KASP molecular markers, primer pairs, kits and their applications for identifying dwarf traits in melon

By developing the KASP molecular marker K1069930 based on the SNP site on chromosome Chr07, the problem of improving dwarf traits in melon crops was solved, and the rapid identification of dwarf traits was achieved, and the melon breeding process was promoted.

CN119842971BActive Publication Date: 2025-06-17SANYA PEARL MELON & WATERMELON DISPLAY & EVALUATION RES CENT
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510316426.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-06-17
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

The long-lived traits in melon crops are low in diversity and limited sources of variation, which hinders the improvement of dwarf traits in melon crops. It lacks short and strong melon varieties, making it difficult to implement mechanized, lightweight, simplified and industrialized cultivation, increasing the difficulty of pest control.

Method used

A KASP molecular marker K1069930 was developed, based on the SNP site design on chromosome Chr07. It can quickly identify the melon dwarf traits through PCR amplification and fluorescence detection, simplifying the detection process and avoiding complex steps such as enzyme cutting, electrophoresis and sequencing.

Benefits of technology

The rapid, simple and efficient identification of melon dwarf traits has been achieved, and the selection and breeding of melon dwarf germplasm has been promoted, and gene localization and molecular assisted breeding process have been promoted.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119842971B_ABST
    Figure CN119842971B_ABST
Patent Text Reader

Abstract

The embodiments of the present application disclose KASP molecular markers, primer pairs, kits and applications thereof for identifying dwarf traits of melons, which relate to the field of molecular marker technology and aim to utilize molecular marker-assisted selection breeding in melon dwarf traits to promote gene localization and molecular-assisted breeding processes. The method for identifying dwarf traits of melons comprises the following steps: extracting genomic DNA of a target melon, using the genomic DNA of the target melon as a template for PCR amplification, and performing fluorescence detection based on primers of KASP marker K1069930 to obtain the gene type of the target melon; based on the detected gene type, determining the trait of the target melon; the KASP marker K1069930 is designed based on the SNP site at Chr07:1069930, and the nucleotide sequence of the SNP site is shown in SEQ ID NO.1. The identification method in the present application can be more efficiently applied to the breeding of dwarf germplasm of melons.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the technical field of molecular markers, and in particular to KASP molecular markers, primer pairs, kits and applications thereof for identifying dwarf traits of melons. Background Art

[0002] Muskmelon (Cucumis melo L.) is a unique economic crop in Xinjiang. It has the advantages of short cultivation cycle, large market demand, good economic benefits, high land utilization rate and multiple cropping index, etc. It has become an effective way to increase farmers' income and optimize agricultural planting structure. In recent years, the area of ​​melon protected cultivation has continued to increase. Dwarf plants have a great advantage in melon protected cultivation due to their increased planting density, which leads to increased yield per unit area of ​​land. This shows that dwarf melons have become the direction of production breeding.

[0003] Dwarfing and stocky structure will become an important target trait for increasing crop yields. In melon crops, the diversity of long vine phenotypes is small and the sources of variation are limited, which seriously hinders the improvement of "dwarfing and stocky" melon crops. Secondly, due to the lack of dwarfing and stocky melon varieties, mechanized, simplified and labor-saving cultivation is difficult to implement, and the difficulty of green prevention and control of pests and diseases is increased. Therefore, the genetic improvement of dwarfing melon crops is still difficult. Summary of the invention

[0004] The main purpose of this application is to provide KASP molecular markers, primer pairs, kits and applications for identifying melon dwarfing traits, aiming to use molecular marker-assisted selection breeding in melon dwarfing traits to promote gene positioning and molecular-assisted breeding processes.

[0005] To achieve the above objectives, the technical solutions adopted in the embodiments of the present application are as follows:

[0006] In a first aspect, the present application provides an application of a KASP molecular marker for identifying a dwarf trait of a melon, which is applied to identifying a dwarf trait of a melon, wherein the identification of the dwarf trait of a melon comprises the following steps:

[0007] Extracting genomic DNA of the target melon, performing PCR amplification using the genomic DNA of the target melon as a template, and performing fluorescence detection based on primers of KASP marker K1069930 to obtain the gene type of the target melon; and determining the trait of the target melon based on the detected gene type;

[0008] The KASP marker K1069930 is designed based on the SNP site at Chr07:1069930, and the nucleotide sequence of the SNP site is shown in SEQ ID NO.1.

[0009] As some optional embodiments of the present application, the genotypes include homozygous long-vine type genotypes, homozygous dwarf type genotypes and heterozygous long-vine genotypes.

[0010] As some optional embodiments of the present application, the homozygous long vine type genotype refers to a genotype whose fluorescence detection result satisfies a first preset condition; the first preset condition means that the distance value of the fluorescence detection result reaching the Y axis is less than the distance value thereof reaching the X axis.

[0011] As some optional embodiments of the present application, the homozygous dwarfing type genotype refers to a genotype whose fluorescence detection result satisfies a second preset condition; the second preset condition means that the distance value of the fluorescence detection result reaching the X-axis is less than the distance value thereof reaching the Y-axis.

[0012] As some optional embodiments of the present application, the heterozygous long vine genotype refers to a gene type whose fluorescence detection result satisfies a third preset condition; the third preset condition means that the difference in distance between the fluorescence detection result reaching the X-axis and the distance between the fluorescence detection result reaching the Y-axis satisfies a preset value.

[0013] As some optional embodiments of the present application, the gene type is obtained based on the following reaction system: KASP mix 10 μL, 0.02 μL each of primers F1 and F2 with a concentration of 100 μM, primer R 0.06 μL, and DNA 1 μL.

[0014] As some optional embodiments of the present application, the PCR amplification procedure is:

[0015] Pre-denaturation at 94°C for 15 min;

[0016] Denature at 94°C for 20 seconds;

[0017] Annealing and extension at 65°C-57°C for 45S;

[0018] 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle;

[0019] Denaturation at 94°C for 20S, annealing and extension at 57°C for 60S, for 30 cycles.

[0020] As some optional embodiments of the present application, the primer pair of KASP marker K1069930 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers;

[0021] The two forward primers include K1069930-F1 as shown in SEQ ID NO.2 and K1069930-F2 as shown in SEQ ID NO.3; the reverse primer is K1069930-R as shown in SEQ ID NO.4.

[0022] As some optional embodiments of the present application, the primer pair of the KASP marker K1069930 can be used to prepare a kit for identifying the KASP molecular marker for the dwarfing trait of melon.

[0023] As some optional embodiments of the present application, the primer pair of KASP marker K1069930 can be used for the breeding of dwarf melon germplasm.

[0024] Compared with the prior art, the present application has successfully developed a KASP molecular marker K1069930, which is closely related to the identification of melon dwarfing traits. The K1069930 molecular marker consists of two forward primers K1069930-F1 and K1069930-F2 with lengths of 50bp and 51bp respectively, and a reverse primer K1069930-R with a length of 25bp. The present application uses the KASP molecular marker K1069930 to perform genotyping on the dwarf type and long vine type of melon. The identification of the target plant DNA can be achieved through only one PCR amplification, and the entire detection process is simple and does not require complex steps such as enzyme cutting, electrophoresis and sequencing. Through the high-throughput genotyping system, the genotyping map and typing value can be quickly obtained, thereby realizing the rapid identification of the target plant genotype. Therefore, the KASP molecular marker K1069930 in the present application can be easily, quickly and efficiently applied to the breeding of melon dwarf germplasm. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is a phenotypic comparison diagram of the dwarf type (M1) and the long vine type (M2) of the melon seedling stage involved in the embodiments of the present application;

[0026] Figure 2 This is a phenotypic comparison diagram of the dwarf type (M1) and the long vine type (M2) of the melon in the reproductive growth period involved in the embodiments of the present application;

[0027] Figure 3 This is the melon ED Euclidean distance analysis diagram involved in the embodiment of the present application. The horizontal axis is the base position on each chromosome, and the vertical axis represents the Nth power of the ED value of the SNP. Each point represents a SNP, the black one is the fitting line, and the orange one is the threshold line;

[0028] Figure 4 This is the SNP site map of the melon KASP molecular marker K1069930 involved in the embodiment of the present application, M1.realigned.bam.Coverage and M2.realigned.bam.Coverage represent the resequencing data of M1 and M2 respectively;

[0029] Figure 5The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 1-88) involved in the embodiments of the present application;

[0030] Figure 6 The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 89-176) involved in the embodiments of the present application;

[0031] Figure 7 The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 177-264) involved in the embodiments of the present application;

[0032] Figure 8 The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 265-352) involved in the embodiments of the present application;

[0033] Fig. 9 The genotyping diagrams of the dwarf type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 353-440) of melon involved in the embodiments of the present application;

[0034] Fig.10 The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 441-528) involved in the embodiments of the present application;

[0035] Fig.11 The genotyping diagrams of the dwarf melon type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 529-616) involved in the embodiments of the present application;

[0036] Fig.12 This is the genotyping diagram of the melon dwarf type (M1), long vine type (M2) and F2 generation expanded population (single plants No. 617-623) involved in the examples of the present application.

[0037] in, Figure 5-Figure 12 In the assay, NTC (no reaction template was added, and ddH2O was used instead of nucleic acid in the reaction) is the negative control; Empty represents vacancy; Unknown represents unknown; Missing means that no liquid was sprayed into the reaction well; UDE means that no fluorescence was detected. DETAILED DESCRIPTION

[0038] It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0039] As mentioned above, melon, with its short cycle, high demand, good benefits and high land utilization rate, plays a significant role in increasing farmers' income and optimizing agricultural structure. With the expansion of protected cultivation area, dwarf plants have become the focus of breeding due to their high density and yield advantages. Dwarf structure is crucial to increasing crop yields. However, the long vine traits of melon crops have not been fully domesticated, the phenotypic diversity is low, and the sources of variation are limited, which restricts the improvement of the "dwarf" trait. The lack of dwarf varieties also hinders mechanized cultivation, increases the difficulty of pest and disease prevention and control, and makes the dwarf genetic improvement of melon crops face challenges.

[0040] Molecular marker technology has been widely used in the field of gene localization. At present, RFLP, RAPD, AFLP, SSR, InDel, SNP and other technologies are commonly used methods in molecular marker technology. As a mainstream SNP high-throughput technology, competitive allele-specific PCR (kompetitive allele-specific PCR, KASP) has achieved high-precision biallelic (SNP and InDels) genotyping with its excellent stability and accuracy. With the rapid development of sequencing technology in my country, InDel markers and SNP markers can be converted into high-throughput competitive allele-specific PCR markers KASP for genotyping analysis of biological populations. This technological advancement will greatly promote the progress of gene localization and molecular-assisted breeding.

[0041] Based on this, the present application describes in detail and provides a KASP molecular marker for identifying the dwarfing trait of melon. In addition, the present application also relates to primer pairs related to the KASP molecular marker, and a kit containing these specific primer pairs, which are designed to efficiently identify the dwarfing trait of melon under laboratory conditions. The present application is not limited to providing these molecular markers and kits, but also further describes the specific application methods of these tools in the process of melon dwarfing germplasm breeding. At the same time, based on the KASP molecular markers, primer pairs and kits provided above, the present application also describes in detail a method for identifying the dwarfing trait of melon, which includes the steps of extracting DNA from melon samples, performing PCR amplification, and performing genotype analysis using KASP technology, thereby achieving accurate identification of the dwarfing trait of melon.

[0042] On the one hand, the KASP molecular marker used to identify the dwarfing trait of melon described in the present application is determined to be KASP marker K1069930; the KASP marker K1069930 is designed based on the single nucleotide polymorphism (SNP) located at the 1069930th position of chromosome Chr07. Further analysis shows that the base of the SNP site mutates from cytosine (C) to thymine (T), and its nucleotide sequence is detailed in the sequence identifier SEQ ID NO.1.

[0043] The sequence identifier SEQ ID NO.1 and its corresponding variant sites are as follows:

[0044] TGCTCCAATAATGGCATGTAGTGTGGGGTAGGATGTCCAAAAGTATATAA[C / T]TATAAGACTATAAGTTGATAGCCATCATCCATGATATGATACCAATTCTT.

[0045] On the other hand, the primer pair for identifying the KASP molecular marker for the dwarfing trait of melon described in the present application includes K1069930-F1 as shown in SEQ ID NO.2, K1069930-F2 as shown in SEQ ID NO.3 and K1069930-R as shown in SEQ ID NO.4.

[0046] K1069930-F1 (SEQ ID NO. 2):

[0047] GAAGGTGACCAAGTTCATGCTATGATGGCTATCAACTTATAGTCTTATAG.

[0048] K1069930-F2 (SEQ ID NO. 3):

[0049] GAAGGTCGGAGTCAACGGATTGATGATGGCTATCAACTTATAGTCTTATAA.

[0050] K1069930-R (SEQ ID NO. 4):

[0051] AATGGCATGTAGTGTGGGGTAGGAT.

[0052] In addition, the kit for identifying the KASP molecular marker for the dwarfing trait of melon described in the present application includes the primer pair of the KASP marker K1069930 as described above, namely K1069930-F1 as shown in SEQ ID NO.2, K1069930-F2 as shown in SEQ ID NO.3 and K1069930-R as shown in SEQ ID NO.4; wherein, K1069930-F1 as shown in SEQ ID NO.2 and K1069930-F2 as shown in SEQ ID NO.3 are forward primers, and K1069930-R as shown in SEQ ID NO.4 is a reverse primer.

[0053] The method for identifying the dwarfing trait of melon involved in the present application comprises the following steps:

[0054] Firstly, the genomic DNA of the target melon was extracted, and then the genomic DNA was used as a template and the primers of KASP marker K1069930 were used for PCR amplification and fluorescence detection. The PCR amplification program was 94°C pre-denaturation for 15 min, 94°C denaturation for 20S, 65°C-57°C annealing and extension for 45S, 10 cycles, the annealing and extension temperature was reduced by 0.8°C each cycle, 94°C denaturation for 20S, 57°C annealing and extension for 60S, 30 cycles; according to the gene type in the test results, the traits of the target melon were determined.

[0055] Specifically, if the detected gene type is HH, the trait of the target melon is a homozygous dwarf type genotype; the homozygous dwarf type genotype refers to a gene type whose fluorescence detection result satisfies a second preset condition; the second preset condition means that the distance value of the fluorescence detection result reaching the X-axis is less than the distance value of the fluorescence detection result reaching the Y-axis; that is, the fluorescence detection result is closer to the X-axis.

[0056] If the detected gene type is FF, the trait of the target melon is a homozygous long vine type genotype; the homozygous long vine type genotype refers to a gene type whose fluorescence detection result satisfies a first preset condition; the first preset condition means that the distance value of the fluorescence detection result reaching the Y axis is less than the distance value of the fluorescence detection result reaching the X axis; that is, the fluorescence detection result is closer to the Y axis.

[0057] If the detected gene type is FH, the trait of the target melon is a heterozygous long-vine genotype; the heterozygous long-vine genotype refers to a gene type whose fluorescence detection result satisfies a third preset condition; the third preset condition means that the difference between the distance between the fluorescence detection result reaching the X-axis and the distance between the fluorescence detection result reaching the Y-axis satisfies a preset value; that is, the fluorescence detection result is near the axis of symmetry between the X-axis and the Y-axis.

[0058] Furthermore, the primers for KASP marker K1069930 consist of two forward primers and one reverse primer, wherein the forward primers include K1069930-F1 as shown in SEQ ID NO.2 and K1069930-F2 as shown in SEQ ID NO.3, and the reverse primer is K1069930-R as shown in SEQ ID NO.4; and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers, respectively.

[0059] The technical solution of this application is further described below in conjunction with specific embodiments:

[0060] Example 1

[0061] This example mainly provides further details on the identification of melon dwarfing trait genes and the development of KASP markers:

[0062] Step 1: In this application study, we selected Figure 1 and Figure 2 The two different types of melons shown are used as experimental materials, namely the dwarf type M1 and the long vine type M2. By hybridizing the dwarf type M1 and the long vine type M2 as parents, F1 generation plants were successfully obtained, which showed long vine types. Subsequently, the F1 generation plants were self-pollinated, resulting in 298 F2 generation plants. When these plants entered the reproductive growth period, the dwarf and long vine type phenotypes of the F2 generation population were identified. The identification results showed that in the F2 generation population, the number of long vine type plants was 223, while the number of dwarf type plants was 75. By analyzing the phenotypes of the F1 generation and the segregation ratio of the F2 generation, it can be found that the segregation ratio of the long vine type to the dwarf type is 3:1. To verify the statistical significance of this ratio, the present application conducted a chi-square test (χ2=0.004) and obtained a probability value of p=0.947, which is much greater than 0.05, as shown in Table 1, indicating that the observed results of the present application are not significantly different from the expected 3:1 separation ratio. Based on these data, it can be concluded that the dwarfing trait is controlled by a recessive single gene. This discovery is of great significance to the genetic breeding of melons because it reveals the genetic mechanism that controls the dwarfing trait of melons and provides a theoretical basis for future breeding work.

[0063] Table 1 Phenotypic identification and genetic analysis of the sixth generation of melon

[0064]

[0065] Step 2. In order to further determine the specific location of the gene that regulates the dwarfing trait of melon, this application selected 30 dwarfing plants and 30 long-vine plants from the F2 generation population, and also selected two parents as references. These samples were sent to Shanghai Paisonno Biotechnology Co., Ltd. for in-depth sequencing and typing using Bulked Segregant Analysis (BSA) and high-throughput sequencing technology. By analyzing the single nucleotide polymorphisms (SNPs) between mixed pools, this application successfully identified a region on chromosome 7 of melon that is significantly associated with the dwarfing trait based on the Euclidean Distance (ED) algorithm. The size of this region was determined to be 3.02 megabase pairs (Mb), such as Figure 3As shown, the horizontal axis is the base position on each chromosome, and the vertical axis represents the Nth power of the ED value of the SNP. Each point represents a SNP, the black is the fitting line, and the orange is the threshold line. In order to further narrow this candidate region, this application developed 18 sets of KASP (Kompetitive Allele Specific PCR) markers within the initial positioning interval. And using 298 F2 populations, the candidate interval was narrowed to 0.35 megabase pairs (Mb), thereby more accurately locating the gene region that may control the dwarfing trait of melon.

[0066] Step 3: In the candidate interval that has been narrowed down to 0.35Mb, the present application further developed the KASP molecular marker technology. Specifically, the KASP marker K1069930 is designed based on the 1069930th SNP site located on chromosome Chr07, such as Figure 4 As shown, M1.realigned.bam.Coverage and M2.realigned.bam.Coverage represent the resequencing data of M1 and M2, respectively. In order to achieve this marker, the present application designed three sets of primers, namely K1069930-F1 (50 base pairs in length), K1069930-F2 (51 base pairs in length), and K1069930-R (25 base pairs in length). Subsequently, the present application expanded the F2 generation population, planted a total of 599 plants, and collected leaf samples from each plant. Take young and tender tissues, place them in a 96-well PCR plate, add 70μl Buffer A solution, and use a PCR instrument to heat bath at 99 degrees Celsius for 2 minutes; after cooling to room temperature, add an equal volume of Buffer B solution, centrifuge instantly, and mix Buffer A and Buffer B thoroughly. Dilute the AB mixture 20 times for KASP marker detection. This application uses the KASP molecular marker K1069930 for genotyping in order to further screen and confirm the target gene.

[0067] Step 4. In the study of this application, the KASP molecular marker K1069930 was used to genotype the individuals in the two parents M1, M2 and the F2 expansion population. The KASP reaction was carried out in a reaction plate, wherein the reaction system included: 10 μL of KASPmix, 0.02 μL of primers F1 and F2 at a concentration of 100 μM, 0.06 μL of primer R, and 1 μL of DNA. The PCR amplification program was 94°C pre-denaturation for 15 min, 94°C denaturation for 20S, 65°C-57°C annealing and extension for 45S, 10 cycles, annealing and extension temperature was reduced by 0.8°C each cycle, 94°C denaturation for 20S, 57°C annealing and extension for 60S, 30 cycles. Through detection, this application successfully divided the genotypes of each individual plant in the F2 expansion population into three different categories. First, there is a type of genotype close to the Y axis, which is similar to the genotype of M2 in the parent and is classified as a homozygous long vine type genotype F:F. Secondly, another type of genotype is close to the X axis. They are similar to the genotype of M1 in the parents and are classified as homozygous dwarf type genotype H:H. Finally, there is another type of genotype located near the symmetry axis of the X and Y axes. They are similar to the genotype of F1 and are classified as heterozygous long-vine genotype F:H. This classification result is Figure 5 (F2 generation expanded population, individual plants 1-88), Figure 6 (F2 generation expanded population, individual plants 89-176), Figure 7 (F2 generation expanded population, individual plants 177-264), Figure 8 (F2 generation expanded population, individual plants 265-352), Fig. 9 (F2 generation expanded population, individual plants 353-440), Fig.10 (F2 generation expanded population, individual plants 441-528), Fig.11 (F2 generation expanded population, individual plants 529-616) and Fig.12 (F2 generation expanded population 617-623 individual plants), where H7 and H8 represent M1, H9 and H10 represent M2, which serve as positive controls; and H11 and H12 represent NTC (no reaction template is added, ddH2O replaces the nucleic acid in the reaction), which serve as negative controls. Through the genotyping detection of KASP molecular marker K1069930 in the F2 expanded population, the present application found that the results were completely consistent with the results of the phenotypic identification of melon dwarfing and long vine types. Based on this, it can be concluded that KASP molecular marker K1069930 can be used as an effective molecular marker for identifying the dwarfing trait of melon.

[0068] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. Use of a reagent for detecting KASP molecular markers for dwarfing traits of melons in identifying dwarfing traits of melons, characterized in that: The identification of melon dwarfing traits comprises the following steps: Extracting genomic DNA of the target melon, performing PCR amplification using the genomic DNA of the target melon as a template, and performing fluorescence detection based on primers of the KASP molecular marker K1069930 to obtain the gene type of the target melon; and determining the trait of the target melon based on the detected gene type; The KASP molecular marker K1069930 is designed based on the SNP site at Chr07:1069930, and the SNP site is located at the 51st base of the nucleotide sequence shown in SEQ ID NO.

1. The polymorphism of the KASP molecular marker is C or T, the CC genotype is a homozygous long vine type, the TT genotype is a homozygous dwarf type, and the CT genotype is a heterozygous long vine type.

2. The application according to claim 1, characterized in that: The PCR amplification procedure is: Pre-denaturation at 94°C for 15 min; Denature at 94°C for 20 seconds; Annealing and extension at 65°C-57°C for 45S; 10 cycles, with the annealing extension temperature decreasing by 0.8°C each cycle; Denaturation at 94°C for 20S, annealing and extension at 57°C for 60S, for 30 cycles.

3. The application according to claim 1, characterized in that: The primer pair of the KASP molecular marker K1069930 includes two forward primers and one reverse primer, and fluorescent reporter groups FAM and HEX are added to the 5' ends of the two forward primers respectively; The two forward primers include K1069930-F1 as shown in SEQ ID NO.2 and K1069930-F2 as shown in SEQ ID NO.3; the reverse primer is K1069930-R as shown in SEQ ID NO.

4.

4. The use according to claim 3, characterized in that: The primer pair of the KASP molecular marker K1069930 can be used to prepare a kit for identifying the KASP molecular marker for the dwarfing trait of melon.

5. The application according to claim 3, characterized in that: The primer pair of the KASP molecular marker K1069930 can be used for the breeding of dwarf melon germplasm.

Citation Information

Patent Citations

  • KASP marker primer combination for detecting watermelon dwarf character and application thereof

    CN116179742A

  • KASP marker for screening sour character of muskmelon and application of KASP marker

    CN117965783A