EsVLRA protein as well as preparation method and application thereof

Abstract

The invention provides an EsVLRA protein and a preparation method and application thereof.The EsVLRA protein comprises an LRRNT structural domain, thirteen LRRs structural domains and an LRRCT structural domain, and meanwhile the C tail end of the EsVLRA protein further comprises a protruding ring structure; the method comprises the following steps: S1, obtaining a crab tissue sample; s2, carrying out RNA separation, cDNA synthesis and gene cloning on the EsVLRA gene; s3, inducing the EsVLRA gene to express an EsVLRA protein; the invention provides the EsVLRA protein, verifies that the EsVLRA protein can be combined with various bacteria and has an immune sensitization function, and provides a new protein for research and development of bacterial binding proteins and vaccines.

Description

Technical Field

[0001] The present invention relates to an EsVLRA protein and a preparation method and application thereof, and belongs to the field of biomedicine. Background Art

[0002] Bacterial binding proteins refer to a class of proteins that can bind to bacteria or specific molecules on the surface of bacteria. According to the search results, the following are several different types of bacterial binding proteins and their functions: ABC transporters: This is a superfamily of membrane proteins that is widely present in prokaryotes and eukaryotes. The main function is to use the energy generated by ATP hydrolysis to transport substrates across the membrane against the concentration gradient. They are involved in many important physiological processes, such as nutrient intake, cell detoxification, lipid homeostasis, signal transduction, viral defense, and antigen presentation. Bacterial DNA binding proteins: This type of protein plays an important role in the DNA replication process, participating in stabilizing the lagging strand and interacting with DNA polymerase III. They are also involved in all DNA-dependent functions, such as transcription, recombination, replication, etc., and maintain structural integrity. Penicillin binding proteins (PBPs): These are membrane proteins located on the bacterial cell membrane, enzymes involved in the biosynthesis of bacterial cell wall peptidoglycan, including transpeptidases, carboxypeptidases, and endopeptidases. Antibiotics such as penicillin inhibit the biosynthesis of bacterial cell walls by binding to PBPs, causing bacterial cell death and thus exerting a bactericidal effect. Phage receptor binding proteins (RBPs): Phages bind to the surface of bacteria through RBPs, a process that requires the participation of complex atomic structures and conformational changes. RBPs play a key role in the process of phage infection of bacteria and are key to studying phage biotechnology and optimizing phage biopharmaceuticals. Bacterial single-stranded DNA binding protein: Bacterial-encoded homo-oligomeric single-stranded (ss) DNA binding protein (SSB), which coats and protects ssDNA intermediates formed during genome maintenance reactions. Phage-derived bacterial binding protein-nanomagnetic beads: These proteins are used for specific separation and sensitive detection of foodborne pathogens. By binding to nanomagnetic beads, target bacteria can be quickly separated and enriched for on-site monitoring methods. Bacterial oligopeptide binding proteins: Depending on the bacterial species, these binding proteins capture peptides of varying sizes from the environment and deliver them to other components of the oligopeptide transport system for internalization. These bacterial binding proteins play an important role in bacterial physiological functions, drug action mechanisms, and biotechnology applications.

[0003] Immunogenic proteins are proteins that can trigger an immune response. Immunogenic protein-based vaccines use target antigens such as inactivated viral particles, virus-like particles, and protein subunits to trigger the host's immune defense.

[0004] In summary, bacterial binding proteins and immune sensitizing proteins have important medical value. Summary of the invention

[0005] The present invention provides an EsVLRA protein, and verifies that the EsVLRA protein can bind to a variety of bacteria and has an immune sensitization function, thereby providing a new protein for the research and development of bacteria-binding proteins and vaccines.

[0006] To achieve this object, the present invention provides the following technical solutions:

[0007] The first aspect of the present invention provides an EsVLRA protein, wherein the EsVLRA protein comprises an LRR_NT domain, thirteen LRRs domains and an LRR_CT domain, and also comprises a protruding loop structure at its C-terminus.

[0008] Preferably, the amino acid sequence of the EsVLRA protein is shown in SEQ ID NO.1.

[0009] In the present invention, the sequence of SEQ ID NO.1 is:

[0010] MSSTPTTTTHPCSPLTGGRLRPRWAWRLSGLAVFTLCLGVASRVPAGEAATPGSAGTQRGGRVEKTPIIVTIISNTTEVLAEGQLETTESSTKFTLFSEQNAGNFTLPDSKEEESLGSPSLENVSGGAKAMAGHAECVVETPFPPDDYEPPMYQCPDADSFWMLGTQLGDQRVSVRVAKVNGGLALPPTASLKLVGLDLQQTNTTHFINLSQALTSLESLHLDGNPDFDASSLLQLGQLPSLNTLQLAGSAQTTLSGNLWQLLKGMPSLQVLYVSSTGLHHLPLDTFQQNPKLQILEIGGNEFISIIFDQGLIQQLTRLNISGCHLKNLEIEVKSAEASQTQHLSIDLSKNHLTSLPASFMNYVTKNFVHLNIKDNLWNESCKVCSLYHLWRYGTDHSDRVDGAQNVNCFQREEALKSCGWEECPSPCTCDAETKTVDCRNTGLMAVPHVAPSNAAVLLLENNSLFDMRGIESPVWCNLNMVNADNNRMTAIIPPDAVGKGTCTCFDDDEFYEEEWDCYPQSLKKLSLSHNKIKNLSHSDCHLLYSLEELHLSGNEVKHLGSHVCSSFQHLEVLSLDHNRYNDLKEEDVAPYPKLRKLNISFNYLPTLPYRILELMPKLTVLDVSNNRLRQLSENTSTPDTPFTSSVSSLLEKLDFSNNSLELIKPVLSLKQIPFLKKLSLDNNPWQCSCETIKDLAVKVFEELKRMAMVKAVQTIRCHQPADLKDVLINDPRALQICEEAESSTNVFSAVVGTMIILAFIGFMVYLACKKSSAYVRNELNMSTSCDETFREVQCGCGP。

[0011] Preferably, the EsVLRA protein is derived from Eriocheir sinensis.

[0012] In the present invention, the EsVLRA protein is a 799 amino acid long protein. It includes an LRR_NT domain, thirteen LRRs domains and an LRR_CT domain, and an obvious protruding loop structure is found at its C-terminus. Multiple sequence alignment analysis of the amino acid sequence shows that EsVLRA has a consistent and conservative amino acid sequence composition with VLRA of other species.

[0013] The second aspect of the present invention provides a method for preparing EsVLRA protein, comprising the following steps:

[0014] S1. Obtain crab tissue samples;

[0015] S2, RNA isolation, cDNA synthesis and gene cloning of EsVLRA gene;

[0016] S3. Induce EsVLRA gene to express EsVLRA protein.

[0017] Preferably, the crab is Eriocheir sinensis, and the tissues are heart, muscle, hepatopancreas, gill and gonad tissues.

[0018] In the present invention, the mRNA expression of EsVLRA was detected in all the blood cells, heart, muscle, hepatopancreas, gills and gonad tissues tested, among which the mRNA expression level was high in the hepatopancreas, gonads and gills. It is worth noting that the expression of EsVLRA in the hepatopancreas, gonads, gills and brain of male crabs was significantly higher than that of female crabs.

[0019] Preferably, the PCR reaction system for isolating RNA of the EsVLRA gene in step S2 includes dNTP, Taq Buffer, r-Taq, a primer EsVLRA_F having a nucleotide sequence of SEQ ID NO.2, and a primer EsVLRA_R having a nucleotide sequence of SEQ ID NO.3, and the reaction procedure includes: 94°C, 3min, and then entering a cycle process: 94°C, 30s, 50°C, 50s, 72°C, 2min45s, for 34 cycles.

[0020] In the present invention, the sequence of SEQ ID NO.2 is: ATGAGCTCTACTCCCACGACCACCA;

[0021] In the present invention, the sequence of SEQ ID NO.3 is: TCATGGACCACAACCACATTGTACC.

[0022] Preferably, step S3 comprises inducing expression with an inducer, isopropyl-β-D-thiogalactosidase IPTG, at 28-30° C. for 10-12 h.

[0023] The third aspect of the present invention provides the use of the EsVLRA protein of the present invention in the preparation of bacteria-binding protein products.

[0024] Preferably, the bacteria include Micrococcus luteus, Staphylococcus aureus, Vibrio parahaemolyticus, Pseudomonas aeruginosa and Pichia pastoris.

[0025] In the present invention, the recombinantly expressed rEsVLRA can strongly bind to Gram-negative bacteria Vibrio parahaemolyticus and Pseudomonas aeruginosa, Gram-positive bacteria Micrococcus luteus and Staphylococcus aureus, and Pichia pastoris, but does not show any antibacterial activity, indicating that EsVLRA mainly participates in immune recognition as a receptor of pathogenic microorganisms.

[0026] The fourth aspect of the present invention provides the use of the EsVLRA protein of the present invention in the preparation of immunosensitizing protein products.

[0027] In the present invention, the immune sensitization test found that when healthy crabs were stimulated by formaldehyde-inactivated Vibrio parahaemolyticus, they first showed a significant increase at the 3rd hour (P<0.05); after the second injection of live bacteria, the expression of EsVLRA was significantly upregulated at the 1st hour after injection, and the expression level was much higher than that of the first injection (about 50 times the first peak, P<0.01); the highest expression level appeared at the 6th hour after the second attack (about 240 times the first peak, P<0.01), and this significant high expression level continued until the 48th hour (P<0.01). It shows that EsVLRA may have memory for pathogen stimulation.

[0028] Compared with the prior art, the beneficial effects and significant progress of the technical solution of the present invention are as follows: the present invention extracts a new EsVLRA protein from the Chinese mitten crab, and the experiments of the present invention prove that the recombinantly expressed rEsVLRA can strongly bind to Gram-negative bacteria Vibrio parahaemolyticus and Pseudomonas aeruginosa, Gram-positive bacteria Micrococcus luteus and Staphylococcus aureus, and Pichia pastoris; the immune sensitization test proves that the EsVLRA protein is an immune sensitization protein, and EsVLRA may have memory for pathogenic stimulation. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solution of the present invention, the drawings used in the embodiments of the present invention are briefly introduced below.

[0030] Figure 1The nucleotide sequence and deduced amino acid sequence of EsVLRA of Example 2, wherein, (A) Sequence analysis of the ORF and deduced amino acid sequence of EsVLRA: the nucleotide numbers are shown on the right. The putative signal peptide, LRR_NT, LRR1, LRR domain, LRR_CT, transmembrane domain and low complexity region are shown in red, pink, blue, green, light blue, yellow and grey shades, respectively. (B) Putative domains of EsVLRA protein: the mature protein contains LRRNT domain, 13 LRR domains, LRRCT domain, signal peptide and transmembrane region. (C) Transmembrane region of EsVLRA: the highest probability of the transmembrane region is indicated in red at the C-terminus;

[0031] Figure 2 The multiple alignment result diagram of the LRR domain of the EsVLR protein of Example 2, wherein the blue shading indicates the same amino acid residues. The pink shading indicates less conserved residues. The light blue shading indicates some similar residues;

[0032] Figure 3 This is a diagram showing the phylogenetic analysis results of EsVLRA in Example 2;

[0033] Figure 4 This is a comparative analysis result diagram of the three-dimensional structure predicted by EsVLRA in Example 2;

[0034] Figure 5 This is a graph showing the relative tissue expression results of EsVLRA in different tissues in Example 3;

[0035] Figure 6 This is a diagram showing the SDS-PAGE analysis results of rEsVLRA in Example 4;

[0036] Figure 7 This is a graph showing the bacterial binding activity results of rEsVLRA in Example 6;

[0037] Figure 8 It is the experimental flow chart of Example 7;

[0038] Fig. 9 This is a graph showing the mRNA expression pattern of EsVLRA during the immune sensitization process of Example 7. DETAILED DESCRIPTION

[0039] The present invention is further described below in conjunction with specific examples. The examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. In addition, it should be understood that after reading the content of the present invention, those skilled in the art can make various changes and modifications to the present invention, and these equivalent forms also fall within the scope limited by the appended claims of the application.

[0040] In order to more fully understand the present invention, the professional terms in the present invention are explained below.

[0041] The present invention is further described in detail below with reference to specific embodiments.

[0042] Example 1

[0043] 1.1. Healthy Chinese mitten crabs (70±5g) were temporarily cultured in 140L water tanks (5-7 crabs per tank) with filtered fresh water at 15±2℃. During the culture period, the water was continuously aerated and fed with clams (2 per crab) once every evening. The water was cleaned and changed the next morning. After one week of culture, the experiment was carried out.

[0044] 1.2. Sample preparation for VLRA tissue distribution experiment

[0045] Hemolymph was extracted from the last leg with an equal volume of ice-cold anticoagulation buffer (27 mM sodium citrate, 336 mM NaCl, 115 mM glucose, 9 mM EDTA, pH = 7.0), and then immediately centrifuged at 800 g, 4 ° C for 5 min to separate blood cells. Six healthy adult male crabs and six females were dissected to collect heart, muscle, hepatopancreas, intestine, brain, ovary and testis. The collected tissues were placed in 1.5 mL centrifuge tubes, passed through liquid nitrogen, and stored in a -80 ° C refrigerator.

[0046] 1.3 RNA isolation, cDNA synthesis and gene cloning of EsVLRA

[0047] Total RNA was extracted using the TRIzol reagent method according to the reagent instructions (Invitrogen). The concentration of RNA was measured using Nanodrop (Thermo). cDNA was synthesized using the PrimeScriptTM RT kit with random hexamer primers (Takara, Dalian, China). To amplify the open reading frame (ORF) of EsVLRA, a pair of gene-specific primers EsVLRA_F and EsVLRA_R were designed based on the single gene sequence obtained from the hepatopancreas transcriptome data (sequence information is shown in Table 2). PCR amplification was performed using the hepatopancreas cDNA library plasmid as a template, and the amplification system is shown in Table 1 below.

[0048] Table 1

[0049] Reagents volume 10×Taq Buffer 2.5μL dNTP(10mM) 0.5μL Primer F (5 mM) 0.75μL Primer R (5 mM) 0.75μL Template (about 30ng) 1μL r-Taq 0.2μL <![CDATA[ddH2O]]> 19.3μL

[0050] The PCR program was: 94°C for 3 min, followed by a cycle of 94°C for 30 s, 50°C for 50 s, 72°C for 2 min, 45 s, 34 cycles, and finally an extension at 72°C for 10 min. The PCR product was gel purified and cloned into the pMD19-T vector (TaKaRa). After transformation into competent cells of E. coli DH5α, positive recombinants were identified by anti-Amp selection medium and PCR screening using M13-47 and RV-M primers. Three positive clones were sequenced, and the ORF of EsVLRA was obtained by overlapping two fragments.

[0051] Table 2

[0052]

[0053] Note: The restriction sites for Bam HI and Xho I are underlined.

[0054] Example 2 Sequence and phylogenetic analysis

[0055] The deduced amino acid sequence was analyzed using the Protein Analysis System (http: / / www.expasy.org / ); SMART (http: / / smart.embl-heidelberg.de / ) and NCBI's sequence alignment program BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi / ) were used to predict the structural and functional domain proteins of EsVLRA; the ProtParam tool in ExPASy (http: / / prosite.expasy.org / ) was used to predict the molecular weight (Mw) and theoretical isoelectric point (pI) of the protein; signal peptide prediction was performed in SignalP 4.1 (http: / / www.cbs.dtu.Dk / services / SignalP / ); transmembrane region prediction was performed in TMHMM Server v.2.0 (http: / / www.cbs.dtu.dk / services / TMHMM / ); hydrophobicity and hydrophilicity analysis was performed using Protparam (http: / / web.expasy.org / protparam / ); Psort II (http: / / psort.hgc.jp / form2.html) was used to predict subcellular localization.

[0056] The three-dimensional structural model was established by SWISS-MODEL (https: / / swissmodel.expasy.org / ); the multiple sequence alignment of EsVLRA with other known VLRs proteins was performed using the CLUSTALW program packaged in DNAMAN 8.0 software.

[0057] Phylogenetic analysis was performed using MEGA 7.0 software using the Negative Joint (NJ) algorithm.

[0058] The EsVLRA protein sequence is SEQ ID NO. 1. The sequence analysis results are shown in Figure 1 As shown, the ORF length of EsVLRA is 2400 bp, encoding a 799 amino acid long protein with a predicted molecular weight of 88.19 kDa and a theoretical isoelectric point of 5.32 ( Figure 1 A). One LRR_NT domain, thirteen LRRs domains and one LRR_CT domain were observed in the deduced protein sequence ( Figure 1 B) EsVLRA has a putative 49 amino acid residue signal peptide at its N-terminus and a predicted transmembrane helix at its C-terminus ( Figure 1 B and 1C). The protein was predicted to be likely hydrophilic (mean hydrophilicity: -0.207) and likely to be located in the extracellular matrix (34.8% probability).

[0059] The results of multiple sequence alignment analysis of amino acid sequences are shown in Figure 2 As shown in the figure, blue shading indicates identical amino acid residues. Pink shading indicates less conserved residues. Light blue shading indicates somewhat similar residues. The species and GenBank accession numbers are as follows: AjVLRA, Sashimi, AIP87048.1; LcVLRA, Japanese lamprey, BAJ14924.1; LpVLRA, Lamprey, AGS42623.1; PmVLRA, Sea lamprey, ABO21293.1; EsVLRB, Hagfish, ABB59046.1; EbVLRB, Hagfish, BAI66956.1; PmVLRB, Sea lamprey, ABO15218.1; LcVLRB, Arctic lamprey, BAJ14925.1; PmVLRC, Sea lamprey, AGJ51136.1; LcVLRC, Arctic lamprey, BAJ41478.1; LpVLRC, Lamprey, AGS42900.1. These results indicate that the amino acid sequence of EsVLRA in Eriocheir sinensis is conserved.

[0060] The results of phylogenetic analysis are as follows Figure 3As shown, the numbers in the branches in the figure represent the calculated values ​​(%) from 1000 repetitions; the species and GenBank number are shown in the tree; EsVLRA in E. sinensis has been highlighted by "▲". It shows that the topology of the tree is divided into three branches: VLRA, VLRB and VLRC. EsVLRA and VLRAs are clustered together, indicating that the VLR in Chinese mitten crab is a new member of the VLRAs family.

[0061] The results of three-dimensional (3D) structural modeling are as follows Figure 4 As shown, the crystal structures of lamprey VLRA (ID: 3M18), VLRB (ID: 3E6J) and VLRC (ID: 4PO4) retrieved from the Protein Data Bank (PDB). The red arrow in the figure indicates the protrusion located at the C-terminal leucine-rich repeat sequence (LRRCT) of EsVLRA, lamprey VLRA and VLRB, but no obvious protrusion loop was found in the LRRCT region of lamprey VLRC. This indicates that EsVLRA has an α-helical structure and is likely to form a protruding loop in its LRCCT region. This is consistent with the protrusion structure in lamprey VLRA, indicating its potential antigen binding ability.

[0062] Example 3 Real-time quantitative PCR analysis of EsVLRA

[0063] Experimental methods

[0064] Real-time quantitative PCR (qRT-PCR) was used to study the tissue expression pattern of EsVLRA (sequence information is shown in Table 2). SYBR green II (TaKaRa, Japan) was used as a fluorescent dye and the reaction was performed on an ABI PRISM 7300 sequence detection system (Applied Biosystems, USA). β-actin was selected as a reference gene for internal standardization. The reaction system of PCR in this example is shown in Table 3 below.

[0065] Table 3

[0066] cDNA 4μL Primer-RTF 0.2μL Primer-RTF 0.2μL 2×SYBR Premix Ex Taq 5μL 50×ROX Reference Dye II 0.2μL <![CDATA[RNase-free H2O]]> 0.4μL

[0067] The qRT-PCR program was performed at 95°C for 5 min, followed by 40 cycles of 95°C for 5 s and 60°C for 31 s. Dissociation curve analysis of the amplified products was performed at the end of each PCR reaction to confirm that only one PCR product was amplified, and each qRT reaction was repeated 3 times. All samples were repeated in triplicate in the qRT-PCR analysis. After the PCR program, the data were analyzed using ABI7500 SDS2.0 software. The fold change of gene expression relative to the control was determined by the 2-△△Ct method (Livak and Schmittgen, 2000). The results were subjected to one-way analysis of variance using SPSS19.0, and P values ​​less than 0.05 or 0.01 were considered statistically significant.

[0068] Experimental Results

[0069] The results are as follows Figure 5 As shown, the EsVLRA mRNA levels (relative to EsActin) between different tissues were compared, with the heart expression level as the standard. The vertical bars represent the mean ± SD (N = 6). It can be seen that the mRNA transcription of EsVLRA was detected in all tissues examined, including blood cells, heart, muscle, hepatopancreas, gills and gonads. EsVLRA had high expression levels in the hepatopancreas, gonads and gills, while the lowest expression levels were detected in the heart of male and female crabs. In addition, the expression of EsVLRA in the hepatopancreas, gonads, gills and intestines of male crabs was significantly higher than that of female crabs (P < 0.01).

[0070] Example 4

[0071] Experimental methods

[0072] 4.1 Construction of recombinant plasmid

[0073] The sequence encoding the mature peptide of EsVLRA was amplified using the VLR specific primers EsVLRA_PF and EsVLRA_PR (sequence information is shown in Table 2). The PCR reaction system of this example is shown in Table 4 below.

[0074] Table 4

[0075] 10×Taq Buffer 2.5μL dNTP(10mM) 0.5μL Primer F (5 mM) 0.75μL Primer R (5 mM) 0.75μL Template (about 30ng) 1μL r-Taq 0.2μL <![CDATA[ddH2O]]> 19.3μL

[0076] The PCR program was: 94°C for 3 min, followed by a cycle of 943°C for 30 s, 50°C for 50 s, and 72°C for 2 min 45 s for 34 cycles, followed by a final extension at 72°C for 10 min. The PCR products were analyzed by 1% agarose gel electrophoresis and purified by a PCR purification kit (Axygen). The purified PCR products were cloned into the pMD19-T simple vector (TaKaRa) and then sequenced to ensure the correct coding sequence.

[0077] The recombinant plasmid containing the PCR product or the pET-32a(+) vector was digested with restriction enzymes BamHI and XhoI (NEB), and the PCR product was then inserted into the pET-32a(+) vector. Then, the recombinant plasmid (pET-32a-EsVLRA) was transformed into competent cells of Escherichia coli BL21(DE3)-pLysS (TransGen) for overexpression. The pET-32a(+) vector without an insert was selected as a negative control, which can only express thioredoxin (Trx) with a 6×His-tag in a prokaryotic expression system.

[0078] 4.2 Expression and purification of recombinant EsVLRA

[0079] After inducing expression with 1 mM isopropyl-β-D-thiogalactosidase (IPTG) at 28°C for 10 hours, the bacterial pellet was collected by centrifugation at 8000g for 15 min at 4°C and resuspended in buffer I (50 mM sodium phosphate, 300 mM NaCl, pH = 7.0), and then sonicated at 4°C for 30 min. The inclusion bodies were washed once with buffer I, washed twice with buffer II (50 mM sodium phosphate, 300 mM NaCl, 2 M urea, pH = 7.0), and dissolved in buffer III (50 mM sodium phosphate, 300 mM NaCl, 8 M urea, pH = 7.0). The recombinant protein and negative control sample (rTrx) were purified by cobalt affinity chromatography (Clontech) under denaturing conditions.

[0080] The purified protein was refolded in a gradient urea-TBS glycerol buffer (50 mM Tris-HCl, 50 mM NaCl, 10% glycerol, 1% glycine, 1 mM EDTA, 0.2 mM oxidized glutathione, 2 mM reduced glutathione, 6, 4, 3, 2, 0 mM urea pH = 8.0, each gradient was kept at 4 ° C for 6-8 h. The resulting protein was separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and developed with Coomassie Brilliant Blue R250. The concentration of the recombinant protein was measured by a BCA protein assay kit (Beyotime).

[0081] Experimental Results

[0082] like Figure 6As shown in the figure, Lane M: protein standard; Lane 1: negative control without IPTG induction; Lane 2: recombinant protein induced by IPTG; Lane 3: purified recombinant protein; Lane 4: rTrx induced by IPTG. It can be seen that the recombinant plasmid pET-32a-EsVLRA was transformed into Escherichia coli BL21(DE3)-pLysS and expressed under the action of IPTG. The induced rEsVLRA was expressed as an insoluble protein and accumulated in the inclusion bodies containing the His tag and thioredoxin tag expressed by the pET-32a(+) plasmid, and then separated from the purified inclusion bodies using 8M urea, and the recombinant protein was renatured and purified ( Figure 6 , lane 3). At the same time, pET-32a vector was used to induce transformation, and a unique 20 kDa expression product Trx ( Figure 6 , Lane 4). The concentration of rEsVLRA protein was 1.86 mg / mL.

[0083] Example 5 Antibacterial Activity Determination

[0084] Experimental methods

[0085] In this study, the antibacterial activity of two Gram-negative bacteria, Vibrio parahaemolyticus and Pseudomonas aeruginosa, two Gram-positive bacteria, Micrococcus and Staphylococcus aureus, and one fungus, Pichia pastoris, was determined using the liquid phase bacterial culture method (Rathinakumar et al., 2009). Briefly, bacteria and yeast were grown to mid-log phase on TSB, LB or YPD medium and diluted to 103CFU / mL with Tris-HCl buffer (50mM, pH=8.0). In a sterile 96-well plate, 50μL of recombinant protein was added to the wells in a 1 / 2-fold serial dilution with 50mM Tris-HCl buffer (pH=8.0). Wells with 50μL Tris-HCl buffer and 50μL Tris-HCl buffer (pH=8.0) diluted rTrx were used as blank controls and negative controls, respectively. Then 50μL of cell suspension (103CFU / mL) was added to the wells and mixed. After 2 hours, 100 μL of the corresponding culture medium was injected into the wells, and the 96-well plates containing Micrococcus luteus and Pichia pastoris were incubated at 28°C, and the plates containing Vibrio parahaemolyticus, Pseudomonas aeruginosa and Staphylococcus aureus were incubated at 37°C. Add the culture medium and incubate overnight at the appropriate temperature. The absorbance of Gram-positive bacteria at 600 nm or Gram-negative bacteria and fungi at 560 nm in each well was measured using a precision microplate reader, and three replicates were set for each experimental group. The minimum antimicrobial concentration (MIC) value is expressed as the range between the highest concentration of protein at which microbial growth is observed and the lowest concentration at which 100% inhibition of microbial growth occurs (Song et al., 2013).

[0086] Experimental Results

[0087] As shown in the table below, the antibacterial activity of recombinant EsVLRA against Gram-positive bacteria, Gram-negative bacteria and yeast was tested in this study. However, no significant antibacterial activity of rEsVLRA was observed.

[0088] Table 5 Minimum inhibitory concentration (MIC) of rEsVLRA

[0089]

[0090] Example 6 Determination of Bacteria Binding Activity

[0091] Experimental methods

[0092] The above-mentioned Gram-positive bacteria, Gram-negative bacteria and yeast in the logarithmic growth phase were gently shaken for 1 hour at 37°C and fixed with 37% formaldehyde to destroy the protease activity of the microorganisms. An equal volume of cell suspension (0.5mL, 3×108CFU / mL) was mixed with sterile 0.1M phosphate buffer (PBS, pH=7.4) and purified protein (final concentration, 1mg / mL protein) and gently shaken and incubated (4°C, 30min). After centrifugation at 800g and 4°C for 5min, the supernatant was removed and the cells were washed twice with PBS. The bound protein was then eluted with 1×SDS-PAGE sample loading buffer, and the microorganisms incubated with PBS were set as controls. The components of the supernatant, washing solution and eluate were electrophoresed on 15% (w / v) SDS-PAGE.

[0093] Experimental Results

[0094] The results are as follows Figure 7 As shown in the figure, the binding activity of recombinant EsVLRA to Gram-positive bacteria (1) Micrococcus luteus and (2) Staphylococcus aureus, Gram-negative bacteria (3) Vibrio parahaemolyticus and (4) Pseudomonas aeruginosa and (5) Pichia pastoris. rEsVLRA was incubated with formaldehyde-fixed microorganisms. After incubation, the supernatant was separated by centrifugation, the precipitate was washed with PBS buffer, and the bound protein was eluted with SDS-PAGE sample loading buffer. The protein components in the supernatant, eluate and washing solution were detected by SDS-PAGE.

[0095] Bacterial binding analysis showed that rEsVLRA was found in the eluate fraction, while no target protein band was detected in the supernatant or washing fluid ( Figure 7 The experimental results showed that rEsVLRA could strongly bind to Gram-negative bacteria Vibrio parahaemolyticus and Pseudomonas aeruginosa, Gram-positive bacteria Micrococcus luteus and Staphylococcus aureus, and Pichia pastoris.

[0096] Example 7 Vaccination and secondary stimulation experiment

[0097] Experimental methods

[0098] Vaccination and immunostimulation tests were performed according to the methods of Powell et al. (2011) with some modifications. Healthy Chinese mitten crabs were raised in filtered fresh water (16°C) and fed clams once a day in the evening for one week before immunostimulation tests. During the vaccination phase, Vibrio parahaemolyticus grown in TSB (+2% NaCl) in the logarithmic growth phase was centrifuged at 800g, 4°C for 10 min and then washed three times with sterile PBS (pH = 7.4). The bacteria were inactivated with 2% formaldehyde at 4°C overnight and then washed extensively in sterile PBS. The sterility of the formalin-inactivated bacterial suspension was verified by plating on tryptic soy agar (+2% NaCl) and incubating at 37°C for 48 hours.

[0099] like Figure 8 As shown, during the first injection “vaccine” experiment, 70 crabs were injected with 50 μL of inactivated Vibrio parahaemolyticus suspension (1×10 8 CFU / mL, called Va group), and the control group was injected with an equal volume of sterile PBS (named PBS group). At 0, 3, 12, and 36 h after injection, 6 crabs from the Va group or the control group were randomly sampled to collect blood cells. 168 h after the initial immunization, 42 crabs in the Va group were injected with 50 μL of live Vibrio parahaemolyticus (called Va-Vp group), and the control group was injected with 50 μL PBS (called PBS). At each time point after injection (1, 3, 6, 12, 24, and 48 h), six crabs were randomly sampled to collect blood cells. After sampling, the blood cells were frozen in liquid nitrogen and stored at -80 °C for further RNA isolation. qRT-PCR was performed for the expression level of EsVLRA.

[0100] Experimental Results

[0101] After injection of formalin-killed Vibrio parahaemolyticus, crabs showed a higher survival rate (survival rate after 7 days was 90.2-100%), and no significant survival difference was found between the immunized group and the control group (Kaplan-Meier survival analysis). This result shows that the killed Vibrio parahaemolyticus will not cause fatal damage to crabs.

[0102] like Fig. 9As shown, after the second injection of live bacteria (Va-Vp group), the expression of EsVLRA was upregulated and was much higher than the expression level at the first injection (Va group). The highest level appeared at the 6th hour after the attack of Vibrio parahaemolyticus, and this high expression level continued until 24h and 48h, but was still significantly higher than that of the control group. There was no significant change in the expression of EsVLRA in the control group. Specifically, during the vaccination phase, the relative expression of EsVLRA transcripts in the Va group was slightly upregulated at 3h compared with the PBS group (P<0.05). During the challenge phase, after the injection of Vibrio parahaemolyticus, the expression levels were significantly upregulated at 1h (49.8-fold, P<0.01), 3h (148.3-fold, P<0.01), and 6h (240.6-fold, P<0.01) compared with the control group. This state was maintained until the 48th hour of detection.

[0103] The applicant declares that, in the description of the above specification:

[0104] The descriptions of the terms "this embodiment", "an embodiment of the present invention", "as shown in...", "further", "a further improved technical sub-scheme", etc., mean that the specific features, structures, materials or characteristics described in the embodiment or example are included in at least one embodiment or example of the present invention; in this specification, the schematic expressions of the above terms are not necessarily for the same embodiment or example, and the specific features, structures, materials or characteristics described may be combined or combined in a suitable manner in any one or more embodiments or examples; in addition, a person of ordinary skill in the art may combine or combine the different embodiments or examples and the features of the different embodiments or examples described in this specification without causing any contradiction.

[0105] Finally, it should be noted that:

[0106] The above embodiments are only used to illustrate the technical solutions of the present invention, but not to limit them.

[0107] Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some or all of the technical features therein, and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention. The non-essential improvements, adjustments or replacements made by those skilled in the art based on the contents of this specification are all within the scope of protection required by the present invention.

Claims

1. An EsVLRA protein, characterized in that The EsVLRA protein includes an LRR_NT domain, thirteen LRRs domains and an LRR_CT domain, and also includes a protruding loop structure at its C-terminus.

2. An EsVLRA protein according to claim 1, characterized in that: The amino acid sequence of the EsVLRA protein is shown in SEQ ID NO.

1.

3. An EsVLRA protein according to claim 1, characterized in that: The EsVLRA protein is derived from Chinese mitten crab.

4. A method for preparing EsVLRA protein, characterized in that: The following steps are involved: S1. Obtain crab tissue samples; S2, RNA isolation, cDNA synthesis and gene cloning of EsVLRA gene; S3. Induce EsVLRA gene to express EsVLRA protein.

5. The method for preparing an EsVLRA protein according to claim 3, characterized in that: The crab is Chinese mitten crab, and the tissues are heart, muscle, hepatopancreas, gill and gonad tissues.

6. The method for preparing the EsVLRA protein according to claim 3, characterized in that: The PCR reaction system for RNA isolation of the EsVLRA gene in step S2 includes dNTP, Taq Buffer, r-Taq, primer EsVLRA_F with a nucleotide sequence of SEQ ID NO.2, and primer EsVLRA_R with a nucleotide sequence of SEQ ID NO.

3. The reaction program includes: 94°C, 3min, and then enters a cycle process: 94°C, 30s, 50°C, 50s, 72°C, 2min 45s, and continues for 34 cycles.

7. The method for preparing EsVLRA protein according to claim 3, characterized in that: Step S3 includes inducing expression with an inducer, isopropyl-β-D-thiogalactosidase IPTG, at 28-30° C. for 10-12 hours.

8. Use of the EsVLRA protein according to any one of claims 1 to 2, or the EsVLRA protein prepared by the method according to any one of claims 3 to 7 in the preparation of a product of bacteria-binding protein.

9. The use according to claim 8, characterized in that The bacteria include Micrococcus luteus, Staphylococcus aureus, Vibrio parahaemolyticus, Pseudomonas aeruginosa and Pichia pastoris.

10. Use of the EsVLRA protein according to any one of claims 1 to 2, or the EsVLRA protein prepared by the method according to any one of claims 3 to 7 in the preparation of immunosensitizing protein products.

Images