Nucleic acid product, kit and sequencing method for constructing single cell whole genome sequencing library

Abstract

The invention relates to a nucleic acid product for constructing a single cell whole genome sequencing library, the nucleic acid product comprises a random primer, the random primer comprises a sequence as shown in SEQ ID No.1, and the random primer has 5'end phosphorylation modification; wherein the SEQ ID NO. 1 is GAGTGTGAGGGATGGAGATGTGTAGTGNNNNNKKKK, and the SEQ ID NO. 2 is shown as SEQ ID NO. The nucleic acid product is used for constructing a single-cell whole genome sequencing library, the comparison rate and the coverage degree of the single-cell whole genome sequencing library are improved, and the CV value of the sequencing library is reduced; furthermore, the coverage degree and the uniformity of single cell whole genome sequencing data are improved, and the quality of the sequencing data is improved.

Description

Technical Field

[0001] The present application relates to the field of gene detection technology, and in particular, to a nucleic acid product, a kit and a sequencing method for constructing a single-cell whole genome sequencing library. Background Art

[0002] Single cells are the basic units of multicellular organisms. The continuous differentiation of mature organisms during development leads to great differences between cells, especially tumor tissues. The high heterogeneity of tumor tissues requires that related research be carried out at the single-cell level.

[0003] The traditional single-cell whole genome sequencing method is to amplify the trace whole genome DNA of isolated single cells, obtain a complete genome with high coverage, and then sequence it. It is widely used in research on cancer, embryonic development, assisted reproduction, cell differentiation, immune mechanisms, microorganisms, etc.

[0004] Currently, common single-cell whole genome amplification methods include degenerate oligonucleotide primer PCR (DOP-PCR, Degenerate Oligonucleotide–Primed Polymerase Chain Reaction), multiple displacement amplification (MDA, Multiple Displacement Amplification), multiple annealing and looping-based amplification (MALBAC, Multiple Annealing and Looping–Based Amplification Cycles), etc. Among them, the 3' end of the primer used in degenerate oligonucleotide primer PCR contains a 6bp random sequence, which can randomly bind to genomic DNA to achieve amplification of the whole genome. However, due to the exponential amplification characteristics of PCR, the differences between different sequences on the genome are amplified, resulting in low coverage of the amplified genome.

[0005] The MDA method uses random hexamer primers and The polymerase has a strong chain displacement property and can amplify 50-100kb DNA fragments under isothermal conditions. At the same time, due to its 3'-5' exonuclease activity and proofreading activity, DNA polymerase has high replication fidelity. MDA method has higher genome coverage than DOP-PCR. The high efficiency and high fidelity of DNA polymerase make the MDA method have significant advantages in the analysis of DNA single nucleotide site variation (SNV) and the construction of large fragment libraries. However, like DOP-PCR, the MDA method is still exponential amplification, so there is still sequence preference in the PCR reaction. Moreover, unlike DOP-PCR, this preference cannot be repeated, so the MDA method is not suitable for the analysis of DNA copy number variation (CNV).

[0006] The 5' end of the MALBAC amplification primer contains a 27bp common sequence, and the 3' end is an 8bp random sequence, which can bind to the template at a low temperature of 15-20°C. After 8-12 cycles of quasi-linear amplification, these circular amplicons are exponentially amplified. The quasi-linear amplification process of the MALBAC method reduces the sequence preference of exponential amplification. Its advantage is that, unlike the MDA method, the preference of MALBAC is repeatable between different cells. Therefore, CNV analysis can be performed after standardization of reference cells; in addition, due to the uniformity of MALBAC amplification, the knockout rate of alleles amplified by this method is lower. The weakness of MALBAC is that the polymerase it uses has lower fidelity than MDA. Therefore, MALBAC will have more false positives when detecting SNVs; in addition, due to its repeatable sequence preference, low-amplification regions on the genome are sometimes lost during the amplification process.

[0007] In summary, the above-mentioned single-cell whole genome amplification methods have one or more of the following defects: time-consuming, high cost, inaccurate sequencing, and different amplification methods have a great impact on the sequencing results. Summary of the invention

[0008] In order to solve one or more of the above technical problems, the present application provides a nucleic acid product for constructing a single-cell whole genome sequencing library, characterized in that the nucleic acid product includes a random primer, the random primer includes a sequence as shown in SEQ ID No. 1, and the random primer has a 5' end phosphorylation modification;

[0009] Among them, SEQ ID No.1:

[0010] GAGTGTGAGGGATGGAGATGTGTAGTGNNNNNKKKK.

[0011] The nucleic acid product used in the present application for constructing a single-cell whole genome sequencing library improves the alignment rate and coverage of the single-cell whole genome sequencing library and reduces the CV value of the sequencing library; further, it improves the coverage and uniformity of the single-cell whole genome sequencing data, thereby improving the quality of the sequencing data.

[0012] In one embodiment, the nucleic acid product further comprises a sequencing adapter, which is used to connect to the 5' end of the random primer;

[0013] Optionally, the nucleic acid product satisfies at least one of the following characteristics (1) to (3):

[0014] (1) The nucleic acid product further includes an amplification primer, wherein the amplification primer includes a primer sequence for amplifying a sequencing adapter;

[0015] (2) the sequencing adapter includes a Y-shaped adapter, the sequencing adapter includes a sequence complementary to the amplification primer, and optionally, the sequencing adapter includes a sequence as shown in SEQ ID No. 2 and a sequence as shown in SEQ ID No. 3;

[0016] SEQ ID No.2: ACACTCTTTCCCTACACGACCGCTTCCGATCT;

[0017] SEQ ID No.3:GATCGGAAGAGCACACGTCTGAACTCCAGTC;

[0018] (3) the amplification primers include the sequence shown in SEQ ID No. 4 and the sequence shown in SEQ ID No. 5;

[0019] SEQ ID No.4:

[0020] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTC CCTACACGACGCT;

[0021] SEQ ID No.5:

[0022] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCA GACGTGTGCTC;

[0023] In the above sequence, NNNNNNNN is an 8-bit random base sequence.

[0024] The second object of the present application is to provide a kit for constructing a single-cell whole genome sequencing library, comprising the above-mentioned nucleic acid product;

[0025] Optionally, the kit includes at least one of a pre-amplification reagent, an adapter ligation reagent, and an amplification reagent;

[0026] Wherein, the pre-amplification reagent contains random primers;

[0027] The adapter ligation reagent contains sequencing adapters;

[0028] The adapter amplification reagent contains amplification primers.

[0029] In one embodiment, the pre-amplification reagent further contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, pre-amplification enzyme, DMSO, BSA and dNTP;

[0030] Optionally, the pre-amplification reagent satisfies at least one of the following characteristics (1) to (11):

[0031] (1) The pH value of the pre-amplification reagent is 8-9;

[0032] (2) The concentration of Tris-HCl in the pre-amplification reagent is 10 mM to 50 mM;

[0033] (3) The concentration of KCl in the preamplification reagent is 10mM to 50mM;

[0034] (4) The concentration of (NH4)2SO4 in the pre-amplification reagent is 10mM to 50mM;

[0035] (5) The volume fraction of Triton-X100 in the pre-amplification reagent is 0.1%-0.5%;

[0036] (6) The volume fraction of DMSO in the pre-amplification reagent is 1% to 10%;

[0037] (7) The concentration of BSA in the pre-amplification reagent is 0.1 mg / mL to 1 mg / mL;

[0038] (8) The sum of the base concentrations of dNTPs in the pre-amplification reagent is 0.1 mM to 1 mM;

[0039] (9) the preamplification enzyme includes Taq DNA polymerase;

[0040] (10) The working concentration of the preamplification enzyme is 0.01U-0.5U;

[0041] (11) The working concentration of random primers is 1 μM to 10 μM.

[0042] In one embodiment, the adapter ligation reagent further contains at least one of Tris-HCl, MgCl2, ATP, DTT, PEG6000 and DNA ligase;

[0043] Optionally, the linker ligation reagent satisfies at least one of the following characteristics (1) to (8):

[0044] (1) The pH of the linker ligation reagent is 8.0-9.0;

[0045] (2) The concentration of Tris-HCl in the linker ligation reagent is 10 mM to 50 mM;

[0046] (3) The concentration of MgCl2 in the linker ligation reagent is 10mM to 50mM;

[0047] (4) The concentration of ATP in the adapter ligation reagent is 1 mM to 10 mM;

[0048] (5) The concentration of DTT in the linker ligation reagent is 1 mM to 10 mM;

[0049] (6) The volume fraction of PEG6000 in the linker connection reagent is 1% to 10%;

[0050] (7) The working concentration of DNA ligase in the adapter ligation reagent is 10U to 50U;

[0051] (8) The working concentration of the sequencing adapter is 1 μM to 10 μM.

[0052] In one embodiment, the linker amplification reagent further contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, DMSO, BSA, dNTP and high-fidelity DNA polymerase;

[0053] Optionally, the linker amplification reagent satisfies at least one of the following characteristics (1) to (11):

[0054] (1) The pH value of the adapter amplification reagent is 8-9;

[0055] (2) The concentration of Tris-HCl in the adapter amplification reagent is 10 mM to 50 mM;

[0056] (3) The concentration of KCl in the adapter amplification reagent is 10mM to 50mM;

[0057] (4) The concentration of (NH4)2SO4 in the adapter amplification reagent is 10mM to 50mM;

[0058] (5) The volume fraction of Triton-X100 in the adapter amplification reagent is 0.1%-0.5%;

[0059] (6) The volume fraction of DMSO in the adapter amplification reagent is 1% to 10%;

[0060] (7) The concentration of BSA in the adapter amplification reagent is 0.1 mg / mL to 1 mg / mL;

[0061] (8) The sum of the base concentrations of dNTPs in the adapter amplification reagent is 0.1 mM to 1 mM;

[0062] (9) the amplification enzyme in the linker amplification reagent includes a high-fidelity DNA polymerase;

[0063] (10) The working concentration of the amplification enzyme in the adapter amplification reagent is 1U to 5U;

[0064] (11) The working concentration of the amplification primer is 1 μM to 5 μM.

[0065] In one embodiment, the kit further comprises a cell lysis reagent, the cell lysis reagent comprising at least one of a cell lysis enzyme, Tris-HCl, NP-40 and Triton X-100;

[0066] Optionally, the cell lysis reagent satisfies at least one of the following characteristics (1) to (6);

[0067] (1) The pH value of the cell lysis reagent is 8-9;

[0068] (2) The concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM;

[0069] (3) the volume fraction of NP-40 in the cell lysis reagent is 0.1%-0.5%;

[0070] (4) The volume fraction of Triton X-100 in the cell lysis reagent is 0.1%-0.5%;

[0071] (5) cell lytic enzymes including proteinase K;

[0072] (6) The working concentration of the cell lytic enzyme is 10 μg / mL to 30 μg / mL.

[0073] The third purpose of the present application is to provide a method for constructing a single-cell whole genome sequencing library, obtaining a single-cell whole genome DNA sample, and using the above-mentioned kit to construct a sequencing library of the single-cell whole genome DNA sample.

[0074] In one embodiment, the specific steps of constructing a sequencing library of a single-cell whole genome DNA sample include:

[0075] Pre-amplifying the single-cell whole genome DNA sample to obtain a genome pre-amplification product;

[0076] The genome pre-amplification product is connected to the adapter to obtain a genome adapter ligation product, and the genome adapter ligation product is amplified to obtain a single-cell whole genome sequencing library.

[0077] The fourth objective of the present application is to provide a single-cell whole genome sequencing method, and to perform NGS sequencing on the single-cell whole genome sequencing library constructed by the above method. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0079] Figure 1 The capillary electrophoresis detection result of the nucleic acid fragments of library S1 in Example 2 of the present application;

[0080] Figure 2 The capillary electrophoresis detection result of the nucleic acid fragments of library S2 in Example 2 of the present application;

[0081] Figure 3 The capillary electrophoresis detection result of the nucleic acid fragments of library S3 in Example 2 of the present application;

[0082] Figure 4 The capillary electrophoresis detection result of the nucleic acid fragments of library S4 in Example 2 of the present application;

[0083] Figure 5 The CNV analysis result of the sequencing data of library S1 in Example 2 of the present application;

[0084] Figure 6 The CNV analysis result of the sequencing data of library S2 in Example 2 of the present application;

[0085] Figure 7 The CNV analysis result of the sequencing data of library S3 in Example 2 of the present application;

[0086] Figure 8 This is the CNV analysis result of the sequencing data of library S4 in Example 2 of the present application. DETAILED DESCRIPTION

[0087] References to embodiments of the present application will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present application. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present application without departing from the scope or spirit of the present application. For example, a feature described or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0088] Therefore, it is intended that the present application covers such modifications and variations that fall within the scope of the appended claims and their equivalents. Other objects, features, and aspects of the present application are disclosed in or are apparent from the following detailed description. It will be appreciated by those of ordinary skill in the art that this discussion is merely a description of exemplary embodiments and is not intended to limit the broader aspects of the present application.

[0089] As used herein, the term "primer" refers to an oligonucleotide, whether naturally present in a purified restriction digest or produced synthetically, which can function as a starting point for synthesis when placed under conditions that induce synthesis of primer extension products complementary to a nucleic acid chain (e.g., in the presence of nucleotides and an inducing agent such as a DNA polymerase and at a suitable temperature and pH). The primer is preferably single-stranded for maximum efficiency in amplification, but may alternatively be double-stranded. If double-stranded, the primer is first treated to separate its chains before being used to prepare an extension product. Preferably, the primer is an oligodeoxyribonucleotide. The primer should be long enough to initiate the synthesis of an extension product in the presence of an inducing agent. The exact length of the primer will depend on many factors, including temperature, primer source, and the use of the method. For example, in some embodiments, primers range from 10 to 100 or more nucleotides (e.g., 10-300, 15-250, 15-200, 15-150, 15-100, 15-90, 20-80, 20-70, 20-60, 20-50 nucleotides, etc.).

[0090] As mentioned above, the principle of traditional single-cell whole genome sequencing is to pre-amplify the whole genome of a single cell to obtain the pre-amplification product, and then amplify the pre-amplification product again. After obtaining a high-concentration genome amplification product, the library is constructed. The library construction steps include genome fragmentation, adapter connection and amplification to obtain a complete library. Finally, the genome information of a single cell is obtained through high-throughput sequencing technology to reveal the differences between individual cells or groups. Single-cell sequencing technology is highly dependent on single-cell whole genome amplification technology, and the uniformity and stability of its amplification determine the quality of downstream sequencing results.

[0091] Among them, the exponential amplification characteristics of degenerate oligonucleotide primer PCR amplify the differences between different sequences on the genome, resulting in a lower coverage of the amplified genome. The MDA method has a higher genome coverage than DOP-PCR. The high efficiency and high fidelity of DNA polymerase give the MDA method a significant advantage in the analysis of SNVs and the construction of large fragment libraries; however, like DOP-PCR, the MDA method is still an exponential amplification, so there is still sequence preference in the PCR reaction. Moreover, unlike DOP-PCR, the preference of the MDA method cannot be repeated, so the MDA method is not suitable for CNV analysis.

[0092] The quasi-linear amplification process of the MALBAC method reduces the sequence preference of exponential amplification, and this preference of the MALBAC method is repeatable between different cells. Therefore, CNV analysis can be performed after standardization with reference cells; in addition, due to the uniformity of MALBAC amplification, the knockout rate of the amplified allele is lower, but MALBAC has more false positives when detecting SNVs; in addition, due to the repeatable sequence preference of the MALBAC method, low-amplification regions on the genome are sometimes lost during the amplification process.

[0093] Therefore, traditional single-cell sequencing methods are costly and time-consuming, and have poor versatility and flexibility.

[0094] In order to at least partially solve at least one of the above technical problems, the first aspect of the present application provides a nucleic acid product for constructing a single-cell whole genome sequencing library, the nucleic acid product comprising a random primer, the random primer comprising a sequence as shown in SEQ ID No. 1, and the random primer having a 5' end phosphorylation modification;

[0095] Among them, SEQ ID No.1: GAGTGTGAGGGATGGAGATGTGTAGTGNNNNNKKKK,

[0096] In the sequence, N represents A, G, C or T, and K represents T or G. Specifically, the random primer having a 5'-terminal phosphorylation modification means that the 5'-hydroxyl end of the primer is connected to a phosphate group, which can be used to connect to a linker. The phosphorylation method of the random primer is a conventional phosphorylation method in the art, for example, using T4 polynucleotide kinase (T4 Polynucleotide Kinase, T4 PNK) to catalyze the transfer of the γ-phosphate group of ATP to the 5'-hydroxyl end of the oligonucleotide chain, a random primer having a 5'-terminal phosphorylation modification can be obtained.

[0097] The random primers in the nucleic acid product of the present application have 5'-end phosphorylation modification, and the pre-amplification products thereof can be directly used to construct sequencing libraries without amplification, and can achieve genome enrichment while completing the sequencing library construction process by directly connecting adapters and amplification steps, omitting the step of direct linear amplification of single-cell genomic DNA pre-amplification products in conventional sequencing library construction methods, and quickly achieving whole-genome sequence analysis of single cells, meeting the requirements for rapid conversion of single-cell sequencing products, and further improving the alignment rate and coverage of single-cell whole-genome sequencing libraries, and reducing the CV value of sequencing libraries.

[0098] In some embodiments, the nucleic acid product also includes a sequencing adapter for connecting to the pre-amplification product of the single-cell genomic DNA, and the connection product is further used for amplification to complete library construction while enriching the single-cell genomic DNA.

[0099] In some embodiments, the nucleic acid product further includes an amplification primer, which includes a primer sequence for amplifying a sequencing adapter. The sequencing adapter and the amplification primer are used in combination to simultaneously achieve the enrichment of genomic DNA and the construction of a sequencing library.

[0100] It is understandable that the sequencing connector in the nucleic acid product of the present application refers to the connector used for the NGS sequencing platform. The present application does not restrict the choice of the type of connector used for the NGS sequencing platform. As long as it can connect the pre-amplification product and use it in combination with the amplification product, it can achieve the fixation of genomic DNA on the sequencing chip during the sequencing process, thereby completing the sequencing of single-cell genomic DNA.

[0101] In some embodiments, the sequencing adapter comprises a Y-shaped adapter.

[0102] In some specific embodiments, the sequencing adapter includes the sequence shown in SEQ ID No. 2 and the sequence shown in SEQ ID No. 3;

[0103] SEQ ID No.2: ACACTCTTTCCCTACACGACCGCTTCCGATCT;

[0104] SEQ ID No. 3: GATCGGAAGAGCACACGTCTGAACTCCAGTC.

[0105] In some embodiments, in order to distinguish the sample source of sequencing data, the amplification primers and / or sequencing adapters further include a tag sequence composed of random bases.

[0106] In some specific embodiments, the tag sequence has 8 to 24 bases.

[0107] In some embodiments, the amplification primers include the sequence shown in SEQ ID No. 4 and the sequence shown in SEQ ID No. 5;

[0108] Among them, SEQ ID No.4:

[0109] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTC CCTACACGACGCT;

[0110] SEQ ID No.5:

[0111] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCA GACGTGTGCTC, where NNNNNNNN is a random base sequence of 8 to 24 positions, used to label DNA molecule fragments.

[0112] The second aspect of the present application is to provide a kit for constructing a single-cell sequencing library, including the above-mentioned nucleic acid product. The kit for constructing a single-cell sequencing library in the present application can omit the step of directly linearly amplifying the single-cell genomic DNA pre-amplification product in the conventional sequencing library construction method, quickly realize the whole genome sequence analysis of a single cell, meet the requirements of rapid conversion of single-cell sequencing products, further improve the alignment rate and coverage of the single-cell whole genome sequencing library, and reduce the CV value of the sequencing library.

[0113] In some embodiments, the working concentration of the random primers is 1 μM to 10 μM, further 5 μM to 7 μM, and further 6 μM.

[0114] In some embodiments, the working concentration of the sequencing adapter is 1 μM to 10 μM, further 4 μM to 6 μM, and further 4 μM.

[0115] In some embodiments, the working concentration of each primer in the amplification primers is 1 μM to 5 μM, further 2 μM to 3 μM, and further 2.5 μM.

[0116] In some embodiments, the kit includes a pre-amplification reagent, an adapter ligation reagent, and an adapter amplification reagent, wherein the pre-amplification reagent contains random primers, the adapter ligation reagent contains sequencing adapters, and the adapter amplification reagent contains amplification primers, so as to complete the construction of a library of single-cell whole genome DNA.

[0117] In some embodiments, the preamplification reagent also contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, preamplification enzyme, DMSO, BSA and dNTP to provide a suitable pH environment, reaction raw materials or enzyme catalyst for the preamplification reaction.

[0118] In some embodiments, the pH value of the pre-amplification reagent is 8 to 9, and may further be 8.5.

[0119] In some embodiments, the concentration of Tris-HCl in the pre-amplification reagent is 10 mM to 50 mM, further 20 mM to 30 mM, and further 25 mM.

[0120] In some embodiments, the concentration of KCl in the pre-amplification reagent is 10 mM to 50 mM, further 20 mM to 30 mM, and further 25 mM.

[0121] In some embodiments, the concentration of (NH4)2SO4 in the pre-amplification reagent is 10 mM to 50 mM, further 20 mM to 30 mM, and further 25 mM.

[0122] In some embodiments, the volume fraction of Triton-X100 in the pre-amplification reagent is 0.1%-0.5%, further 0.2%-0.3%, and further 0.25%.

[0123] In some embodiments, the volume fraction of DMSO in the pre-amplification reagent is 1% to 10%, further 3% to 7%, and further 5%.

[0124] In some embodiments, the concentration of BSA in the pre-amplification reagent is 0.1 mg / mL to 1 mg / mL, further 0.03 μg / mL to 0.08 μg / mL, and further 0.5 μg / mL.

[0125] In some embodiments, the sum of the concentrations of the bases of dNTPs in the pre-amplification reagent is 0.1 mM to 1 mM, further 0.5 mM to 0.7 mM, and further 0.6 mM.

[0126] In some embodiments, the pre-amplification enzyme includes Taq DNA polymerase, which is used in combination with random primers to pre-amplify the whole genome of a single cell.

[0127] In some specific embodiments, in order to achieve better pre-amplification effect, the working concentration of the pre-amplification enzyme is 0.01U-0.5U, further 0.1U-0.4U, and further 0.2U-0.3U.

[0128] In some embodiments with 5' end phosphorylation modification, in order to add NGS adapters to both ends of the single-cell genome pre-amplification product, the adapter connection reagent also contains at least one of Tris-HCl, MgCl2, ATP, DTT, PEG6000 and DNA ligase to achieve the connection between the single-cell genome pre-amplification product and the NGS sequencing adapter, so as to facilitate the subsequent amplification to complete the construction of the sequencing library, thereby realizing NGS sequencing of single-cell genomic DNA.

[0129] In some specific embodiments, the pH of the linker ligation reagent is 8.0-9.0; further, it can be 8.5.

[0130] In some specific embodiments, the concentration of Tris-HCl in the linker ligation reagent is 10 mM-50 mM, further 20 mM-30 mM, and further 25 mM.

[0131] In some specific embodiments, the concentration of MgCl2 in the linker ligation reagent is 10 mM-50 mM, further 20 mM-40 mM, further 30 mM.

[0132] In some specific embodiments, the concentration of ATP in the linker ligation reagent is 1 mM-10 mM, further 3 mM-7 mM, further 5 mM.

[0133] In some specific embodiments, the concentration of DTT in the linker ligation reagent is 1 mM-10 mM, further 3 mM-7 mM, and further 5 mM.

[0134] In some specific embodiments, the volume fraction of PEG6000 in the linker connection reagent is 1%-10%, further 3%-7%, and further 5%.

[0135] In some specific embodiments, the working concentration of DNA ligase in the adapter ligation reagent is 10U-50U, further 20U-40U, further 30U.

[0136] In some embodiments with 5'-end phosphorylation modification, in order to obtain a sequencing library of the pre-amplification product, the adapter amplification reagent also contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, DMSO, BSA, dNTP and a high-fidelity DNA polymerase, which is used to amplify the amplification product connected with the adapter to connect the label to obtain a single-cell whole genome sequencing library.

[0137] In some specific embodiments, the pH value of the adapter amplification reagent is 8 to 9, further 8.3 to 8.7, and further 8.5.

[0138] In some specific embodiments, the concentration of KCl in the adapter amplification reagent is 10 mM to 50 mM, further 20 mM to 30 mM, and further 25 mM.

[0139] In some specific embodiments, the concentration of (NH4)2SO4 in the linker amplification reagent is 10mM to 50mM, further 20mM to 30mM, and further 24mM.

[0140] In some specific embodiments, the volume fraction of Triton-X100 in the linker amplification reagent is 0.1%-0.5%, further 0.2%-0.4%, and further 0.3%.

[0141] In some specific embodiments, the volume fraction of DMSO in the linker amplification reagent is 1% to 10%, further 3% to 7%, and further 5%.

[0142] In some specific embodiments, the concentration of BSA in the adapter amplification reagent is 0.1 mg / mL to 1 mg / mL, further 0.3 μg / mL to 0.8 μg / mL, and further 0.5 μg / mL.

[0143] In some specific embodiments, the sum of the base concentrations of dNTPs in the adaptor amplification reagent is 0.1 mM to 1 mM, further 0.2 mM to 0.4 mM, and further 0.3 mM.

[0144] In some specific embodiments, the amplification enzyme includes a high-fidelity DNA polymerase, which is used to amplify the primers connected to the adapters in combination with the index primers to construct a sequencing library.

[0145] In some specific embodiments, in order to achieve better library construction effect, the working concentration of the amplification enzyme is 1U-5U, further 2U-4U, and further 3U.

[0146] In some embodiments, in order to obtain a single-cell whole-genomic DNA sample, the kit further includes a cell lysis reagent to release the genomic DNA in the cell.

[0147] In some specific embodiments, the pH value of the cell lysis reagent is 8 to 9, further 8.3 to 8.8, and further 8.5.

[0148] In some specific embodiments, the cell lysis reagent contains Tris-HCl, which is used to maintain the pH of the cell lysis reagent.

[0149] In some specific embodiments, the concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM, further 20 mM to 30 mM, and further 25 mM.

[0150] In some embodiments, the cell lysis reagent contains a cell lysis enzyme.

[0151] In some specific embodiments, the cell lysis enzyme includes proteinase K, which is a powerful proteinase with high specific activity. It is active in a wide pH range (4-12.5) and at high temperatures (50°C-70°C). In genomic DNA extraction, it is used to enzymatically hydrolyze histones bound to nucleic acids, freeing the DNA in the solution to facilitate subsequent pre-amplification reactions.

[0152] In some specific embodiments, the working concentration of the cell lytic enzyme is 10 μg / mL to 30 μg / mL.

[0153] In some embodiments, the cell lysis reagent contains NP-40.

[0154] In some specific embodiments, the volume fraction of NP-40 in the cell lysis reagent is 0.1%-0.5%, further 0.2%-0.3%, and further 0.25%.

[0155] In some embodiments, the cell lysis reagent contains Triton X-100.

[0156] In some specific embodiments, the volume fraction of Triton X-100 in the cell lysis reagent is 0.1%-0.5%, further 0.2%-0.3%, and further 0.25%.

[0157] The third aspect of the present application provides a method for constructing a single-cell whole genome sequencing library, comprising: obtaining a single-cell whole genome DNA sample, and using the above-mentioned kit to construct a sequencing library of the single-cell whole genome DNA sample.

[0158] Compared with traditional sequencing library construction methods that use single-cell whole genome amplification combined with library construction, such as degenerate oligonucleotide amplification DOP-PCR, multiple displacement amplification MDA, and multiple annealing circular amplification MALBAC, the construction method of the present application omits the step of directly amplifying the amplification products of random primers, simplifies the library construction process, and improves the coverage and uniformity of single-cell whole genome sequencing data. It has the characteristics of extremely simplified library construction process, good library construction quality, and relatively low cost.

[0159] In some specific implementation schemes, the specific steps of constructing a sequencing library of a single-cell whole genome DNA sample include:

[0160] Pre-amplifying the single-cell genomic DNA sample to obtain a pre-amplification product;

[0161] The pre-amplification product is connected to a sequencing adapter, and the pre-amplification product connected to the sequencing adapter is amplified to obtain a single-cell whole genome sequencing library.

[0162] The present application creatively uses random primers with phosphorylation modification at the 5' end to pre-amplify a trace amount of single-cell genome, and directly uses the pre-amplification product for library construction. In addition, in the process of completing the library construction process, the genomic DNA is enriched to obtain high-concentration library DNA, which meets the library concentration requirements of the NGS sequencing platform.

[0163] The fourth aspect of the present application provides a single-cell whole genome sequencing library constructed according to the above method, which has a higher alignment rate and coverage and a lower CV value, thereby improving the coverage and uniformity of single-cell whole genome sequencing data.

[0164] The fifth aspect of the present application provides a single-cell whole genome sequencing method, which performs NGS sequencing on the above-mentioned single-cell whole genome sequencing library, so that the sequencing data has higher coverage and uniformity and lower CV value.

[0165] The implementation scheme of the present application will be described in detail below with reference to examples.

[0166] The nucleic acid composition used in the examples of this application was synthesized by Shanghai Bio-Tech Co., Ltd. The Taq DNA polymerase used in the examples of this application was purchased from Nanjing Novozyme Biotechnology Co., Ltd., with the item number P101-01. The Taq Buffer used in the examples of this application was diluted and prepared by the basic Taq Buffer (10×) provided by the Taq DNA polymerase. Other reagents used in the examples of this application were obtained through conventional commercial channels.

[0167] Example 1

[0168] 1. Single cell isolation

[0169] Obtain cell line samples or tissue samples, prepare them into cell suspensions, and then use micromanipulation, flow cytometry, etc. to prepare the cell suspensions into single cells and distribute them into 0.2 ml PCR tubes. The solution volume is 2.5 μL, for a total of three tubes.

[0170] 2. Cell lysis reaction

[0171] (1) Prepare cell lysis buffer: 25 mM Tris-HCl, 0.25% Triton-X100, 0.25% NP-40, pH 8.5.

[0172] (2) Add 2.5 μL of cell lysis buffer and 0.2 μL of proteinase K to every 2.5 μL of single cell sample, centrifuge briefly, and place in a PCR instrument for reaction. Reaction procedure: 70°C for 10 min; 95°C for 4 min; store at 25°C.

[0173] 3. Pre-amplification reaction

[0174] (1) Prepare the pre-amplification reagents according to Table 1 below.

[0175] Table 1

[0176] Ingredients and concentration Reaction volume μL 250 mM Tris-HCl (pH 8.5) 0.5 250mM KCl 0.5 100 μM random primers 0.3 10mM dNTP 0.3 <![CDATA[250mM(NH4)2SO4]]> 0.5 50% DMSO 0.5 2.5% (v / v) Triton-X100 0.5 5mg / mL BSA 0.5 Nuclease-free water 1.4 total: 5

[0177] The random primer sequence is shown in SEQ ID No. 1. 5 μL of pre-amplification reagent and 0.2 μL of pre-amplification enzyme were added to 5 μL of lysate, and the mixture was centrifuged and placed in a PCR instrument to perform single-cell whole genome pre-amplification reaction.

[0178] (2) The pre-amplification reaction procedure is shown in Table 2.

[0179] Table 2

[0180]

[0181] 4. Ligation reaction

[0182] (1) Prepare a linker connection reagent according to Table 3 below, wherein the linker is a Y-shaped linker, and the sequences are shown in SEQ ID No. 2 and SEQ ID No. 3.

[0183] Table 3

[0184]

[0185]

[0186] (2) After preparation, centrifuge briefly and place in a PCR instrument to perform the reaction.

[0187] The reaction procedure is shown in Table 4.

[0188] Table 4

[0189] cycle temperature time Heating cover 105℃ on 1 20℃ 15min 1 4℃ ∞

[0190] 5. Amplification reaction

[0191] (1) Prepare the adapter amplification reagent according to Table 5 below.

[0192] Table 5

[0193] Element Reaction volume μL 1M Tris-HCl (pH 8.5) 1 1M KCl 1 1M(NH4)2SO4 2 10%(v / v)Triton-X100 1 100%(v / v)DMSO 2 10mg / ml BSA 2 100U high-fidelity DNA polymerase 1.2 10mM dNTP 2.4 Connect products 20 100 μM amplification primer i5 (SEQ ID No. 4) 1 100 μM amplification primer i7 (SEQ ID No. 5) 1 Nuclease-free water 5.4 total: 40

[0194] (3) After the preparation is completed, centrifuge it instantly and place it in a PCR instrument to react. The reaction procedure is shown in Table 6:

[0195] Table 6

[0196]

[0197] 6. Purify the amplified product and sequence it

[0198] (1) Add VAHTS DNA Clean Beads (Vazyme, #N411) at a ratio of 1:1. Add 40 μL of purified magnetic beads to every 40 μL of reaction product, mix by pipetting, and adsorb at room temperature for 5 min.

[0199] (2) Wash twice with 100 μL of 80% ethanol and let dry for 2 min.

[0200] (3) Mix by pipetting 20 μL ddH2O and let stand at room temperature for 2 min to elute to obtain three libraries: T1, T2, and T3.

[0201] (4) The concentration of the obtained product was measured using an ultra-micro spectrophotometer (ThermoFisher, NanoDrop One).

[0202] (5) The obtained products were analyzed for fragment length using a fully automatic nucleic acid electrophoresis analysis system (Bioptic, Qsep100).

[0203] (6) After passing the quality control, the cells were sequenced using the MGISEQ2000 sequencing platform and the PE150 sequencing mode. The sequencing depth was estimated to be about 10x. The sequencing data were compared and analyzed to obtain basic information of the library, as shown in Table 7 below.

[0204] Table 7

[0205] Comparison rate Coverage CV Library T1 99.6 34％ 0.29 Library T2 99.42 36％ 0.31 Library T3 99.52 34.2％ 0.32 Mean 99.51 34.73％ 0.306

[0206] The sequencing results showed that the average alignment rate of the sequenced genome was 99.51, the average coverage rate was 34.73%, and the average CV value was 0.306. The library construction method of the present application significantly improved the alignment rate and coverage of the genome, reduced the CV value, and greatly improved the quality of sequencing data.

[0207] Example 2

[0208] 1. Single cell isolation

[0209] Four groups of single cell samples were obtained from the same patient, and the single cell isolation method was the same as in Example 1.

[0210] 2. Obtain the whole genome of a single cell and sequence it

[0211] The whole genomes of the above four groups of single-cell samples were sequenced according to the following steps (1) to (3).

[0212] (1) Four groups of libraries were constructed, of which the first group of single cells was constructed using the same reaction system and process as in Example 1, and the resulting library was named S1; the second group of single cells was constructed by Single Cell WGA Kit (Takara, #112219) was used for single cell whole genome amplification, and 5 ng of amplified product was taken for Universal Plus DNA Library Prep Kit for MGI (Vazyme, #NDM617) was used to construct the library, and the magnetic beads were washed with 80% ethanol and eluted with ddH2O to obtain the purified library named S2. The third group of single cells were amplified by the whole genome amplification kit MALBACR single cell whole genome amplification kit (Shanghai Yikang Medical Laboratory Co., Ltd., catalog number KT110700150), and 5 ng of the amplified product was taken for The library was constructed by Universal Plus DNA LibraryPrep Kit for MGI (Vazyme, #NDM617), and the magnetic beads were washed with 80% ethanol and eluted with ddH2O to obtain the purified library named S3. The fourth group of single cells was amplified by whole genome amplification kit Qiagen150343REPLI-gSingle Cell Kit (QIAgen, Germany, catalog number 150343). 5 ng of amplified product was taken and Universal Plus DNA Library Prep Kit for MGI (Vazyme, #NDM617) was used to construct the library. The magnetic beads were washed with 80% ethanol and eluted with ddH2O. Finally, the purified library was obtained and named S4. The gel electrophoresis results of the four library fragments are shown in Figures 1 to 4 shown.

[0213] (2) The library concentration was measured using an ultra-micro spectrophotometer (ThermoFisher, NanoDrop One) and the length of the library fragments was analyzed using a fully automatic nucleic acid electrophoresis analysis system (Bioptic, Qsep100). After passing the quality control, the library was sequenced using the MGISEQ2000 sequencing platform and the PE150 sequencing mode. The sequencing depth was estimated to be about 10x. The sequencing data were compared and analyzed to obtain the basic sequencing data of the amplified products.

[0214] (3) Compare the sequencing data with the reference genome sequence, calculate the sequencing alignment rate, coverage and SD value, and use the human cell chromosome detection data analysis system to analyze the data. The results are as follows: Figures 5 to 8 shown.

[0215] 3. Experimental results

[0216] (1) Based on Figures 1 to 4 From the electrophoresis detection results of the four libraries shown, it can be seen that the fragment length distribution of the four libraries S1 to S4 is excellent, and the main peak of the S1 library is symmetrical on both sides, the fragment length distribution is uniform, and the uniformity is the best.

[0217] (2) Table 8 shows the basic data of sequencing of four libraries in Example 2.

[0218] Table 8

[0219] Clean reads Comparison rate Average sequencing depth Coverage SD value Library S1 220153498 99.74 9.73 97.31 1.88 Library S2 214892321 99.32 9.76 92.67 2.26 Library S3 218973217 99.15 9.63 93.49 2.13 Library S4 220203474 98.92 9.52 92.38 2.21

[0220] (2) As can be seen from Table 8, the amount of sequencing data of the four libraries is roughly the same, and there is no significant difference in the alignment rate and average sequencing depth; in terms of coverage, library S1 has a higher coverage; Figures 5 to 8 As can be seen in the figure, the sequencing results of S1 show that the distribution of each chromosome is the most concentrated, and the difference between the data is the smallest.

[0221] The above results show that the NGS single-cell library construction method provided by the present application omits the step of directly amplifying the single-cell whole genome pre-amplification product in the traditional library construction method, compared with the traditional single-cell whole genome amplification and library construction kit combined with each other to construct a single-cell whole genome library. The genomic DNA pre-amplification product is creatively directly connected with a connector before amplification, so that the linear amplification of a trace amount of single-cell whole genome pre-amplification product can be achieved in the library construction operation process, which saves the single-cell genome library construction time and makes the detection process faster; and the single-cell whole genome sequencing effect has higher coverage and uniformity, as well as lower CV value.

[0222] The technical features of the above embodiments may be combined arbitrarily. To make the description concise, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0223] The above embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application shall be subject to the attached claims.

Claims

1. A nucleic acid product for constructing a single-cell whole genome sequencing library, characterized in that: The nucleic acid product includes a random primer, the random primer includes a sequence as shown in SEQ ID No. 1, and the random primer has a 5' end phosphorylation modification; Among them, SEQ ID No.1: GAGTGTGAGGGATGGAGATGTGTAGTGNNNNNKKKK.

2. The nucleic acid product according to claim 1, characterized in that The nucleic acid product also includes a sequencing adapter, which is used to connect to the 5' end of the random primer; Optionally, the nucleic acid product satisfies at least one of the following characteristics (1) to (3): (1) The nucleic acid product further includes an amplification primer, wherein the amplification primer includes a primer sequence for amplifying the sequencing adapter; (2) the sequencing adapter comprises a Y-shaped adapter, the sequencing adapter comprises a sequence complementary to the amplification primer, and optionally, the sequencing adapter comprises a sequence as shown in SEQ ID No. 2 and a sequence as shown in SEQ ID No. 3; SEQ ID No.2: ACACTCTTTCCCTACACGACCGCTTCCGATCT; SEQ ID No.3:GATCGGAAGAGCACACGTCTGAACTCCAGTC; (3) the amplification primer and / or the sequencing adapter further comprises a tag sequence consisting of random bases; (4) The amplification primers include the sequence shown in SEQ ID No. 4 and the sequence shown in SEQ ID No. 5; SEQ ID No.4: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTC CCTACACGACGCT; SEQ ID No.5: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCA GACGTGTGCTC; In the above sequence, NNNNNNNN is a random base sequence of 8 to 24 bits.

3. A kit for constructing a single-cell whole genome sequencing library, characterized in that: Comprising the nucleic acid product according to claim 1 or 2; Optionally, the kit includes at least one of a pre-amplification reagent, an adapter ligation reagent, and an adapter amplification reagent; Wherein, the pre-amplification reagent contains the random primer; The adapter ligation reagent contains the sequencing adapter; The linker amplification reagent contains the amplification primer.

4. The kit according to claim 3, characterized in that The pre-amplification reagent further contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, pre-amplification enzyme, DMSO, BSA and dNTP; Optionally, the pre-amplification reagent satisfies at least one of the following characteristics (1) to (11): (1) The pH value of the pre-amplification reagent is 8 to 9; (2) The concentration of Tris-HCl in the pre-amplification reagent is 10 mM to 50 mM; (3) The concentration of KCl in the pre-amplification reagent is 10 mM to 50 mM; (4) The concentration of (NH4)2SO4 in the pre-amplification reagent is 10mM to 50mM; (5) The volume fraction of Triton-X100 in the pre-amplification reagent is 0.1%-0.5%; (6) The volume fraction of DMSO in the pre-amplification reagent is 1% to 10%; (7) The concentration of BSA in the pre-amplification reagent is 0.1 mg / mL to 1 mg / mL; (8) The sum of the base concentrations of dNTPs in the pre-amplification reagent is 0.1 mM to 1 mM; (9) The pre-amplification enzyme includes Taq DNA polymerase; (10) The working concentration of the preamplification enzyme is 0.01U-0.5U; (11) The working concentration of the random primers is 1 μM to 10 μM.

5. The kit according to claim 3, characterized in that The linker ligation reagent further contains at least one of Tris-HCl, MgCl2, ATP, DTT, PEG6000 and DNA ligase; Optionally, the linker ligation reagent satisfies at least one of the following characteristics (1) to (8): (1) The pH of the linker ligation reagent is 8.0 to 9.0; (2) The concentration of Tris-HCl in the linker ligation reagent is 10 mM to 50 mM; (3) The concentration of MgCl2 in the linker ligation reagent is 10mM to 50mM; (4) The concentration of ATP in the linker ligation reagent is 1 mM to 10 mM; (5) The concentration of DTT in the linker ligation reagent is 1 mM to 10 mM; (6) The volume fraction of PEG6000 in the linker connection reagent is 1% to 10%; (7) The working concentration of DNA ligase in the adapter ligation reagent is 10U to 50U; (8) The working concentration of the sequencing adapter is 1 μM to 10 μM.

6. The kit according to claim 3, characterized in that The linker amplification reagent also contains at least one of Tris-HCl, KCl, (NH4)2SO4, Triton-X100, DMSO, BSA, dNTP and high-fidelity DNA polymerase; Optionally, the linker amplification reagent satisfies at least one of the following characteristics (1) to (11): (1) The pH value of the linker amplification reagent is 8 to 9; (2) The concentration of Tris-HCl in the linker amplification reagent is 10 mM to 50 mM; (3) The concentration of KCl in the linker amplification reagent is 10 mM to 50 mM; (4) The concentration of (NH4)2SO4 in the linker amplification reagent is 10mM to 50mM; (5) The volume fraction of Triton-X100 in the linker amplification reagent is 0.1%-0.5%; (6) The volume fraction of DMSO in the linker amplification reagent is 1% to 10%; (7) The concentration of BSA in the linker amplification reagent is 0.1 mg / mL to 1 mg / mL; (8) The sum of the base concentrations of dNTPs in the adapter amplification reagent is 0.1 mM to 1 mM; (9) The amplification enzyme in the linker amplification reagent includes a high-fidelity DNA polymerase; (10) The working concentration of the amplification enzyme in the linker amplification reagent is 1U to 5U; (11) The working concentration of the amplification primer is 1 μM to 5 μM.

7. The kit according to any one of claims 3 to 6, characterized in that The kit further comprises a cell lysis reagent, wherein the cell lysis reagent comprises at least one of a cell lysis enzyme, Tris-HCl, NP-40 and Triton X-100; Optionally, the cell lysis reagent satisfies at least one of the following characteristics (1) to (6); (1) The pH value of the cell lysis reagent is 8 to 9; (2) The concentration of Tris-HCl in the cell lysis reagent is 10 mM to 50 mM; (3) the volume fraction of NP-40 in the cell lysis reagent is 0.1%-0.5%; (4) The volume fraction of Triton X-100 in the cell lysis reagent is 0.1%-0.5%; (5) The cell lytic enzyme includes proteinase K; (6) The working concentration of the cell lytic enzyme is 10 μg / mL to 30 μg / mL.

8. A method for constructing a single-cell whole genome sequencing library, characterized in that: A single-cell whole-genome DNA sample is obtained, and a sequencing library of the single-cell whole-genome DNA sample is constructed using the kit described in any one of claims 3 to 7.

9. The method according to claim 8, characterized in that The specific steps of constructing the sequencing library of the single-cell whole genome DNA sample include: Pre-amplifying the single-cell whole genome DNA sample to obtain a genome pre-amplification product; Connecting the genome pre-amplification product to a connector to obtain a genome connector connection product; The genomic adapter ligation products are amplified to obtain a single-cell whole-genome sequencing library.

10. A single-cell whole genome sequencing method, characterized in that: The single-cell whole genome sequencing library constructed by the method described in claim 8 or 9 is subjected to NGS sequencing.

Images