 3 ;

[0034] Mix components 1-4 and add them to the freeze-dried enzyme powder, mix well, add the template to be amplified (5μL), add buffer B (2.5μL) to the tube cap, centrifuge, mix well by inverting, and maintain a constant temperature of 38℃ for 10 minutes.

[0035] A two-step reaction system was configured according to Table 4, wherein the template in 6 was the amplification product of the one-step reaction. The configured reaction system was centrifuged, mixed by inversion, and placed in a fluorescence quantitative PCR instrument. The program was constant temperature reaction at 38°C for 20 minutes, and the fluorescence signal was collected every 30 seconds.

[0036] Table 4 ;

[0037] S33, screening the optimal inner primers. The three pairs of inner upstream primers (Bru-1IF, Bru-2IF, Bru-3IF) in Example 1 were combined in pairs with the three pairs of inner downstream primers (Bru-1IR, Bru-2IR, Bru-3IR) to obtain a total of 9 primer combinations. The positive control plasmid constructed in Example 2 (concentration of 1.73×10 5 ) as a template, and perform MIRA amplification reaction according to the common MIRA reaction experimental method shown in step S31. The result is as follows Figure 2As shown, the primer combination of upstream primer Bru-1IF and downstream primer Bru-3IR has a higher fluorescence curve intensity and reaches the amplification threshold faster than the other 8 combinations. Therefore, the primer combination of upstream primer Bru-1IF and downstream primer Bru-3IR is the optimal inner primer combination.

[0038] S34, screening the optimal peripheral primers. The three pairs of peripheral upstream primers (Bru-1OF, Bru-2OF, Bru-3OF) designed in Example 1 were combined with three pairs of peripheral downstream primers (Bru-1OR, Bru-2OR, Bru-3OR) to obtain a total of 9 primer combinations. The optimal inner primer combination (Bru-1IF+Bru-3IR) obtained in step S33 was used as the inner primer, and the positive control plasmid (concentration of 1.73×10 5 ) as a template, and perform the nested MIRA amplification reaction according to the nested MIRA reaction experimental method shown in step S32. The result is as follows Figure 3 As shown, compared with the other 8 combinations, the fluorescence curve intensity of the primer combination of Bru-2OF+Bru-2OR is higher and reaches the amplification threshold faster. Therefore, the primer combination of Bru-2OF+Bru-2OR is the optimal peripheral primer combination.

[0039] S35, optimize the reaction temperature. Set the positive control plasmid constructed in Example 2 (concentration of 1.73×10 5 ) was used as a template, and the nested MIRA amplification reaction was performed according to the nested MIRA reaction experimental method shown in step S32 at 5 reaction temperature gradients (38°C, 39°C, 40°C, 41°C, and 42°C). The results are shown in FIG. Figure 4 As shown, the fluorescence curve intensity was higher and the amplification threshold was reached faster when the reaction was carried out at 40°C. Therefore, 40°C was selected as the optimal reaction temperature.

[0040] Embodiment 4 The specificity of the optimal Brucella sutchi MIRA detection method obtained in the evaluation embodiment three was as follows: Six common pathogens with similar clinical symptoms to those of Brucella infection were used for evaluation: Escherichia coli, Bacillus subtilis, Pseudomonas aeruginosa, Staphylococcus aureus, Streptococcus pneumoniae, and Haemophilus influenzae. The positive control plasmid constructed in Example 2 and the six pathogens were used to conduct a specificity experiment using the optimal Brucella MIR detection method established in Example 3. The results are shown in Figure 2. Figure 5 As shown, MIRA can only detect Brucella, and no amplification curves are generated for the other six pathogens, proving that it has no cross-reaction with the six pathogens with similar clinical infection symptoms. The primer-probe combination for rapid detection of Brucella based on MIRA isothermal amplification has good specificity.

[0041] Embodiment 5 The sensitivity of the optimal Brucella sutchi MIRA detection method obtained in Example 3 was evaluated and compared with the common MIRA, and the specific steps were as follows: The plasmid diluted in Example 2 was used to react according to the optimal MIRA detection method obtained in Example 3 to evaluate its sensitivity. The sensitivity of the ordinary MIRA reaction was compared with that of the optimal MIRA detection method obtained in Example 3. The amplification results of the optimal MIRA detection method obtained in Example 3 are shown in FIG. Figure 6 As shown in Figure 2, the detection limit of the optimal Brucella MIRA detection method obtained in Example 3 is 1.73 copies / μL, which has a very high detection sensitivity for Brucella. Figure 7 As shown, the detection limit is 1.73×10 1 This indicates that the detection limit is increased tenfold by introducing the method of Sue's amplification, and the primer-probe combination for rapid detection of Brucella based on Sue's MIRA isothermal amplification has extremely high sensitivity.

[0042] Embodiment 6 To evaluate the clinical detection performance of the Brucella nest MIRA detection method, in order to fully evaluate the detection capability of the Brucella nest MIRA detection method established by the present invention, 5 cattle blood samples, 10 sheep blood samples, and 10 human blood samples were selected, a total of 25 samples (all samples were from the Yunnan Provincial Institute of Endemic Disease Control), and the optimal Brucella nest MIRA detection method obtained in Example 3 was used for the test. The template in the one-step reaction system was the DNA of the extracted sample to be tested. The qPCR method was used as a control.

[0043] The results are as follows Figure 8 As shown in Table 5, 25 blood samples detected 12 positives in total, including 2 cattle blood samples, 5 sheep blood samples, and 5 human blood samples. The detection result of the optimal Brucella nest MIRA detection method obtained using the embodiment of the present invention three is consistent with the qPCR detection result. The Brucella nest MIRA detection method shown in the present invention can be used for real sample detection, and has good detection performance.

[0044] Table 5 ;

[0045] Therefore, the Brucella detection method provided by the present invention has the advantages of strong specificity and no cross-reaction compared with SAT and RBPT serological detection methods; compared with blood culture and qPCR technology, it has the advantages of short detection time and convenient operation, and can complete nested MIRA amplification and detection within 30 minutes; the detection performance is greatly improved, and the detection limit is increased by 10 times compared with ordinary MIRA, which can reach 1.73 copies / μL; the present invention is based on nested MIRA technology, meets the requirements of POCT (Point-ofCare Testing, i.e., rapid, sensitive, specific, low equipment requirements and economical), can overcome the limitation of equipment dependence, and is an ideal tool for on-site screening of Brucella in livestock (cattle and sheep) and people in epidemic areas, providing a powerful diagnostic tool for early screening, early diagnosis and prevention and control of animal-to-animal transmission and human-to-animal transmission of Brucella.

[0046] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solution of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solution to deviate from the spirit and scope of the technical solution of the present invention.

Claims

1. A primer-probe combination for detecting Brucella based on nested MIRA, characterized in that, The primer-probe combination comprises: an inner upstream primer Bru-1IF, an inner downstream primer Bru-3IR, an outer upstream primer Bru-2OF, an outer downstream primer Bru-2OR and a probe.

2. A primer-probe combination for detecting Brucella based on nested MIRA according to claim 1, characterized in that: The sequence of the inner upstream primer Bru-1IF is shown as SEQ ID NO.1, the sequence of the inner downstream primer Bru-3IR is shown as SEQ ID NO.6, the sequence of the outer upstream primer Bru-2OF is shown as SEQ ID NO.8, and the sequence of the outer downstream primer Bru-2OR is shown as SEQ ID NO.

11.

3. A primer-probe combination for detecting Brucella based on nested MIRA according to claim 1, characterized in that: The probe sequence is labeled with a FAM fluorescent reporter group at the 29th base T from the 5′ end, the 31st base T is replaced by tetrahydrofuran THF, the 33rd base T is labeled with a BHQ-1 fluorescent quencher group, and the 3′ end is modified with C3 spacer blocking. The sequence is shown in SEQ ID NO.

13.

4. A method for detecting Brucella based on nested MIRA, characterized in that: Using the primer-probe combination for detecting Brucella based on nested MIRA according to any one of claims 1 to 3, a one-step reaction system is configured with the extracted DNA of the sample to be tested as a template, and the mixture is reacted at a constant temperature of 38-42° C. for 10 minutes. A two-step reaction system is configured with the reaction product as a template, and the mixture is reacted at a constant temperature of 38-42° C. for 20 minutes. A fluorescent signal is collected, which is positive.

5. A method for rapid detection of Brucella by isothermal amplification according to claim 4, characterized in that, The one-step reaction system includes the following components: 29.4 μL of buffer A, 2 μL of peripheral upstream primer, 2 μL of peripheral downstream primer, 9.1 μL of ddH2O, 5 μL of template, 2.5 μL of buffer B, and MIRA reaction enzyme; the concentration of the primers is 10 μM, and buffer A, buffer B, and MIRA reaction enzyme are all taken from the DNA Constant Temperature Rapid Amplification Kit-Fluorescence Type.

6. A method for rapid detection of Brucella by isothermal amplification according to claim 4, characterized in that, The two-step reaction system includes the following components: 29.4 μL of buffer A, 2 μL of inner upstream primer, 2 μL of inner downstream primer, 0.6 μL of probe, 8.5 μL of ddH2O, 5 μL of template, and 2.5 μL of buffer B; the concentrations of the probe and primers are both 10 μM, and buffer A and buffer B are both taken from the DNA Constant Temperature Rapid Amplification Kit-Fluorescence Type; the template is the one-step reaction product.

7. A Brucella detection kit, characterized in that: The invention comprises the primer-probe combination for rapid detection of Brucella based on nested MIRA isothermal amplification as described in any one of claims 1 to 3.

8. An application of a primer-probe combination for rapid detection of Brucella by nested MIRA isothermal amplification as described in any one of claims 1-3 in Brucella detection, characterized in that: The application is not intended for the diagnosis and treatment of diseases.

9. an application of the method for rapid detection of Brucella by isothermal amplification as described in any one of claims 4-6 in Brucella detection, characterized in that: The application is not intended for the diagnosis and treatment of diseases.

Images