Application of HY-133073 in preparation of drugs for resisting liver cancer central immune escape

Abstract

The invention provides an application of HY-133073 in preparation of a medicine for resisting immune escape of liver cancer center. Based on a tumor immune escape mechanism related to thymus in a liver cancer morbidity process found for the first time, the tumor immune escape mechanism is named as tumor central immune escape, the invention specifically discloses application of HY-133073 in preparation of drugs for resisting liver cancer central immune escape, and the main mechanism is that HY-133073 inhibits signal transduction after CCR7 is combined with CCL19 or CCL21, and the HY-133073 inhibits signal transduction after CCR7 is combined with CCL19 or CCL21. Therefore, CCR7 positive CD8 T cells are inhibited from homing to thymus and immune escape to the center, infiltration of the CD8 T cells to liver tumors is enhanced, and the anti-cancer effect is achieved. The compound can be used for preparing liver cancer central immune escape inhibition drugs or central immune escape inhibition drugs for liver cancer treatment and tumor immune research.

Description

Technical Field

[0001] The invention relates to the field of medicines, and in particular to application of HY-133073 in preparing drugs for resisting central immune escape of liver cancer. Background Art

[0002] The liver tissue has a rich distribution of immune cells, and liver cells proliferate vigorously, with a high risk of cell mutation. When liver cells become cancerous, the distribution composition and functional characteristics of immune cells in the liver tissue are redistributed. In most cases, cancerous liver cells are cleared by the immune system. However, some liver cancer cells evade immune system surveillance in various ways, proliferate disorderly, and form liver tumors. A variety of anti-tumor programs have been developed to target the mechanism of immune escape, such as chemotherapy drugs targeting the cell anti-apoptotic protein Bcl-2, antibody drugs targeting the PD1 / PDL1 immune checkpoint, and so on.

[0003] The following are the ways in which tumors can escape immune responses: tumor cells do not express specific antigens, have low immunogenicity, and cannot be detected by immune surveillance cells; tumor cells reduce the expression of MHC molecules, reduce the presentation of antigens to the tumor cell surface, and evade immune cell surveillance; tumor cells lack co-stimulatory molecules such as CD80 and CD86 on their surface, resulting in the inability to activate and proliferate tumor-specific T cells; tumor cells express immunosuppressive molecules such as PDL1, which inhibit the function of anti-tumor immune cells; immunosuppressive cells exist in the tumor microenvironment, which inhibit the function of anti-tumor immune cells; and the anti-apoptosis mechanism of tumor cells, such as the high expression of anti-apoptotic proteins such as Bcl2, cannot be effectively killed even if they are recognized by immune cells. Summary of the invention

[0004] The purpose of the present invention is to provide a compound HY-133073 for use in the preparation of liver cancer central immune escape inhibitory drugs. The main mechanism is that HY-133073 inhibits the signal transduction after the receptor CCR7 binds to the ligands CCL19 and CCL21, thereby inhibiting the homing of CCR7-positive CD8 T cells to the thymus and the central immune escape of tumors, enhancing the infiltration of CD8 T cells into liver tumors, and achieving anti-cancer effects. It can be used as a preparation of liver cancer central immune escape inhibitory drugs or central immune escape inhibitory drugs for liver cancer treatment and tumor immunity research.

[0005] To achieve the above object, the present invention adopts the following technical solution: Application of HY-133073 in the preparation of drugs for treating central immune escape of tumors.

[0006] Preferably, said tumor comprises primary hepatocellular carcinoma.

[0007] Preferably, HY-133073 is used to prepare a pharmaceutical composition containing HY-133073 and a pharmaceutically acceptable carrier.

[0008] Preferably, the pharmaceutical composition contains 0.01%-99.99% HY-133073, and the rest is a pharmaceutical carrier.

[0009] Application of HY-133073 in the preparation of a drug for treating hepatocellular carcinoma.

[0010] Preferably, the hepatocellular carcinoma comprises primary hepatocellular carcinoma.

[0011] Preferably, HY-133073 is used to prepare a pharmaceutical composition containing HY-133073 and a pharmaceutically acceptable carrier.

[0012] Preferably, the pharmaceutical composition contains 0.01%-99.99% HY-133073, and the rest is a pharmaceutical carrier.

[0013] Preferably, the structural formula of HY-133073 is as follows: CAS: 681514-83-0; Compound CID: 136165388 The inventors of the present application discovered a new thymus-dependent central immune escape pathway when studying the occurrence and progression of hepatocellular carcinoma: on the one hand, hepatocellular carcinoma cells promote the expression of ligands CCL19 and CCL21 by thymic tissue, recruiting CCR7-positive activated CD8 T cells to home to the thymus; on the other hand, hepatocellular carcinoma cells secrete proteins such as alpha fetoprotein (AFP) into the circulatory system, and are taken up and presented by thymic epithelial cells as tumor-associated antigens; CD8 T cells have been exposed to alpha fetoprotein antigens presented by antigen presenting cells (APC) in peripheral immune organs. After these CD8 T cells home to the thymus, they are exposed to alpha fetoprotein antigens presented by thymic epithelial cells for the second time, undergoing activation-induced cell death (AICD), thereby causing thymus-dependent tumor immune escape, which has not been reported before. We named it "tumor central immune escape (TCIE)".

[0014] The advantages of the present invention are: When the inventor studied the mechanism of liver cancer, he discovered a new mechanism of tumor central immune escape and found that HY-133073 has the effect of resisting liver cancer central immune escape. When hepatocellular carcinoma occurs and progresses, liver cancer cells promote the thymus homing and death of CD8 T cells dependent on the CCR7-CCL19 / CCL21 chemokine axis, and tumor central immune escape occurs. Surgical resection of the thymus of liver cancer-bearing mice increased CD8 T cell infiltration in liver cancer tissue and inhibited liver tumor progression. HY-133073 can replace surgical resection of the thymus. On the premise of preserving the thymus, it can pharmacologically inhibit the signal transduction after the CCR7 receptor binds to the CCL19 ligand and the CCL21 ligand, thereby inhibiting the homing of CCR7-positive CD8 T cells to the thymus and the central immune escape of liver cancer, enhancing the infiltration of CD8 T cells into liver tumors, and achieving anti-cancer effects.

[0015] So far, there are no reports on the application of HY-133073 in the treatment of central immune escape in liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 :The thymus upregulates the expression of CCL19 and CCL21 during liver cancer. (A) The inventors used intraperitoneal injection of diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma was induced by this method, and healthy mice were used as controls, and thymus tissues were collected.

[0017] (B) The inventors collected thymus tissues from the above liver cancer model mice and used fluorescent real-time quantitative PCR technology to analyze the transcriptional expression level of CCL19 in thymus tissues.

[0018] (C) The inventors collected thymus tissues from the above-mentioned liver cancer model mice and used fluorescent real-time quantitative PCR technology to analyze the transcriptional expression level of CCL21 in thymus tissues.

[0019] Figure 2 :When liver cancer occurs, activated CD8 T cells home to the thymus and die, allowing tumors to escape central immune system. Among them: (A) The inventors used intraperitoneal injection of diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma was induced by this method, and healthy mice were used as controls, and thymus tissues were collected.

[0020] (B) The inventors collected thymus tissues from the above-mentioned healthy mice and liver cancer model mice, and used flow cytometry to analyze the distribution ratio of CD73-positive peripherally derived CD8 T cells in the thymus of healthy mice (normal) and liver cancer mice (model).

[0021] (C) The inventors statistically analyzed the above flow cytometry data and quantitatively compared the distribution ratio of CD73-positive peripherally derived CD8 T cells in the thymus of healthy mice (normal) and liver cancer mice (model).

[0022] (D) The inventors collected thymus tissues from the above-mentioned healthy mice and liver cancer model mice, and used multiple fluorescent staining technology to detect CD8, CD73, granzyme B (GZMB), and cell death TUNEL signals.

[0023] (E) The inventors statistically analyzed the above immunofluorescence data and quantitatively compared the death of CD73-positive CD8 T cells.

[0024] Figure 3 :When liver cancer occurs, thymic epithelial cells take up alpha-fetoprotein (AFP). Among them: (A) The inventors used intraperitoneal injection of diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma was induced by this method, and healthy mice were used as controls, and thymus tissues and liver cancer tissues were collected.

[0025] (B) The inventors collected liver cancer tissues from the above-mentioned healthy mice and liver cancer model mice, and used mRNA sequencing technology to analyze the transcriptional expression level of alpha-fetoprotein (AFP) in the liver tissue (normal liver) of healthy mice and the liver cancer tissue (HCC) of liver cancer mice.

[0026] (C) The inventors collected thymus tissues from the above-mentioned healthy mice and liver cancer model mice, and used mRNA sequencing technology to analyze the transcriptional expression of alpha-fetoprotein (AFP) in the thymus tissues of healthy mice (normal thymus) and the thymus tissues of liver cancer mice (model thymus).

[0027] (D) The inventors collected liver cancer tissues from the above-mentioned healthy mice and liver cancer model mice, and used protein spectrum technology to analyze the protein expression level of alpha-fetoprotein (AFP) in the liver tissues (normal liver) of healthy mice and the liver cancer tissues (HCC) of liver cancer mice.

[0028] (E) The inventors collected thymus tissues from the above-mentioned healthy mice and liver cancer model mice, and used protein spectrum technology to analyze the protein expression level of alpha-fetoprotein (AFP) in the thymus tissues of healthy mice (normal thymus) and the thymus tissues of liver cancer mice (model thymus).

[0029] (F) The inventors collected thymus tissues from the above-mentioned healthy mice and liver cancer model mice, and used multiple fluorescent staining technology to analyze the expression and localization of alpha-fetoprotein (AFP) in the thymus tissues of healthy mice (normal thymus) and the thymus tissues of liver cancer mice (model thymus) (green), and used Epcam to mark thymic epithelial cells (red).

[0030] Figure 4 :Thymus removal inhibits tumor central immune escape and enhances CD8 T cell infiltration in liver cancer tissue. Among them: (A) The inventors injected 1×10 6 Orthotopic liver transplantation tumors were established by using Hepa1-6 cells. The thymus of mice was removed 7 days after modeling as the experimental group (thymectomy), and sham surgery was used as the control group (sham). The mice were euthanized on the 28th day after modeling.

[0031] (B) The inventors collected tumor-bearing liver tissues from the above model mice and took photos.

[0032] (C) The inventors conducted a statistical analysis of the ratio of tumor-bearing liver to mouse body weight in the above model mice.

[0033] (D) The inventors collected tumor-bearing liver tissues from the above model mice, and used immunofluorescence technology to detect and analyze the distribution of CD8 T cells in liver cancer tissues and adjacent tissues, and stained the cell nuclei with DAPI.

[0034] (E) The inventors conducted quantitative statistical analysis on the distribution of the above CD8 T cells in liver cancer tissues.

[0035] Figure 5 :The inhibitory effect of HY-133073 on mouse hepatocellular carcinoma. Among them: (A) The inventors injected 1×10 6 Orthotopic liver transplantation tumors were constructed by using Hepa1-6 cells. HY-133073 treatment was started by intraperitoneal injection 7 days after modeling. The solvent group was used as the control (vehicle). The mice were euthanized 28 days after modeling.

[0036] (B) The inventors collected tumor-bearing liver tissues from the above model mice and took photos.

[0037] (C) The inventors conducted quantitative statistical analysis on the weight of tumor-bearing liver in the above model mice.

[0038] (D) The inventors conducted quantitative statistical analysis on the liver tumor weight of the above model mice.

[0039] Figure 6 :The inhibitory effect of HY-133073 on central immune escape of mouse hepatocellular carcinoma. Among them: (A) The inventors injected 1×10 6 Orthotopic liver transplantation tumors were constructed by using Hepa1-6 cells. HY-133073 treatment was started by intraperitoneal injection 7 days after modeling. The solvent group was used as the control (vehicle). The mice were euthanized 28 days after modeling.

[0040] (B) The inventors collected tumor-bearing liver tissues from the above-mentioned model mice, and used immunofluorescence technology to detect and analyze the distribution of CD8 T cells (rose red) in thymus tissue, and used CD73 (green) to mark CD8 T cells homing to the thymus from the periphery (rose red and green co-localized to appear yellow).

[0041] (C) The inventors collected tumor-bearing liver tissues from the above model mice and used immunohistochemistry to detect the distribution of CD8 in liver cancer tissue (tumor, T) and para-tumor tissue (para-tumor, PT).

[0042] Figure 7 : Molecular structure formula of HY-133073 compound. DETAILED DESCRIPTION

[0043] In order to make the above features and advantages of the present invention more clearly understood, the following embodiments are given for detailed description. The methods of the present invention are all conventional methods in the art unless otherwise specified.

[0044] Example 1 The thymus upregulates the expression of CCL19 and CCL21 during liver cancer development.

[0045] For diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma model was induced by intraperitoneal injection of DEN (25 mg / kg body weight, Sigma-Aldrich) into 2-week-old C57BL / 6N mice. Six weeks later, mice were injected intraperitoneally with CCl 4 (2 ml / kg body weight, 1:4 v / v corn oil, Sigma-Aldrich) or corn oil twice a week for 12 weeks. Tissues were collected 2 weeks after the last injection. Mice were euthanized by cervical dislocation according to the AVMA Animal Euthanasia Guidelines (2020 edition).

[0046] For real-time quantitative PCR experiments, RNA samples were quantified using a Nanodrop 1000 spectrophotometer (ThermoScientific). 1 μg of RNA was reverse transcribed using random primers and MultiScribe reverse transcriptase (AppliedBiosystems). Gene expression analysis was performed using RT-qPCR. Briefly, 50 ng of complementary DNA was amplified using SYBR Green Master Mix (BioRad) and gene-specific primers on a CFX96 Real TimePCR detection system. The thermal cycling conditions were: 95ºC 30 s, 58ºC 30 s, 72ºC 30 s, for a total of 40 cycles. The expression levels of all samples were normalized to 18S RNA. The following specific primers were used to determine the mRNA expression level: Ccl19 – F: GGGGTGCTAATGATGCGGAA, Ccl19 – R: CCTTAGTGTGGTGAACACAACA; Ccl21 – F:GTGATGGAGGGGGTCAGGA, Ccl21 – R: GGGATGGGACAGCCTAAACT; Actb – F: GGCTGTATTCCCCTCCATCG, Actb – R: CCAGTTGGTAACAATGCCATGT. Example 2 When liver cancer occurs, activated CD8 T cells home to the thymus and die, thereby achieving central immune escape of the tumor.

[0047] For diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma model was induced by intraperitoneal injection of DEN (25 mg / kg body weight, Sigma-Aldrich) into 2-week-old C57BL / 6N mice. Six weeks later, mice were injected intraperitoneally with CCl 4 (2 ml / kg body weight, 1:4 v / v corn oil, Sigma-Aldrich) or corn oil twice a week for 12 weeks. Tissues were collected 2 weeks after the last injection. Mice were euthanized by cervical dislocation according to the AVMA Animal Euthanasia Guidelines (2020 edition).

[0048] For flow cytometry, thymic tissue was ground using a 70 μm cell sieve and a 1 ml syringe handle, cells were rinsed with phosphate buffered saline (PBS), centrifuged at 400 g for 5 minutes, and the supernatant was removed. Cell pellets were resuspended in PBS, CD16 and CD32 antibodies were added to block cells (ebioscience, 1:50 dilution), incubated at room temperature for 30 minutes, centrifuged at 400 g for 5 minutes, and the supernatant was removed. Cell pellets were resuspended in PBS, fluorescently labeled antibodies CD73-FITC, CD8-APC, and CD45-PerCP cy5.5 (ebioscience, 1:200 dilution) were added, incubated at room temperature for 30 minutes, centrifuged at 400 g for 5 minutes, and the supernatant was removed. Cells were fixed with 1% formaldehyde and stored in the dark at 4 degrees until flow cytometry.

[0049] For multiple fluorescent staining experiments, thymic tissue was embedded in OCT (Sakura), slowly frozen in liquid nitrogen, and stored in a -20°C freezer until sectioning. The frozen tissue was cut into 3 μm thick sections using a cryostat, and stained with CD8, CD73, granzyme B (GZMB)-specific primary antibodies and fluorescently labeled secondary antibodies (Alexa Fluor™ 647, Thermo Fisher Scientific) one by one, and images were obtained using an Olympus EvidenceIXplore SpinSR microscope. The antibodies were then eluted with 2-mercaptoethanol / SDS elution buffer, and then counterstained with other primary and secondary antibodies fluorescently labeled, and imaged using an Obvious IXplore SpinSR microscope to complete the cycle. For the detection of cell death signals, the standard method of the TUNEL staining kit (Yeasen Biotechnology) was used.

[0050] Example 3: Thymic epithelial cells take up alpha-fetoprotein when liver cancer occurs.

[0051] For diethylnitrosamine (DEN) combined with CCL 4 Spontaneous hepatocellular carcinoma model was induced by intraperitoneal injection of DEN (25 mg / kg body weight, Sigma-Aldrich) into 2-week-old C57BL / 6N mice. Six weeks later, mice were injected intraperitoneally with CCl 4 (2 ml / kg body weight, 1:4 v / v corn oil, Sigma-Aldrich) or corn oil twice a week for 12 weeks. Tissues were collected 2 weeks after the last injection. Mice were euthanized by cervical dislocation according to the AVMA Animal Euthanasia Guidelines (2020 edition).

[0052] For mRNA sequencing, the liver and thymus were perfused using a peristaltic pump and pre-chilled PBS buffer to remove all red blood cells in liver tissue, liver tumor tissue, and thymus. Total RNA of the samples was extracted using TRIzol (Invitrogen). Further mRNA sequencing was performed by Aksomics (Shanghai, China). In brief, mRNA was purified, fragmented, and converted into cDNA, followed by ligation of adapters / barcodes. Libraries quality-controlled by the Agilent Bioanalyzer 2100 system were sequenced using the Illumina NovaSeq6000 platform.

[0053] For protein profiling, liver and thymus were perfused with a peristaltic pump and pre-chilled PBS buffer to remove red blood cells from liver tissue, liver tumor tissue, and thymus. Samples were digested in trypsin solution and dried. Samples were analyzed by EASY-nLC 1200 (Thermo Fisher Scientific) coupled to Orbitrap Fusion Lumos (ThermoFisher Scientific) equipped with EASY-IC ion source. Peptides were dissolved in 10 μl 0.1% formic acid and automatically sampled on a C18 column (35cm × 75 μm id, 2.5 μm 100Å). Samples were eluted in 0.1% formic acid with a linear gradient of 3% to 35% acetonitrile for 120 min at a flow rate of 300 nl / min. Raw files were analyzed against the uniprot database using Proteome Discoverer 2.2 software.

[0054] Example 4 Thymus removal inhibits tumor central immune escape and enhances CD8 T cell infiltration in liver cancer tissue.

[0055] For the intrahepatic transplantation tumor model, C57BL6 / N male 7-8 week-old mice were purchased from Jicui Yaokang (hereinafter referred to as the same), and the mice were anesthetized with chloral hydrate. A 5 mm long window was opened on the right side of the mouse abdomen near the xiphoid process using ophthalmic scissors to expose the left liver lobe of the mouse. An insulin syringe was used to inject 1×10 6 Hepa1-6 liver cancer cells, then press with a cotton swab for 2-5 seconds to prevent tumor cells from spilling out of the liver, and use medical sutures to suture the surgical incision.

[0056] For post-thymectomy, 7 days after the above intrahepatic suppressive tumor modeling, the mice were anesthetized and fixed on a surgical board. To expose the thymus, a 2 mm incision was made at the base of the thoracic manubrium. The thymic lobe was grasped and removed with toothed forceps and then excised with ophthalmic scissors. Similarly, another group of mice underwent sham surgery. After 3 weeks, tumor-bearing livers were harvested. The thymectomized mice were examined at the end of the experiment to confirm the absence of thymic remnants.

[0057] For immunofluorescence detection of CD8 T cell distribution in mouse liver after thymectomy, liver cancer and adjacent tissues were embedded in OCT (Sakura brand), slowly frozen in liquid nitrogen, and stored in a -20 degree refrigerator until sectioning. The frozen tissue was cut into 3 μm thick sections using a cryostat, stained with CD8-specific primary antibody and fluorescently labeled secondary antibody (Alexa Fluor™ 647, Thermo Fisher Scientific), and DAPI was used to stain cell nuclei (Sigma-Aldrich), and images were obtained using Olympus's EvidenceIXplore SpinSR microscope.

[0058] Example 5 Inhibitory effect of HY-133073 on mouse hepatocellular carcinoma.

[0059] For the intrahepatic transplanted tumor model, C57BL6 / N male 7-8 week old mice were purchased from Jicui Yaokang (the same below), and the mice were anesthetized with chloral hydrate. Ophthalmic scissors were used to open a 5 mm long window near the xiphoid process on the right side of the mouse abdomen midline to expose the left liver lobe of the mouse. An insulin syringe was used to inject 1×106 Hepa1-6 liver cancer cells under the liver capsule, and then a cotton swab was used to press for 2-5 seconds to prevent tumor cells from overflowing from the liver. The surgical incision was sutured with medical sutures. HY-133073 was given intraperitoneally 7 days after modeling, with a dose of 25 μg per mouse (equivalent dose of 1 mg / kg). The mice were euthanized 28 days after modeling, and the tumor-bearing livers were collected, photos of the tumor-bearing livers were taken, and the weight of the tumor-bearing livers and liver tumors were counted.

[0060] Example 6 Inhibitory effect of HY-133073 on central immune escape of mouse hepatocellular carcinoma.

[0061] For the intrahepatic transplanted tumor model, C57BL6 / N male 7-8 week old mice were purchased from Jicui Yaokang (the same below), and the mice were anesthetized with chloral hydrate. Ophthalmic scissors were used to open a 5 mm long window near the xiphoid process on the right side of the mouse abdomen midline to expose the left liver lobe of the mouse. An insulin syringe was used to inject 1×106 Hepa1-6 liver cancer cells under the liver capsule, and then a cotton swab was used to press for 2-5 seconds to prevent tumor cells from overflowing from the liver. The surgical incision was sutured with medical sutures. HY-133073 was given intraperitoneally 7 days after modeling, with a dose of 25 μg per mouse (equivalent dose of 1 mg / kg). The mice were euthanized 28 days after modeling, and the thymus and tumor-bearing liver were collected.

[0062] For multicolor fluorescent staining of thymus tissue of intrahepatic transplanted tumor mice treated with HY-133073, thymus tissue was embedded in OCT (Sakura brand), slowly frozen in liquid nitrogen, and stored in a -20 degree refrigerator until sectioning. The frozen tissue was cut into 3 μm thick sections using a cryostat, and stained with CD8 and CD73 specific primary antibodies and fluorescently labeled secondary antibodies (AlexaFluor™647, Thermo Fisher Scientific) one by one, and DAPI was used to stain cell nuclei (Sigma-Aldrich), and images were obtained using Olympus's EvidenceIXplore SpinSR microscope. The antibodies were then eluted with 2-mercaptoethanol / SDS elution buffer, and then counterstained with other primary and secondary antibodies for fluorescent labeling, and imaged with Obvious IXploreSpinSR microscope to complete the cycle.

[0063] For immunohistochemical staining of liver tissues of mice with intrahepatic transplanted tumors treated with HY-133073, liver cancer and adjacent tissues were embedded in OCT (Sakura brand), slowly frozen in liquid nitrogen, and stored in a -20 degree refrigerator until sectioning. The frozen tissues were cut into 3 μm thick sections using a cryostat, stained with CD8-specific primary antibody and HRP-conjugated secondary antibody (CST, CellSignaling Technology), developed with DAB (CST, CellSignaling Technology), and then stained with hematoxylin (Sigma-Aldrich) for nuclei, and images were captured using a bright field microscope.

[0064] Combination Figure 1-Figure 6 , in DEN United CCL 4 In mice with spontaneous liver cancer induced by induced ... Figure 1). Furthermore, the inventors used flow cytometry and multiplex immunofluorescence techniques to find that the distribution of CD8 T cells that were double positive for CD73 and granzyme B (GZMB) increased in the thymus tissue of mice with liver cancer, which represented that mature CD8 T cells from the periphery had homed to the thymus, and TUNEL positivity indicated that these cells had died ( Figure 2 Furthermore, the use of mRNA sequencing (transcriptome) and protein spectrum analysis revealed that alpha-fetoprotein AFP was only upregulated at the transcriptional level in liver cancer tissues ( Figure 3 In B), there was no significant upregulation of transcription in thymus tissue ( Figure 3 Middle C), the protein level of alpha-fetoprotein AFP increased in liver cancer tissue and thymus tissue ( Figure 3 D and E), which indicates that the alpha-fetoprotein in the thymic tissue comes from outside the thymus, and the protein content is increased due to the internalization of the alpha-fetoprotein secreted by liver cancer. Using immunofluorescence experiments, the co-localization relationship between alpha-fetoprotein AFP and Epcam-positive thymic epithelial cells was found ( Figure 3 F in the middle further illustrates that the alpha-fetoprotein in the thymic tissue originates from ingestion. After CD8 T cells are exposed to alpha-fetoprotein in the periphery, they exhibit strong binding ability when they are exposed to the same antigen for the second time in the thymic medullary region. In immunological concepts, the thymus uses a negative selection mechanism to eliminate T cells that strongly bind to antigens presented by thymic epithelial cells to avoid the development and formation of autoreactive T cells. Therefore, this group of CD8 T cells homing to the thymus will be "killed by mistake" by the negative selection mechanism of the thymus, resulting in a decrease in anti-tumor CD8 T cells and central immune escape. Resection of the thymus can increase the infiltration of CD8 T cells in liver cancer tissue to a certain extent and inhibit the growth of liver cancer ( Figure 4 ), but this is not yet possible in clinical practice. In addition, since the thymus is the site of T cell development, the anti-cancer effect obtained by thymus removal will not be long-term. HY-133073 can simulate the principle and effect of surgical thymus removal, relying on its regulation of immune function, and significantly inhibit the growth of liver orthotopic transplanted tumors ( Figure 5 HY-133073 significantly inhibits central immune escape and enhances anti-cancer immunity, which is manifested by inhibiting the homing of CD73-positive mature CD8 T cells to thymic tissue ( Figure 6 B), and promote the distribution of CD8 T cells in liver cancer tissues ( Figure 6 Middle C).

[0065] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention should fall within the scope of the present invention.

Claims

1. Application of HY-133073 in the preparation of drugs for treating central immune escape of tumors.

2. The use according to claim 1, characterized in that: The tumor comprises liver cancer.

3. The use according to claim 1, characterized in that: The liver cancer includes primary hepatocellular carcinoma.

4. The use according to any one of claims 1 to 3, characterized in that: HY-133073 is used to prepare a pharmaceutical composition containing HY-133073 and a pharmaceutically acceptable carrier.

5. The use according to claim 4, characterized in that: The pharmaceutical composition contains 0.01%-99.99% of HY-133073, and the rest is a pharmaceutical carrier.

6. Application of HY-133073 in the preparation of drugs for treating hepatocellular carcinoma.

7. The use according to claim 6, characterized in that: The hepatocellular carcinoma includes primary hepatocellular carcinoma.

8. The use according to claim 6, characterized in that: HY-133073 is used to prepare a pharmaceutical composition containing HY-133073 and a pharmaceutically acceptable carrier.

9. The use according to claim 8, characterized in that: The pharmaceutical composition contains 0.01%-99.99% of HY-133073, and the rest is a pharmaceutical carrier.

10. The use according to claim 8, characterized in that: The structural formula of HY-133073 is as follows: 。

Images